Development of a Protocol for Efficient DNA Extractionof Patulin-Producing Molds from Food for SensitiveDetection by PCR

M. Isabel Luque & María J. Andrade &

Alicia Rodríguez & Mar Rodríguez & Juan J. Córdoba

Received: 10 June 2011 /Accepted: 1 September 2011 /Published online: 17 September 2011# Springer Science+Business Media, LLC 2011

Abstract Early detection of patulin-producing molds infoodstuffs is very important for food industry and forensuring the consumers’ health. For precise and sensitivedetection of patulin-producing molds by polymerase chainreaction (PCR) protocol, a previously efficient DNAextraction from foods is necessary, since variations in theefficiency can affect the detectability. In this study, eightdifferent DNA extraction methods including a wide varietyof treatments were assayed and compared in order to selectthe most efficient. Methods which combined thermalconidia breakdown and DNA commercial extraction kitsreached higher yields, obtaining more quantity and qualityin DNA extraction than those methods without extractionkit. In the present work, a simple method for fungal DNAextraction which is relatively rapid by means of minimizingthe use of costly chemicals such as sodium dodecyl sulfate,mercaptoethanol, etc., or dangerous such as phenol/chlor-ophorm, was developed. When the detection limits wereevaluated after PCR amplification using DNA from nineinoculated food matrices with the eight methods tested, themethod including thermal conidia breakdown, extractionwith cetyl trimethylammonium bromide/phosphate-bufferedsaline (1:2) buffer, and E.Z.N.A. Fungal DNA Mini Kit waschosen as the most adequate for detecting patulin-producing molds by PCR. This method allowed detectionlimits ranged from 102–103 conidia/g.

Keywords Patulin . Foodstuffs .Molds . PCR . DNAextraction

Introduction

Patulin is a potent mycotoxin produced mainly by Penicilliumspp. (Dombrink-Kurtzman and Blackburn 2005; Niessen2007) but also by Aspergillus spp. (Steiman et al. 1989;Varga et al. 2003). Patulin has been found mostly in applesand other fruits (Cheraghali et al. 2005) as consequence ofmold contamination. In addition, several species of Asper-gillus and Penicillium genera frequently isolated in dry-curedmeat products and ripened cheeses have been described aspatulin-producing (Erdogan et al. 2003; Erdogan and Sert2004; Martín et al. 2004).

Early detection of patulin-producing molds in foodproducts throughout the entering food chain and elimina-tion of contaminated raw materials or processed foods maybe of great interest to prevent patulin formation. DNA-based methods such as the polymerase chain reaction(PCR) are being used as an alternative to culture-basedmethods for the detection of molds in a variety ofenvironments including foods (Miller et al. 2003; Zur etal. 2002). For precise and sensitive detection of patulin-producing molds by PCR protocol, a previously efficientDNA extraction from foods is necessary, since variations inthe efficiency can affect the following amplification andconsequently the detectability.

The principal factor affecting the DNA extraction fromfoods belonged to food components, which act as inhibitoryto PCR, by interfering with cell lysis (i.e., DNA extraction),contributing to nucleic acid degradation, or inhibiting TaqDNA polymerase (Rossen et al. 1992; Wilson 1997).Strategies to purify target DNA from foods, thereby

M. I. Luque :M. J. Andrade :A. Rodríguez :M. Rodríguez :J. J. Córdoba (*)Higiene y Seguridad Alimentaria. Facultad de Veterinaria,Universidad de Extremadura,Avda. de la Universidad s/n,10003 Cáceres, Spaine-mail: jcordoba@unex.esURL: http://higiene.unex.es

Food Anal. Methods (2012) 5:684–694DOI 10.1007/s12161-011-9298-x

reducing the concentration of PCR inhibitory components(calcium ions, fats, and proteins), typically include solvent-based extraction methods (Drake et al. 1996), specializedlysis buffers (Dickison et al. 1995; Rossen et al. 1992), and/or nucleic-acid-binding matrices (Wilson 1997). Further-more, the efficiency of the cell lysis and the nucleic acidpurification methods used to recover DNA templates arefactors of great importance in the final success of DNAextraction (Wilson 1997). This concern must be especiallyconsidered when a PCR method is developed to detectmolds because of the well-known resistance of their sporesto lysis and the potential presence of inhibitory compoundsin their cells (Martin and Haider 1971).

