Molecular and Biochemical Parasitology 75 (1996) 169- 178

Development of a polymerase chain reaction assay for the diagno- sis of neosporosis using the Neospora caninum 14-3-3 gene’

Nicola C. Lally”**, Mark C. Jenkins”, J.P. Dubeyb

“Parusite Immunobiology Laboratory, USDA, ARS, PIL, Building 1040, Room 100, BARC-East, Beltsville. MD 20705, USA bParasite Biology and Epidemiology Laboratory, USDA, ARS, BeltsviNe, MD, USA

Received 17 July 1995; revised 11 October 1995; accepted 11 October 1995

Abstract

Neospora caninum is a recently described apicomplexan parasite which causes neuromuscular disease in dogs, and

abortion and neonatal morbidity in cattle, sheep and horses. Morphological similarites and serological cross-reactivity between N. caninum and the closely related parasite Toxoplasma gondii, have resulted in the frequent misdiagnosis of neosporosis as toxoplasmosis. This report describes the isolation and characterization of an N. caninum cDNA clone encoding a 14-3-3 protein homologue. The 14-3-3 proteins are a class of proteins which show a high degree of amino acid sequence conservation across several eukaryotic taxa. Using less conserved regions of the N. caninum cDNA clone, nested primers were designed for the amplification of a 614-bp N. caninum DNA fragment by the polymerase chain reaction (PCR). The DNA fragment was amplified from N. caninum genomic DNA, but not from T. gondii, Sarcocystis muris, Sarcocystis tenella, or Sarcocystis cruzi genomic DNA. Additionally, the fragment was amplified from DNA prepared from the brains of N. caninum-infected mice, but not from the brain of a mouse infected with T. gondii. These results suggest that this PCR assay may be useful for the diagnosis of neosporosis.

Keywords: Neospora caninum; 14-3-3 Protein: Polymerase chain reaction

Abbreviations: PCR, polymerase chain reaction; DAI, days after inoculation: ORF, open reading frame

*Corresponding author. Tel.: + 1 301 5048054; Fax: + 1 301 5045306.

’ Note: Nucleotide sequence data reported in this paper have been submitted to the GenBankm database with the accession number U31542.

1. Introduction

Neosporu caninum is an apicomplexan parasite first described causing neuromuscular disease in dogs [1,2]. Neospora parasites have been associ- ated with abortion and neonatal morbidity and mortality in cattle, sheep, goats and horses [3]. Neospora tachyzoites are very similar in morphol- ogy to those of Toxoplasma gondii, and recent studies on the ribosomal RNA sequences of these two parasites have confirmed that they are very

0166-6851/96/$15.00 Q 1996 Elsevier Science B.V. All rights reserved

SSDl 0166-685 1(95)02530-8

170 N.C. Lally et al. / Molecular and Biochemical Parasitology 75 (1996) 169-l 78

closely related. In fact it has been suggested that N. caninum should be placed in the genus Toxo- plasma [4,5]. The lifecycle of Neospora is un- known, tachyzoites and tissue cysts being the only stages so far identified. However, in view of its close phylogenetic relationship to T. gondii, N. caninum is likely to have a similar heteroxenous predator/prey lifecycle.

Neosporosis has now been identified as a major cause of abortion in dairy cattle in California, and many other regions of the world [3,6,7]. The epidemiology of neosporosis is not well under- stood. This is due in part to the inadequacy of current methods of diagnosing the infection. An indirect immunofluorescent antibody test can de- tect antibodies against N. car&urn, however, this does not distinguish between animals with acute infection, and those which have been previously exposed, or congenitally infected. In addition, there appears to be serological cross reactivity because of shared antigens between N. caninum and T. gondii [3,8,9]. Diagnosis of abortion due to Neospora infection mainly relies upon demonstra- tion of the parasite by immunohistochemical staining of sections of aborted foetal tissues. However, this is not always possible because aborted foetuses are often autolysed, and rela- tively few parasites are present.

This report describes the identification and characterization of an N. caninum gene encoding a 14-3-3 protein homologue. The 14-3-3 proteins are a family of evolutionarily conserved eukary- otic proteins which were first isolated from mam- malian brain [lo]. Homologues are found in a variety of eukaryotic taxa, in which they appear to have various functions. Despite the high degree of sequence conservation among 14-3-3 protein genes, the N. caninum sequence was used to de- velop a polymerase chain reaction (PCR) assay for the detection of N. caninum DNA. Using this assay an N. caninum DNA fragment was am- plified from brains of N. caninum-infected mice but not from a mouse infected with T. gondii. Furthermore, DNA prepared from the closely related parasites T. gondii and Sarcocystis species, which also cause abortion in livestock, were not amplified using this assay.

2. Materials and methods

2. I. Parasites

N. caninum tachyzoites of the NC-l [l 11, NC-2 [12], and NC-3 [ 131 isolates were grown in HS-68 cells [8]. Bradyzoites of S. cruzi (B-l isolate [14]), S. tenella (Montana strain [15]), and S. muris (Iowa strain [16]) were obtained from experimen- tally infected calves, sheep and mice, respectively

P71.