The methods described for DNA extraction from puremold strains have included digestion enzymes such asproteinase K and lyticase (Chen et al. 2002; Karakousis etal. 2006), liquid nitrogen and grinding with mortar (Dean etal. 2004; Sánchez et al. 2008), or DNA isolation kits (Filionet al. 2003; Maaroufi et al. 2004). Methods for DNAextraction from foods to be used in PCR may combine theabove steps, but efficiency in DNA yield and subsequentPCR results should be evaluated. In addition, severalauthors have pointed out that no single method is validto complete DNA extraction for all species of molds(Karakousis et al. 2006) and that each species requires aspecific method to efficiently obtain DNA templates. Itshould be of great interest to develop an efficient DNAextraction from food for any of patulin-producing species tobe used to detect them by PCR.

The purpose of this work was to evaluate differentprotocols of DNA extraction from foods that combinebuffers of extraction, enzyme digestion, and commercialkits to develop an efficient method of DNA extraction frompatulin-producing molds in food matrices to be used forPCR detection.

Materials and Methods

Mold Strains

Ten reference mold strains belonged to Penicillium andAspergillus genera were used in this study (Table 1). Five ofthese strains were typified as patulin producing in theirrespective culture collections. In addition, all of the strainsdemonstrated patulin production after growing on maltextract agar (MEA, 2% malt extract, 2% glucose, 0.1%peptone, and 2% agar), at 25 °C for 15 days and subsequentanalysis of patulin by micellar electrokinetic capillaryelectrophoresis, based on the absorbance spectrum rangingbetween 190 and 600 nm (Martín et al. 2004) and also byhigh-pressure liquid chromatography-mass spectrometry(MS), with the achievement of full MS after atmosphericpressure chemical ionization (Núñez et al. 2007).

Preparation of Mold Conidia and Inoculation of FoodMatrices

All mold strains were grown for 20 days at 25 °C on MEAto obtain conidia solution. Conidia were extracted floodingthe MEA plates with 5 ml of sterile deionized watercontaining 10% (v/v) glycerol (Scharlau Chemie S.A.,Barcelona, Spain) and rubbing the surface with a glassrod. The resulting suspensions were stored at −80 °C untilbeing used. A conidia suspension of each mold strainsassayed was initially quantified by microscopy, using aNeubauer counting chamber, and decimal dilutions weremade to inoculate foods. Non-sterile commercial foodswere inoculated in separate assays with each one of theprepared dilutions of conidia in sterile bags to reach a finalconcentration ranging from 10 to 106 conidia per gram offood matrix.

Table 1 Patulin-producing mold strains used in this study

Species designation Strain reference Collection information Source

Penicillium camemberti CECT 2267 Unknown Pork meat

Penicillium commune CBS 311.48 Unknown Cheese

P. commune CBS 341.59 Unknown Unknown

Penicillium dipodomyicola IBT 26223 Producer Chicken feed mixture

Penicillium expansum CECT 2278 Producer Dry-fermented sausage “salchichón”

P. expansum CECT 2279 Producer Bulgarian salami

P. expansum CECT 2280 Unknown Apple

Penicillium griseofulvum CBS 485.84 Producer Grain of Hordeum vulgare

P. griseofulvum CBS 110.420 Producer Soil

Aspergillus terreus CBS 601.65 Unknown Unknown

CECT Spanish Type Culture Collection, CBS Centraalbureau voor Schimmelcultures (The Netherlands), IBT Type Culture Collection of theDepartment of Biotechnology from the Technical University of Denmark (IB), Unknown without previous information about patulin productionby culture collections, Producer positive mycotoxins production about information collections

Food Anal. Methods (2012) 5:684–694 685

DNA Extraction Protocol

Eight methods, which included different lysis and extrac-tion buffers, enzymatic treatment, and conditions of DNAextraction and DNA extraction kits, were evaluated toextract DNA from different inoculated food matrices. Thus,a 10-fold dilution ranging from 10 to 106 conidia/g were setup with Penicillium commune CBS 311.48, Penicilliumgriseofulvum CBS 110.420, and Penicillium expansumCECT 2280 for cooked products (cooked ham, cookedturkey breast, and mortadella), ripened foods (dry-curedham, dry-fermented sausage “Salchichón,” and ripenedcheese), and fruits (apple, peach, and pear), respectively(Table 2). In all of the assayed methods, 5 g of inoculatedfoods were homogenized with 10 ml of Tris–HCl buffer(pH 8.0) in a filter bag BagPage (Interscience, Paris,France) by using a stomacher machine (IUL Instruments,Barcelona, Spain). The resulting filtrate was transferred to asterile tube and centrifuged firstly at 2,500 rpm for 30 s andsecondly at 13,000 rpm for 10 min. The pellets wereresuspended in 100 μl of sterile deionized water beforeincubating at 95 °C for 10 min and cooled on ice for15 min. Then, these 100 μl of samples were treated with themethod described below (Table 3).

Method 1. Cetyl trimethylammonium bromide (CTAB)extraction buffer, enzymatic treatment, and E.Z.N.A. kit (“CTAB-enzymatic treatment-E.Z.N.A.” method)

This method consists of a modification of the protocoldescribed by Rodríguez et al. (2011). The samples weretreated with 500 μl CTAB buffer (5 g D-sorbitol, 2 g N-lauroylsacarosine, 1.6 g CTAB, 1.4 M NaCl, 0.5 M ethyl-enediaminetetraacetic acid (EDTA) pH 8, 2 g polyvinylpolypyrrolidone, 0.1 M Tris–HCl buffer pH 8) and 10 μl ofproteinase K (10 mg/ml, Sigma Aldrich Co., Madrid, Spain)before incubating at 65 °C for 1 h. Then, 10 μl RNase Asolution (10 mg/ml, Sigma Aldrich Co.) was added beforeincubation at 37 °C for 1 h. Five hundred microliterschloroform were added, and the mixtures were centrifuged at13,000 rpm for 20 min. The upper layer was transferred to anew tube, and the aqueous phase was processed by using theE.Z.N.A. Fungal DNA Mini Kit (Omega Bio-tek, Doraville,GA) following the protocol of the manufacturer, startingfrom DNA precipitation by adding 500 μl of isopropanol(step 4 protocol B). In the final step, DNA was eluted fromthe E.Z.N.A. columns with 100 μl of elution buffer.

Method 2. Phosphate-buffered saline (PBS)-tween extrac-tion buffer, enzymatic treatment, and E.Z.N.A.kit (“PBS-tween-enzymatic treatment-E.Z.N.A.” method).

The samples were treated with 500 μl PBS-tween(0.15 M NaCl, 0.01 M sodium-phosphate buffer pH 7.4with 0.05% Tween-20), 10 μl of proteinase K (10 mg/ml),and 100 μl of lyticase (4 U/ml, Sigma Aldrich Co.) beforeincubating at 65 °C for 1 h. Samples were then treated with500 μl chloroform and centrifuged at 13,000 rpm for20 min. After the incubation of the supernatant with 15 μlRNase A solution (10 mg/ml) at 37 °C for 1 h, sampleswere treated with 500 μl chloroform and the mixtures werecentrifuged at 13,000 rpm for 5 min. and E.Z.N.A. FungalDNA Mini Kit as indicated in method 1 after adding 500 μlof isopropanol.

Method 3. CTAB/PBS extraction buffer (1:1), enzymatictreatment and E.Z.N.A. kit (“CTAB/PBS (1:1)-enzymatic treatment-E.Z.N.A.” method)

The samples were treated with 500 μl of CTAB/PBS(1:1) extraction buffer, 10 μl of proteinase K (10 mg/ml),and 100 μl of lyticase (4 U/ml) before incubating at 65 °Cfor 1 h. Samples were then treated with 500 μl chloroformand centrifuged at 13,000 rpm for 20 min. The supernatantwas incubated with 10 μl RNase A solution (10 mg/ml) at37 °C for 1 h. After adding 500 μl chloroform andcentrifuging at 13,000 rpm for 5 min, samples were treatedwith isopropanol and E.Z.N.A. Fungal DNA Mini Kit asindicated in method 1.