2.2. Construction of N. caninum cDNA library and analysis of clone Ncl3.1

Tachyzoite mRNA was extracted from N. can- inum tachyzoites of the NC-l isolate and cDNA prepared using standard procedures [ 181. The lat- ter was used to construct a cDNA library in the bacteriophage expression vector UNI-ZAP XR (Stratagene).

Bacteriophage plaques were screened using serum from a cow that was experimentally in- fected with N. caninum tachyzoites [ 191. pBlue- script SK ~ subclones were prepared by in vivo excision (procedure supplied by Stratagene), and lysates prepared from these clones [20] analysed by Western blotting.

DNA sequencing was performed using the dideoxy chain-termination method [21]. Sequence analysis was carried out using the Genetics Com- puter Group (GCG) Sequence Analysis Software Package [22].

2.3. Experimental infections with N. caninum and T. gondii

Four Swiss Webster mice were inoculated sub- cutaneously with 10’ N. caninum tachyzoites pooled from three strains (NC-l, NC-2 and NC- 3). They were killed 463 days after inoculation (DAI) and their brains examined microscopically for N. caninum tissue cysts. Six to eight 3-mm portions of cerebrum from each mouse were crushed between a glass slide and coverslip, and examined using a 100 x objective.

A second group of three BALB/c mice were each inoculated subcutaneously with 10’ NC-l

N.C. Lally et al. / Molecular and Biochemical Parasitology 75 (1996) 169-l 78 171

tachyzoites. The brains from one mouse killed 22 DAI, and a second mouse that died 23 DA1 were pooled for DNA extraction. The third mouse died 40 DAI. On removal it was noticed that the brain from this mouse was autolysed.

A mouse orally inoculated with oocysts of the ME-49 strain [23] of T. gondii was killed 2 months post-inoculation and the brain removed for prepa- ration of DNA.

2.4. Preparation of DNA samples for PCR

DNA was prepared from Neospora tachyzoites and Sarcocystis bradyzoites by incubating in 50 mM Tris, pH 8.0, 10 mM EDTA, 1% SDS, 100 pg ml - ’ proteinase K, at 50°C for 2 h, foIlowed by extraction with phenokchloroform and ethanol precipitation.

Mouse brains were washed in sterile water to remove excess blood then cut into pieces with a sterile disposable scalpel. DNA was extracted from brain as described for parasites above, ex- cept that the initial incubation at 50°C lasted 16-20 h. DNA prepared from the P strain of T. gondii [24] was kindly provided by Dr Michael White (Montana State University).

2.5. Ampkjication of a 614-bp N. caninum DNA fragment b-y nested PCR

Oligonucleotide primers Ncl3F3 (GAGCAGC- AGCCGAAAGAC) and Ncl3R2 (CCAGTTTG- GGCTGTCATG) corresponding to bp 17 1 - 188 and 1536-1553 of the Nc13.1 DNA sequence, respectively, were used to amplify a fragment of 1382 bp. The secondary amplification was carried out using primers Ncl3Fl (TCGGATCTG- CAAGCAGAC, bp 780-897) and Nc13R4 (TGTCCAACGTGTGCGATG, bp 1376- 1393).

PCR reactions contained 10 mM Tris, pH 8.3, 50 mM KCl, 1.5 mM MgCl,, 0.2 PM each primer, 0.2 mM dNTPs and 25 units ml - ’ Taq poly- merase (Perkin Elmer). Thermocycling consisted of 30 cycles of the following: denaturation, 1 min at 94°C; annealing, 1 min at 58°C; extension, 72°C for 1.5 min (primary amplification) or 1 min (secondary amplification). After the primary am- plification, PCR reactions were diluted 1:lO in

sterile water and 5 ~1 added to the secondary amplification reaction mix.

3. Results

3.1. IdentiJication and characterization of clone Nc13.1

Screening of the cDNA library using serum from experimentally infected cattle resulted in the identification of several immunopositive clones, one of which was designated ANc13.1. A pBlue- script sub-clone prepared from this bacteriophage clone by in vivo excision was used to prepare induced lysates for Western blotting. The pBlue- script sub-clone (BSNcl3.1) expressed a recombi- nant peptide of approximately 40 kDa which was recognised by serum from the N. caninum-infected cow but not by prebleed serum (Fig. 1). This protein was not expressed by a non-recombinant pBluescript control clone.