Method 4. CTAB/PBS extraction buffer (1:2), enzymatictreatment, and E.Z.N.A. kit (“CTAB/PBS(1:2)-enzymatic treatment-E.Z.N.A.” method)

The samples were treated with 500 μl of CTAB/PBS(1:2) extraction buffer, 20 μl of proteinase K (10 mg/ml),and 200 μl of lyticase (4 U/ml) before incubating at 65 °Cfor 1 h. Samples were then treated with 500 μl chloroformand centrifuged at 13,000 rpm for 20 min. The supernatantwas incubated with 20 μl RNase A solution (10 mg/ml) at37 °C for 2 h. After adding 500 μl chloroform andcentrifuging at 13,000 rpm for 5 min, samples were treatedwith isopropanol and E.Z.N.A. Fungal DNA Mini Kit asindicated in method 1.

Method 5. CTAB extraction buffer, enzymatic treatment,and phenol/chloroform (“CTAB-enzymatictreatment-phenol/chloroform” method)

This protocol was based on the Shokere et al. (2009)method with some modifications. The samples were treatedwith 500 μl of CTAB and 10 μl of proteinase K (10 mg/ml)and 100 μl of lyticase (4 U/ml) before incubating at 65 °Cfor 30 min. Then samples were treated 500 μl phenol/chloroform, and the mixtures were centrifuged at

686 Food Anal. Methods (2012) 5:684–694

Tab

le2

Results

ofqu

ality

(A26

0/28

0)andqu

antityof

DNA

obtained

from

inoculated

food

swith

patulin

-produ

cing

molds

(P.commun

eCBS311.48

,P.

griseofulvum

CBS110.42

0,andP.

expa

nsum

CECT22

80),by

usingtheeigh

ttested

DNA

extractedmetho

d

Cookedham

Cookedturkey

breast

Mortadella

Dry-fermented

sausage

“Salchichón”

Dry-cured

ham

Ripened

cheese

Apple

Peach

Pear

M1a

A260/280b

1.16

±0.29

1.23

±0.16

1.13

±0.12

1.22

±0.08

1.26

±0.13

1.34

±0.17

1.05

±0.26

1.33

±0.45

0.98

±0.23

DNA

concentrationc

4.14

±0.32

3.38

±0.48

<1

4.05

±0.60

4.87

±0.33

<1

3.5±0.27

3.35

±0.31

<1

Level

detected

d–

––

––

––

––

M2

A260/280

1.32

±0.52

1.21

±0.25

1.09

±0.16

1.08

±0.09

1.66

±0.20

1.63

±0.31

1.16

±0.25

1.65

±0.42

1.30

±0.27

DNA

concentration

6.43

±0.35

7.30

±0.62

<1

4.82

±0.31

5.81

±0.43

4.18

±0.20

6.04

±0.73

3.20

±0.19

<1

Level

detected

(2.5±0.15)×10

5e

(2.7±0.76)×10

5–

–(6.7±0.84)×10

6–

(1.9±0.63)×10

4–

–

M3

A260/280

1.61

±0.38

1.25

±0.09

1.63

±0.34

1.45

±0.31

1.32

±0.25

1.24

±0.18

1.09

±0.08

1.56

±0.26

1.34

±0.11

DNA

concentration

6.47

±0.27

8.45

±0.45

5.78

±0.38

7.46

±0.26

6.58

±0.27

5.82

±0.22

8.84

±0.10

5.54

±0.11

5.12

±0.15

Level

detected

(2.7±0.46)×10

3(2.6±0.45)×10

3(2.5±0.30)×10

3(6.5±0.47)×10

3(5.6±0.99)×10

3(5.7±0.56)×10

4(1.9±0.15)×10

4(1.7±0.46)×10

4(1.8±0.29)×10

4

M4

A260/280

1.54

±0.37

1.37

±0.18

1.70

±0.44

1.29

±0.14

1.25

±0.18

1.12

±0.07

1.17

±0.06

1.68

±0.27

1.57

±0.19

DNA

concentration

10.68±0.21

10.87±0.17

7.84

±0.13

11.83±0.27

13.2±0.19

15.18±0.21

12.71±0.28

7.01

±0.24

8.47

±0.33

Level

detected

(2.8±0.55)×10

3(2.6±0.46)×10

2(2.6±0.48)×10

3(6.4±0.56)×10

2(6.3±0.97)×10

2(6.8±0.41)×10

2(1.9±0.20)×10

3(1.6±0.48)×10

2(1.8±0.43)×10

3

M5

A260/280

1.32

±0.52

1.20

±0.44

1.09

±0.27

1.56

±0.32

1.27

±0.19

1.60

±0.41

1.04

±0.25

1.17

±0.18

1.19

±0.23

DNA

concentration

6.05

±0.16

6.14

±0.24

<1

5.71

±0.57

3.66

±0.29

4.38

±0.34

7.22

±0.28

4.07

±0.36

<1

Level

detected

(2.8±0.53)×10

6(2.5±0.42)×10

6–

(6.8±0.48)×10

6–

–(2.5±0.60)×10

5–

–

M6

A260/280

1.59

±0.45

1.13

±0.20

1.11

±0.32

1.64

±0.34

1.68

±0.37

1.01

±0.14

1.33

±0.20

1.60

±0.42

1.25

±0.31

DNA

concentration

3.72

±0.31

4.03

±0.47

<1

3.53

±0.29

4.36

±0.42

3.56

±0.24

4.43

±0.30

3.46

±0.25

<1

Level

detected

––

––

––

––

–

M7

A260/280

1.15

±0.25

1.33

±0.34

0.99

±0.11

1.11

±0.12

1.02

±0.24

1.13

±0.19

1.27

±0.31

1.23

±0.33

1.18

±0.29

DNA

concentration

3.24

±0.60

4.41

±0.37

<1

3.85

±0.25

1.89

±0.38

1.75

±0.23

4.53

±0.36

2.86

±0.18

<1

Level

detected

––

––

––

––

–

M8

A260/280

0.83

±0.29

1.02

±0.21

0.57

±0.18

0.94

±0.34

1.04

±0.16

0.88

±0.43

1.10

±0.26

0.79

±0.36

0.99

±0.25

DNA

concentration

<1

<1

<1

<1

<1

<1

<1

<1

Level

detected

––

––

––

––

–

PCRresults

andlevelsof

detection(con

idia/g)foun

dwith

obtained

DNA

isalso

show

naM1–

M8:

DNA

extractio

nmetho

dsassayedas

describedin

materialandmetho

dssection

bSpectroph

otom

etrically

ratio

at26

0/28

0(purity

value)

ofDNA

recoveredfrom

differentinoculated

food

matriceswith

106conidia/gassayed,

byextractio

nmetho

d.(−)representsno

ndetected

PCRprod

uct

cAmou

ntof

DNA

recovered(exp

ressed

inng

/μl)from

differentinoculated

food

matricesassayed,

byextractio

nmetho

ddDatarepresenttheminim

alnu

mberof

conidiapergram

offood

sample(con

idia/g)detected

afterPCRam

plification

eDatarepresentthemeans

±thestandard

deviationof

threeindepend

entassays

Food Anal. Methods (2012) 5:684–694 687

13,000 rpm for 15 min. The upper layer was transferred to anew tube and 10 μl RNase A solution (10 mg/ml) wereadded before incubation at 37 °C for 2.5 h. An equalvolume of chloroform was then added, and the sampleswere vortexed and centrifuged at 13,000 rpm for 5 min.

After removing the supernatant, the obtained pellet wasresuspended in 350 μl of 1.2 M NaCl and 350 μl ofchloroform. Before centrifugation at 10,000 rpm for 10 minthe aqueous phase was mixed with 350 μl of isopropanoland incubated for 20 min at room temperature. After adding500 μl of 75% ethanol, and centrifuge at 13,000 rpm for10 min, the supernatant was discarded and DNA wasresuspended in 100 μl of elution buffer.

Method 6. Modified CTAB extraction buffer, enzymatictreatment. and chloroform (“Modified CTAB-enzymatic treatment-chloroform” method)

This protocol was assayed after introducing somevariations on the protocol described by ISO 21571:2005.The samples were treated with 500 μl of modified CTABbuffer (2% w/v CTAB, 0.1 M Tris HCl pH 8, 20 mM EDTApH 8, 1.4 M NaCl) and 40 μl of proteinase K (10 mg/ml)before incubating at 65 °C for 2 h. The mixtures were thencentrifuged at 5,000 rpm for 5 min.