3.2. Sequence analysis of Nc13.1

The entire Nc13.1 insert was sequenced and found to consist of 1757 bp (Fig. 2) The 3’ end of the clone ends in a run of seven G nucleotides instead of a poly-A tail. It is therefore unclear whether this clone represents a full length tran- script. The sequence was compared with the Gen- Bank DNA sequence database and the highest scoring alignments were with 14-3-3 protein genes, or homologues thereof. In particular, the Nc13.1 region from nucleotide positions 100-800 was approximately 60% identical to the coding regions of several 14-3-3 genes/homologues. The Nc13.1 sequence contains an open reading frame (ORF) extending from the beginning of the insert to a stop codon (TAA) at bp 843-845, which encodes a peptide of 32.5 kDa. This ORF was in frame with the j?-galactosidase sequence encoded by pBluescript. In addition, the calculated molecular weight of this deduced amino acid sequence plus the peptide encoded by the pBluescript vector mw (38.6 kDa) is similar to the apparent molecular weight of the recombinant peptide shown in Fig.

172 N.C. Lally et al. / Molecular and Biochemical Parasitology 75 (1996) 169-I 78

Prebleed Post-infection

-ve Ncl3.1 -ve Ncl3-1

Fig. 1. Western blot analysis of clone BSNcl3.1. This clone expressed a recombinant peptide (arrow) which was recognised by serum from a Neospora-infected cow (Post-infection), but not by prebleed serum. The peptide was not expressed by a non-recombinant pBluescript clone used as a control ( - ve).

1. It was therefore concluded that this recombi- nant peptide is the product of the above-men- tioned ORF. The deduced amino acid sequence of this ORF was compared with the Swissprot protein sequence database and, not surprisingly, the highest scoring alignments were with 14-3-3 proteins/homologues. The Nc13.1 deduced amino acid sequence showed between 55 and 63% iden- tity when aligned with various 14-3-3 proteins/ho- mologues from several taxonomic groups (Fig. 3). On the basis of the multiple alignment it appears that the ATG at positions 48-50 is the start codon of the N. caninum 14-3-3 homologue, al- though the BSNc13.1 clone appeared to express the putative 5’ non-translated region as part of the

fusion protein. This occurred because of the ab- sence of stop codons between the vector-encoded /3 -galactosidase sequence and the above-men- tioned ATG.

3.3. Design of PCR primers, and speciJic ampl$cation of the N. caninum 14-3-3 sequence

PCR primers corresponding to less conserved regions of the N. caninum 14-3-3 gene were de- signed. These regions were either outside the cod- ing region of the putative 14-3-3 protein (Nc13R2 and Nc13R4). Or corresponding to sections of the gene which encode less conserved regions of the 14-3-3 protein (Fig. 3).