The upper layer was transferred to a new tube and 10 μlRNase A solution (10 mg/ml) were added before incubationat 60 °C for 15 min. An equal volume of chloroform wasthen added, and the samples were vortexed and centrifugedat 13,000 rpm for 10 min. The upper layer was transferredto a new sterile tube and 1 ml CTAB precipitation solution(0.5% w/v CTAB, 0.04 M NaCl) were mixed andcentrifuged at 13,000 rpm for 10 min. The aqueous phase

was discarded and the pellet was diluted in 400 μl 1.2 MNaCl and incubated at 60 °C for 15 min. After adding400 μl chloroform and centrifuging at 13,000 rpm for10 min, the aqueous phase together with 400 μl isopropanolwas mixed and let stand for 30 min to allow precipitate toform and after centrifuging at 13,000 rpm for 10 min,supernatant was discarded; 400 μl 75% ethanol were mixedand centrifuged at 10,000 rpm for 5 min. DNA was finallyresuspended in 100 μl of elution buffer.

Method 7. Modified CTAB extraction buffer, polyvinyl-pyrrolidone (PVP), chloroform, and enzymatictreatment (“Modified CTAB-PVP-chloroform-enzymatic treatment” method)

Protocol followed by Doyle and Doyle (1987) with somemodifications was followed. Thus, the samples were treatedwith 500 μl of modified CTAB buffer and 0.5 mg of PVPbefore incubating at 65 °C for 20 min. After adding 300 μlchloroform, the mixtures were then centrifuged at10,000 rpm for 5 min being the resulting supernatanttransferred to a new sterile tube and incubated for 20 min atroom together with 150 μl 1.2 M NaCl and 300 μl 75%ethanol and centrifuged at 10,000 rpm for 3 min. Thesupernatant was discarded, and pellets were washed with300 μl ethanol and centrifuged at 10,000 rpm for 1 min.DNA was resuspended in 100 μl of elution buffer andincubated with 10 μl RNase A solution (10 mg/ml) at 37 °Cfor 15 min.

Method 8. Modified CTAB/sodium dodecyl sulfate (SDS)extraction buffer, and chloroform (“ModifiedCTAB/SDS-chloroform” method)

Table 3 Methods of mold DNA extraction

DNA extraction assays Major steps involved in the procedure

Method 1 (“CTAB-enzymatictreatment-E.Z.N.A.” method)

CTAB extraction buffer + proteinase K + RNase A + chloroform + isopropanol + E.Z.N.A.Fungal DNA Mini Kit

Method 2 (“PBS-tween-enzymatictreatment-E.Z.N.A.” method)

PBS-tween + proteinase K + lyticase +chloroform + RNase A + chloroform + isopropanol +E.Z.N.A. fungal DNA Mini kit

Method 3 (“CTAB/PBS (1:1)-enzymatictreatment-E.Z.N.A.” method)

CTAB/PBS (1:1) extraction buffer + proteinase K + lyticase + chloroform + RNase A +chloroform + isopropanol + E.Z.N.A. fungal DNA Mini kit.

Method 4 (“CTAB/PBS (1:2)-enzymatictreatment-E.Z.N.A.” method)

CTAB/PBS (1:2) extraction buffer + proteinase K + lyticase + chloroform + RNase A +chloroform + isopropanol + E.Z.N.A. fungal DNA Mini kit.

Method 5 (“CTAB-enzymatictreatment-phenol/chloroform” method)

CTAB extraction buffer + proteinase K + lyticase + phenol:chloroform + RNase A +NaCl + chloroform + isopropanol + 75% ethanol + Elution buffer

Method 6 (“Modified CTAB-enzymatictreatment-chloroform” method)

modified CTAB extraction buffer + proteinase K + RNase A + chloroform + CTABprecipitation solution+ NaCl + chloroform + isopropanol + 75% ethanol + Elution buffer

Method 7 (“Modified CTAB-PVP-chloroform-enzymatic treatment” method)

modified CTAB extraction buffer + PVP + chloroform + NaCl + 75% ethanol (x2) +Elution buffer + RNase A

Method 8 (“Modified CTAB/SDS-chloroform”method)

modified CTAB extraction buffer:SDS + chloroform (x2) + isopropanol + ethanol (x2) +deionized water

688 Food Anal. Methods (2012) 5:684–694

Method 8 consists of a modification of that reported by Niuet al. (2008). Samples were added of 500 μl modified CTABbuffer and SDS extraction buffer (100 mM Tris–HCl pH 8.0,50 mM EDTA pH 8.0, 500 mM NaCl, 10 mM mercaptoetha-nol, 1% SDS) before incubating at 65 °C for 1 h The mixtureswere then centrifuged at 7,000 rpm for 10 min. The upper layerwas transferred to a new sterile tube with 500 μl of chloroform.Samples were centrifuged at 7,000 rpm for 10 min being theresulting supernatant transferred to a new tube. A volume of500 μl chloroform was added, and the mixtures werecentrifuged at 7,000 rpm for 10 min. The aqueous phase wastransferred to a new tubewith 500μl isopropanol and incubatedfor 20 min at room temperature before being centrifuged at10,000 rpm for 10 min. Pellets were washed with 500 μlethanol twice and centrifuged at 10,000 rpm for 1 min. DNAwas resuspended in 150 μl of sterile deionized water.

Determination of Quantity and Quality of DNA

Quality of the extracted DNAs was checked by triplicate byusing a Biophotometer Eppendorf (Eppendorf AG, Ham-burg, Germany) based on the ratio at 260/280.

Quantity (ng/μl) of DNA was estimated by electropho-resis on 1% (w/v) agarose gel (TAE buffer system) andethidium bromide staining (0.5 μg/ml, Sigma Aldrich Co.).The results were visualized on a UV transillumination G-Box of Syngene (Synoptics group, Frederick, MD), photo-graphed, and analyzed by the integrated camera andsoftware GeneSnap and GeneTools of Syngene.

A standard equation relating the absorbance values andthe concentrations of DNA standards (0.25 μg/μl, RocheDiagnostics, Indianapolis, IN) was then generated in orderto estimate the concentration (ng/μl) of purified DNA.

PCR Assay to Detect idh Gene

The specific primers FC2 (5′ CGATGTTGCTAGCAAAGACG 3′) (Luque et al., 2011) and IDH2 (5′ ACCTTCAGTCGCTGTTCCTC 3′) (Paterson 2007) based on the idh gene wasused for PCR in order to generate a specific product of 496 bp.

The reaction was performed in a total volume of 50 μl,containing 5 μl of 10x Mg free PCR buffer, 3 μl MgCl2(50 mM), 1 μl deoxynucleotide mix (10 mM), 2 μl of eachprimer (10 mM), 0.5 μl Taq polymerase (2 U/μl, Finn-zymes, Espoo, Finland), and 5 μl of template DNA. Theamplification conditions were: initial denaturation step at94 °C for 4 min; 30 cycles at a melting temperature of 94 °C for 1 min, annealing temperature of 52 °C for 1 min, andextension temperature of 72 °C for 1 min. A final extensionof 5 min at 72 °C was included.

For PCR amplification, three replicates of 5 μl DNAextracted from each inoculated food were assayed per run.

The presence of the expected amplicon was detected on 2%agarose gels using 1× TAE buffer at 85 V for 1 h. Gelswere stained with ethidium bromide, and the productsvisualized and photographed as described previously. ADNA molecular size marker of 0.15–2.1 kbp from RocheDiagnostic was used to determine the size of the amplicons.A negative control containing deionized water instead ofDNA template was used in all experiments runs.

The detection limit achieved in the PCR with the DNAextracted with the eight different DNA extraction methodstested was calculated as the lowest dilution of conidia/ginoculated in each food yielding a specific PCR product of496 bp. The detection limit shows the minimum amplifiedamount of DNA which it is possible to detect. The non-inoculated negative controls which consisted in non-inoculated food products were also performed in triplicate.

Results

Evaluation of Quality and Quantity of the Extracted DNAwith the Different Methods Assayed

The eight assayed DNA extraction methods were evaluatedaccording to the concentration, purity state, and yield of theextracted DNA in foods inoculated with 106 conidia/g ofpatulin-producing molds.

From the eight extraction methods tested the highestrelation A260/A280 (ranging from 1.12 to 1.70) wereobtained with method 4 (CTAB/PBS (1:2)-enzymatictreatment-E.Z.N.A.), followed by method 3 (CTAB/PBS(1:1)-enzymatic treatment-E.Z.N.A.) where A260/A280 valuesranged from 1.09 to 1.63 (Table 2). The remaining methodsshowed for most of the extracted foods values of A260/A280between 1.0 and 1.3, except method 8 (Modified CTAB/SDS-chloroform), where most of the A260/A280 values were under1.0 (Table 2).