N.C. La& et al. / Molecular and Biochemical Parasitology 75 (1996) 169- I78 173

1

64

127

190

253

316

379

442

505

568

631

694

757

820

883

946

1009

1072

1135

1198

1261

1324

1387

1450

1513

1576

1639

1702

CTTTTCCGTCGCTCCCTCTCTTTTTGTCCTGCGTACCTGTATCCAC~TGGCGGAG~T~ MAEEIK

AAAATCTGCGCGATGAATACGTTTACAAGGCGAAGCTTGCGGAGCAAGCGGAGCGCTATGACG NLRDEYVYKAKLAEQAERYDE

AAATGGCGGAGGCCATGAAGAATTTGGTGGAAAACTGCCTCGATGAGCAGCAGCCGAAAGACG MAEAMKNLVENCLDEQQPKDE

AGCTGTCCGTGGAGGAGCGTAACCTCCTCTCTGTTGCGTACAAGAATGCTGTCGGCGCGCGCA LSVEERNLLSVAYKNAVGARR

GAGCCAGCTGGCGCATTATTTCTTCTGTTGAGCAGAAGGA?iCTCAGCAAGCAGCACATGCAAA ASWRIISSVEQKELSKQHMQN

ACAAAGCCCTCGCTGCCGAGTATCGGCAAAAGGTCGAGGAGGAATTGAACAAGATCTGCCACG KALAAEYRQKVEEELNKI C H D

ACATCCTTCAACTTCTCACCGACAAACTCATTCCGAAAACTTCGGACAGTGAGAGTAAGGTGT ILQLLTDKLI PKTSDSESKVF

TCTACTACAAGATGAAGGGAGACTACTACTACCGCTA~TCTCC~GTTCAGTGGC~GGAGG~ YYKMKGDYYRYISEFSGEEGK

AGAAACAGGCTGCTGACCAAGCCCAGGAGTCGTACCAGAAGGCGACCGAAACCGCGGAGGGAC KQAADQAQESYQKATETAEGH

ACTCCCCTGCGACTCACCCTATTCGTCTTGGCCTTGCCTTG~CTACTCTGTCTTCTTCTACG SPATHPIRLGLALNYSVFFYE

AGATCCTCAACTTGCCGCAGCAGGCGTGCGAAATGGCGAAGAGAGCCTTTGATGATGCGATTA ILNLPQQACEMAKRAFDDAIT

CTGAATTTGATAACGTTAGCGAGGACTCTTACAAGGACAGCACTCTTATCATGCAGCTTCTGC EFDNVSEDSYKDSTLIMQLLR

GTGATAACTTGACTCTCTGGACCTCGGATCTGCAAGCAGACCAGCAGCAGCAAGAGGGCGG DNLTLWTSDLQADQQQQEGGE

AGAAGCCCGCTGAGCAGGCTGATCAGTAAATTTTTGGGAATGGAAGGAGTAAAAGTTAACGGG KPAEQADQ*

GATGCTGTCCTCTGGGAAGGCGGGGGGGGAGGCGTTCCGGTCGTGCAAGATCACACTCT

TCCATGAGGAAGTCCGTTGTCTATATATGTCTCGTGTTTGAGTGTGTTCTTTGTACG

GACCAAACTCGTCCTGCGCACGTTACCGCATGAGTGGTAGTTCGCGACGGCTTATGTGTGTAT

CCGACGGGCTAAATGTCGCCAAAAGTGCCTAGTGCCTAGTCT~GGGCCGGCGA~GGGTTTCTCTGTTC

TGCTCTGCGTTCTTCCTTCTCCCGCCTGCTGCTCTTCAAGGTGT

GCACTGATGTGCGTGCGTTTCGGAGTGATAAATAGGGAGGGTTGCTGCGGGCAGTGTCTCCCG

TGTAATCTAATTGAAAACGGGAGAAAATATTTTGGGATCTGCTTTTCTCT

GTATTGAGAGAAAGCGGACCCTGCGGAAGCGAGTTCTCGAGTTCTCGTGT~GTGTTTG~TCGCACACG

TTGGACAGTATACCCGGTAGAGTACAAGAGAAGGGATATTGAGGAAAGACGCAGACGAGT

GGTTTCGTTTGGGCAGAAGCCACCGAGTAGAGTA~GCAGATTTTGAGAT~G~CACTGTCC

GTGACTAGGCACCATATGAGGCGCATGACAGCCCAAACTG

CCTTCGAGGAGTCAGCTCTCCTGGGGGCGCGCGTACACACA

GATATATGTATATTTATCGAATGTTCTTTTTTCACTCCATGCGGTGATAACAAACCTCTCTTA

ACACAGCAGCGACTGTGCTTTCGAGTAAGCCGATCAAAGAACTTAAAAAGGGGGGG 1757

Fig. 2. DNA sequence of the N. caninum Nc13.1 cDNA clone and amino acid sequence of the putative 14-3-3 protein encoded by

nucleotides 48-845. The 5’ NTR region (1-47) appeared to be translated in the BSNcl3.1 clone due to an absence of stop codons,

and to maintenance of the same reading frame between the /?-galactosidase sequence of the vector and the ATG at 48-50. However,

on the basis of the multiple alignment shown in Fig. 3, it is believed that the ATG at 48-50 is the translational start site of this

gene in vivo.

174 N.C. Lally et al. / Molecular and Biochemical Parasitology 75 (1996) 169- 178

E.histo beta zeta epsilon A.thali D.melan C. elega S .cerev

. . . . . MAS-E

. . . . . . MDKS

. . ...* MDKN

. . . ..MDD-E

. . ..MASG-E

. . . MSTVDKFI

. . . . MSDTVEi

. . ..MSQT-E

DC--T-___-

-L-Q_____-

-L-Q-----_

,,L-_Q---mm

-L--M_---_

_L_Q_____-

-L-Q&-___

DS-_L_---_

-S----E-VQ C--QVA.... ------D--A ---AV..T.. ------D--A C--SV..T.. -----w--V- S--KVA...G -----E--V- F-EKV..SAA -S----D--Q ---SV..T.. ------D--A ---m..T..

-----E--V- N--AVA.SS.

.EME..A---

.EQ.GH.---

.EQ.G.A---

..M..DV--T VD..G.---T .ET.G.V--- .EQ.GQ.--- . ..GQ.---

60 VEERNLLSVA I_______-- N_------__ N_-------_

---____--- N __--_____ N_-_-___-_

----_-__--

120 N.canin YKNAVGARRA SWRIISSVEQ KELSKQHMQN K.ALAAEYRQ KVEEELNKIC HDILQLLTDK E.histo ---VI--K-- ------- L -- --QA-G.NDK HVEIIKG--A -I-K-LSTC- D-V-KVIQEN beta ---V-----S ---V-_-I-- -..TE_wEK -QQMGK--- E -I-A--QD-- N-V-E--DKY zeta ___V____-S ---W--I-- -..TEG.AEK -QQM-R---E -I-T--RD-- N-V-S--Em epsilon ___VI_____ ____-__ I __ --EN-G.GED -LI<MIR-s-Q M--T--~-- C---,,V-,,m

A.thali ---VI----- -------I-- --E-RG.NDD HVTAIR--- S -I-T-LSG-- DG--K--DSR D.melan ---V-----S ---V---I-- -..TEA.SAR -QQ-AR--- E R--K--RE-- YEV-G--DKY C.elega ---V-----S ---V---I-- -_.TEG.SEK -QQ--K---V ---Q---D-- Q-V-K--DEF

S.cerev _--VI_____ ----V--I__ --E--EKSEH QVE-IRS--S -I-T--T-IS D---SV-DSH

180 N.canin LIPKTSDSES KVFYYKMKGD YYRYISEFSG EEGKKQAADQ AQESYQKhTE TAEGHSPATH E_histo -L--A-T--- ---FK--E-- ----FA--TV D-KR-EV--K SLAA-TE--- ISNAF,LAP-- beta ---NATQp-- ----L---mm -F--L--VAS GDN-QTTVSN S-QA--E-F- ISKKEXQP-- zeta --..NA_QA-- ----L--m-- ----LA-VAA GDD--GIV-- S-QA--E-F- ISmMQp--

epsilon ---AANTG-- _______--_ -H---A--AT GNDR-E--EN SLVA-m-SD I-MTEL-P-- A.thali ---AAASGD- ----L----- -H--LA--KT GQER-D--EH Tm-KS-QD I-MLAp--

D.melan ----ASNP-- ----L----- ----LA-VAT GDARNTW-D S-TA--D-FD ISK-KMQP-- C.elega --V-AGAA-- -A--L----- ----LA-VAS -D.RAAVVEK S-KA--E-LD I-KDKMQP-- S.cerev -_-SATTG-_ _______--_ -H--L&--- S GDAREK-TNS SL-A-KT-S- I-TTEL-P--

N.canin E.histo beta zeta epsilon A.thali D.melan C.elega S.cerev

PIRLGLALNY SVFFYEILNL PQQACEMAKR AFDDAITEFD -_---u---F ---YF--mD mK_-QL--Q ______ AKL- ---___---F ---y-- -e-S -EK--SL--T ---E--A-&

-------m-F ---~-----S -EK--SL--T ---E--A-L_

____---__ F ---y-----S -DR--J&--J, ------A-L-

---------F ---y-----S -DR--NL-_Q ---E--A-L-

---------F ---y-----s -DK--QL--Q ------A-L-

_____--m-F ---Y---_-T -EH--QL--Q ------A-L_

-a---_-m-F ---y---Q-S -DK--H&-Q ------A-L-

240 NVSEDSYKDS TLIMQLLRDN E-P-NM---- ----_---__ TLN-E--w_- ___-----__ TL--E--w-- --__--____ TL--E--e-- --______-- TLG-E---w- ____-_--__ TLN------- --___---__ TLN------- __---_--__ TL__E----- ________-_

Ncl3Fl 284 N.canin LTLWTSDLQA DQQQQEGGEK PAEQADQ... . . . . . . . . . . . . . . E.histo -------ACD EE........ . . . . . . . . . . . . . . . . . . . . _... beta ------EN-G -EGDAGE--N . . . . . . . . . . . .._....._ ._._ zeta -------T-G -WE-GE N......... . . . . . . . . . . . . . . epsilon -------M-G -GEE-m QDVEDENQ.. . . . . . . . . . . . . . . A.thali -------M-D -AADEIKEAA APKPTEEQQ. . . . . . . . . . . . . . . D.melan -------T-G -EAEPQE-GD N......... .._....... . .._ C.elega ---- ---VG- ED-E---NQE AGN....... . . . . . . . . . . . . . . S_cerev ------- ISE SG-EDQQQQQ QQQ-QQ-QQQ QQAPAEQTQG EPTK

Fig. 3. Multiple alignment of the N. caninum 14-3-3 protein sequence with those of 14-3-3 proteinsjhomologues from other

eukaryotes. A hyphen indicates an amino acid that is identical to that in the N. caninum sequence. Sequences are from three

mammalian isoforms, (beta, zeta and epsilon, accession numbers P31946, P29312, 219599), Entamoeba histolytica (U13418), plant (Arabidopsis thaliana, Q01525), Drosophila melanogaster (P293 IO), nematode (Coenorhabditis elegans UO5038), and Saccharomyces cereuisiue (P34730). Full stops indicate gaps introduced to optimise the alignment. Less conserved regions of the protein encoded by

the DNA sequence corresponding to primers Ncl3Fl and Nc13F3 are shown.*(e)*

N.C. Lally et al. / Molecular and Biochemical Parasitology 75 (1996) 169- 178 175

A two-step nested PCR assay was employed using primers Nc13F3 and Nc13R2 for the pri- mary amplification, followed by primers Ncl3Fl and Ncl3R4 to amplify a 614-bp fragment of the N. caninum 14-3-3 gene. The gene fragment was amplified from N. caninum tachyzoite DNA, but not from DNA prepared from T. gondii, S. cruzi, S. tenella or S. murk (Fig. 5). The PCR assay was also carried out using DNA prepared from the brains of mice that were inoculated with N. can- inum tachyzoites. Three of four DNA prepara- tions from mice killed 463 DA1 were positive by the PCR assay, whereas N. caninum tissue cysts were identified by microscopic examination in only two. In addition, DNA preparations from pooled brains of mice killed 22 and 23 DAI, and a mouse which died 40 DA1 were both positive (Fig. 4). DNA from a T. gondii-infected mouse brain was negative (Fig. 4).

To estimate the sensitivity of detection of Neospora parasites in murine brain, PCR reac- tions were carried out using DNA extracted from uninfected brain, to which was added Neospora DNA extracted from a known number of tachy- zoites. The 614-bp band was amplified from as few as 25 tachyzoites in a 50-~1 PCR reaction in the presence of DNA from 5 mg of brain tissue. This is equivalent to 5000 parasites per g of brain tissue.

4. Discussion

This report describes the isolation of an N. caninum gene encoding a 14-3-3 homologue using serum from an experimentally infected bovine. Antibody responses directed against evolutionar- ily conserved proteins are not unusual during infection with pathogenic organisms. Indeed, many pathogens elicit high antibody titres to evo- lutionarily conserved heat shock proteins [25]. However, it seems unlikely that an antibody re- sponse to the Neospora 14-3-3 homologue is a common feature of bovine neosporosis since only one of nine experimentally infected bovine sera contained antibodies to the recombinant 14-3-3 homologue (not shown). In addition, neither of two bovine sera which were believed to be natu-

rally infected with N. caninum recognised the re- combinant antigen (not shown).

The 14-3-3 proteins are a family of proteins which were first isolated from mammalian brain [lo]. Seven isoforms exist in mammalian tissues, and 14-3-3 homologues have been isolated from several eukaryotic organisms from various taxo- nomic groups, including plants [26], insects [27], amphibians [28], yeast [29] and protozoa (Gen- Bank accession numbers U13418-20). This is the first report of a 14-3-3 homologue from an api- complexan. Several properties have been at- tributed to 14-3-3 proteins. These include cell signalling processes as well as regulation of growth and development [30]. In mammalian

bp

1353 \ 1078\

872-

603-

Fig. 4. Agarose gel electrophoresis of PCR products. Lane 1, negative control (no substrate DNA added); lane 2, 1%‘. can- inum DNA (250 tachyzoites); lanes 3-6, DNA prepared from brains of mice which were killed 463 DA1 with N. caninum tachyzoites; lane 7, DNA prepared from pooled brains of two mice 22 and 23 DA1 with N. caninum; lane 8, DNA from the brain of a mouse 40 DA1 with N. caninurn; lane 9. DNA prepared from the brain of a mouse killed two months after experimental inoculation with T. gondii (ME-49 strain).

176 N.C. Lally et al. / Molecular and Biochemical Parasitology 75 (1996) 169-l 78

bP 123456

135

107

87

603-

Fig. 5. Agarose gel electrophoresis of PCR products. Lane 1, negative control; lane 2, N. caninum DNA (250 tachyzoites); lanes 3-6, approximately 10 ng of DNA from T. gondii (P strain), S. cruzi, S. tenella and S. murk, respectively.

brain, 14-3-3 is involved in the activation of ty- rosine and tryptophan hydroxylases, which are essential for the biosynthesis of certain neuro- transmitters [31]. 14-3-3 also appears to play a role in kinase-mediated signal tranduction through inhibition of protein kinase [32,33].

A yeast 14-3-3 homologue may be involved in growth regulation [29], and a plant 14-3-3 homo- logue appears to be associated with a DNA bind- ing complex which is involved in transcriptional regulation [26]. The function of the N. caninum 14-3-3 homologue is unknown. However, the

widespread conservation of this class of proteins suggests that it may be of fundamental impor- tance in the functioning of eukaryotic cells.

Despite the high degree of amino acid sequence conservation among 14-3-3 proteins of different species, certain regions of the protein were iden- tified which appear to be less conserved. In addi- tion, it was noticed that the DNA sequences downstream from the various 14-3-3 genes showed considerably less similarity to one another than the coding regions. These less conserved regions were chosen for the design of PCR primers. Initially, primers Ncl3Fl and Nc13R2 were used to amplify a fragment of 655 bp. This worked well on purified N. caninum DNA, how- ever, amplification of the N. caninum DNA frag- ment from infected mouse brains was not achieved using this method (not shown). It was then decided to use a nested PCR approach. Using this two-step assay a 614-bp DNA frag- ment was amplified from purified N. caninum tachyzoite DNA. PCR reactions using DNA from T. gondii, S. cruzi, S. tenella and S. murk indi- cated that the PCR assay is specific for N. can- inum. In addition to amplifying the fragment from purified N. caninum tachyzoite DNA it was also amplified from the brains of three mice killed 463 days after experimental inoculation with N. can- inum tachyzoites. It was also amplified from two DNA samples prepared from mice killed 22-23 and 40, DA1 respectively. PCR reactions carried out using DNA extracted from a known number of tachyzoites indicated that the assay may be able to detect parasites in brain tissue containing 5000 parasite genomes per g. However, the signifi- cance of such an estimate of sensitivity is unclear since it is not known how many parasites are likely to be present in infected tissues, and the stage present in such tissues is the tissue cyst containing bradyzoites, not the tachyzoite as was used in this study.

The ability to specifically amplify a fragment of an N. caninum gene from infected mouse tissue suggests that this test may be useful for the diag- nosis of neosporosis. Currently, neosporosis can be diagnosed by immunohistochemical staining of tissue sections prepared from biopsy material or aborted foetal tissue. The PCR assay may prove

N.C. Lally et al. / Molecular and Biochemical Parasitology 75 (1996) 169-I 78 177

to be a useful alternative to this existing tech- nique. It may be particularly useful for testing aborted foetal tissue which may be severely au- tolysed, and therefore impossible to process for immunohistochemical staining. In this respect it is encouraging that the PCR assay gave a positive result using DNA prepared from an infected mouse brain that was autolysed. Further evalua- tion of this PCR as a diagnostic test for neosporo- sis should involve comparison with existing diagnostic tests. In addition to testing tissue sam- ples for the presence of N. caninum parasites it may be possible to detect the parasites in other clinical samples from infected animals. An evalua- tion of two PCR methods for the detection of T. gondii found that parasite DNA could be detected in the blood of experimentally infected sheep up to 10 days post-infection, and in lymph up to 12 days post-infection [34]. If the PCR assay can detect N. caninium parasites in blood or lymph of infected animals it could be used in conjunction with serological tests to distinguish between ani- mals which are acutely infected, and those which have been previously infected, or are harbouring a chronic infection. This would be invaluable in studies of the epidemiology of neosporosis. An- other aspect of N. caninum which is in particular need of further investigation is the lifecycle. The parasite is believed to undergo sexual reproduc- tion in the gut of an unknown carnivorous host, resulting in the excretion of oocysts. PCR amplifi- cation of N. caninum DNA either from faeces or gut contents may enable identification of the definitive host.

References

[I] Bjerkas, I.. Mohn, S.F. and Presthaus, J. (1984) Uniden- tified cyst-forming sporozoan causing encephalomyelitis and myositis in dogs. Z. Parasitenkd. 70, 271-274.

[2] Dubey. J.P., Carpenter. J.L., Speer, C.A., Topper, M.J. and Uggla, A. (1988) Newly recognised fatal protozoan disease of dogs. J. Am. Vet. Med. Assoc. 192, 126991285.

[3] Dubey, J.P. and Lindsay D.S. (1993) Neosporosis. Para- sitol. Today 9, 452-458.

[4] Ellis, J., Luton, K., Baverstock, P.R., Brindley, P.J., Nimmo, K.A. and Johnson, A.M. (1994) The phylogeny of Neospora caninum. Mol. Biochem. Parasitol. 64, 3033 311.

[51

WI

[71

181

[91

UOI

[ill

P4

Holmdahl, O.J.M.. Mattson, J.G., Uggla, A. and Jo- hanssen, K.-E. (1994) The phylogeny of Neospora can- inum and Toxoplasma gondii based on ribosomal RNA sequences. FEMS Microbial. Lett. 119, 187-192. Anderson, M. L, Blanchard, P.C., Barr, B.C.. Dubey. J.P., Hoffman, R.L. and Conrad, P.A. (1991) Neospora- like protozoan infection as a major cause of abortion in California dairy cattle. J. Am. Vet. Med. Assoc. 198, 241-244. Anderson, M., Palmer. C., Thurmond, M., Picanso, J., Blanchard. P.. Breitmeyer, R., Layton, B.. McAllister. M., Daft. B.. Kinde, J., Read, D., Dubey, J.P. Conrad, P. and Barr, B. (1995) Evaluations of abortions in cattle attributable to neosporosis in selected dairy herds in California. J. Am. Vet. Med. Assoc. 207, 1206- 1210. Bjerkas, I., Jenkins, M.C. and Dubey, J.P. (1994) Identifi- cation and characterization of Neospora caninum tachy- zoite antigens useful for diagnosis of neosporosis. Clin. Diagn. Lab. Immunol. 1, 214-221. Conrad, P.A., Sverlow, K., Anderson, M., Rowe. J., BonDurant, R., Tuter, G., Breitmayer, R.. Palmer. C.. Thurmond, M., Ardans, A., Dubey, J.P., Duhamel. G. and Barr, B. (1993) Detection of serum antibody re- sponses in cattle with natural or experimental Neospora infections. J. Vet. Diagn. Invest. 5, 5722578. Moore, B.W. and Perez, V.J. (1967) In: Physiological and Biochemical Aspects of Nervous Integration, (Carlson. F.D., ed.). pp. 343-359. Prentice-Hall, Englewood Cliffs, NJ. Dubey, J.P., Hattel, A.L., Lindsay. D.S. and Topper, M.J. (1988) Neonatal Neospora caninum infection in dogs: Isolation of the causative agent and experimental trans- mission. J. Am. Vet. Med. Assoc. 193, 1259- 1263. Hay, W.H., Shell, L.C., Lindsay, D.S. and Dubey, J.P. (1990) Diagnosis and treatment failure of Neospora can- inum infection in a dog. J. Am. Vet. Med. Assoc. 197. 87789.

[13] Lindsay, D.L., Dubey. J.P. and Blagburn. B.L. (1991) Characterization of a Neospora caninum (Protozoa: Api- complexa) isolate (NC-3) in mice. J. Alabama Acad. Sci. 62, l-8.

[14] Fayer, R. and Dubey, J.P. (1984) Protective immunity against clinical sarcocystosis in cattle. Vet. Parasitol. 15. 1877201.

[15] Dubey, J.P., Speer, C.A., Callis, G. and Blixt, J.A. (1982) Development of the sheep-canid cycle of Sarcoqstis tenella. Can. J. Zool. 60, 246442477.

[16] Last. M.J. and Powell, E.C. (1978) Separation of Sarco- cystis muris and Isospora j&s in mice used by Powell and McCarley (1975) in studies on the life cycle of S. muris. J. Parasitol. 64, 162- 163.

[17] Dubey, J.P.. Speer, C.A. and Fayer, R. (1989) Sarcocysto- sis of animals and man. CRC Press, Boca Raton. Florida.

[18] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual Second Edi- tion. Cold Spring Harbor Laboratory Press.

178

[I91

PO1

Pll

[221

1231

1241

P51

WI

N.C. L&J et al. / Molecular and Biochemical Parasitology 75 (1996) 169-I 78

Dubey, J.P., Lindsay, D.S., Anderson, M.L., Davis, SW. and Shen, SK. (1992) Induced transplacental transmis- sion of Neospora caninum in cattle. J. Am. Vet. Med. Assoc. 201, 7099713. Carroll, S.B. and Laughon, A. (1987) Production and purification of polyclonal antibodies to the foreign seg- ment of P-galactosidase fusion proteins. In: DNA Cloning (Glover, D.M., ed.), Vol. III, pp. 89-111. IRL Press, Oxford. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467. Devereux, J., Haeberli, P. and Smithies, 0. (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12, 387-395. Lunde, M.N. and Jacobs,’ L. (1983) Antigenic differences between endozoites and cystozoites of Toxoplasma gondii. J. Parasitol. 69, 806-808. Ware, P.L. and Kaspar, L.H. (1987) Strain-specific anti- gens of To.xopfasma gondii. Infect. Immun. 55, 7788783. Kaufman, S.H.E. (1990) Heat shock proteins and the immune response. Immunol. Today 11, 129- 136. De Vetten, N.C., Lu, G. and Ferl, R.J. (1992) A maize protein associated with the G-box binding complex has homology to brain regulatory proteins. Plant Cell 4, 1295-1307.

[27] Swanson, K.D. and Ganguly, R. (1992) Characterization of a Drosophila melanogaster gene similar to the mam- malian genes encoding the tyrosine/tryptophan hydroxy- lase activator and protein kinase C inhibitor proteins. Gene 113. 183-190.

[28] Martens, G.J.M., Piosik, P.A. and Danen, E.H.J. (1992) Evolutionary conservation of the 14-3-3 protein. Biochem. Biophys. Res. Commun. 184, 1456-1459.

[29] Van Heusden, G.P.H., Wenzel, T.J., Lagendijk, E.L., De Steensma, J.Y. and Van Den Berg, J.A. (1992) Character- ization of the yeast BMHl gene encoding a putative protein homologous to mammalian protein kinase II acti- vators and kinase C inhibitors. FEBS Lett. 302, 145-150.

[30] Aitken, A., Collinge, D.B., Van Heusden, B.P.H., Isobe, T., Roseboom, P.H. and Soll, J. (1992) 14-3-3 Proteins: a highly conserved, widespread family of eukaryotic proteins. TIBS 17, 4988501.

[31] Ichimura, T., Isobe, T., Okuyama, T., Takahashi, N., Araki, K., Kuwano, R. and Takahashi, Y. (1988) Molec- ular cloning of cDNA coding for brain-specific 14-3-3 protein, a protein kinase-dependent activator of tyrosoine and tryptophan hydroxylases. Proc. Natl. Acad. Sci. USA 85, 708447088.

[32] Toker, A., Ellis, C.A., Sellers, L.A. and Aitken, A. (1990) Protein kinase C inhibitor proteins. Purification from sheep brain and sequence similarity to lipocortins and 14-3-3 protein. Eur. J. Biochem. 191, 421-429.

[33] Hirsch, S., Aitken, A., Bertsch, U. and Soll, J. (1992) A plant homologue to mamalian brain and 14-3-3 protein kinase C inhibitor. FEBS Lett. 296, 222-224.

[34] Wastling, J.M., Nicoll, S. and Buxton, D. (1993) Com- parison of two gene amplification methods for the detec- tion of Toxoplasma gondii in experimentally infected sheep. J. Med. Microbial. 38, 360-365.