Table 2 shows also the measures of the DNA concentra-tion. Method CTAB/PBS (1:2)-enzymatic treatment-E.Z.N.A.showed also the highest yield in DNA concentration, withvalues ranging from 7.01 to 15.18 ng/μl in the differentfood matrices tested. With method 3 (CTAB/PBS (1:1)-enzymatic treatment-E.Z.N.A.) were obtained good amountof DNA ranging from 5.12 to 8.84 ng/μl in the differentfood tested. With the remaining methods, quantity of DNAextracted was generally lower and in some of the foodtested under 1 ng/μl (Table 2).

PCR to Detect idh Gene

The DNA obtained with the eight tested methods (Fig. 1)was used in PCR based on idh gene to detect patulin-

Food Anal. Methods (2012) 5:684–694 689

producing molds. PCR detection was assayed with DNAextracted from the different food matrices inoculated atlevels from 106 to 10 conidia/g. In Table 2, positive resultsof PCR are shown for the lowest dilution of conidia/ginoculated in each food yielding a specific PCR product of496 bp. In those methods and foods with negative resultsin PCR, there was no amplification at any of the conidia/gdilution tested. Only methods 2 (PBS-tween-enzymatictreatment-E.Z.N.A.), 3 (CTAB/PBS (1:1)-enzymatictreatment-E.Z.N.A.), 4 (CTAB/PBS (1:2)-enzymatictreatment-E.Z.N.A.), and 5 (CTAB-enzymatic treatment-phenol/chloroform) showed amplification of 496 bp forsome of the foods and conidia/g dilutions tested, beingthe methods 3 and 4, the only ones yielding specificamplicon of 496 bp in all of the foods tested (Fig. 2).The best PCR results were obtained with DNA extractedwith method 4, since this method yielded specificamplification at level from 102 to 103 conidia/g for all ofthe tested foods, while with method 3, the detection limitranged from 103 to 104 conidia/g (Table 2, Fig. 2). Onlyfor cooked ham and mortadella was the detection limit thesame for methods 3 and 4 (Table 2, Fig. 2).

Thus, the most efficient DNA extraction method wasmethod 4 (Thermal conidia breakdown, CTAB/PBS-tweenextraction buffer and E.Z.N.A. Fungal DNA Mini Kit,Fig. 3) because of yielding the highest DNA concentration,absence of PCR inhibitors, and the lowest detection limit(Fig. 2).

Discussion

The detection of patulin-producing molds in foods is clearlyinfluenced by the DNA extraction method. Several reportshave described procedures for the extraction and purifica-tion of molds DNA (Karthikeyan et al. 2010). However, allthe available methods of DNA extraction are time consum-ing and rather costly (Sambrook and Russel 2001).

In the present work, eight different DNA extractionmethods from foods were evaluated in order to obtainmold DNA with an appropriate quality and enoughquantity and without PCR inhibitors to be used efficient-ly in the detection of patulin-producing molds. All DNAextraction methods included thermal conidia breakdown.The importance of this step was reported by Selma et al.(2008), to release DNA from mold conidia and improvethe efficiency of DNA extraction. Furthermore, the step ofcool on ice immediately after incubating of samples athigh temperature is very important in order to get the celllysis and to reach a good yield from the broken fungalconidia. Thus, some exitosus DNA extraction methodsfrom food samples including this procedure have beenreported (Desalle et al. 1993; Mafra et al. 2008; Rodríguezet al. 2003).

From the results, methods which used the fungal E.Z.N.A. DNA kit at the end of the protocol (methods 1–4)obtained more DNA concentration and higher qualitythan those developed without E.Z.N.A. kit (methods 5–

Fig. 1 Agarose gel of DNA extracted from dry-fermented sausage“salchichón” artificially inoculated with 106 conidia/g of patulin-producing molds. 1.a method 1 (CTAB, proteinase K, chloroform,RNase A, isopropanol, and kit), 1.b method 2 (PBS-tween,proteinase K-lyticase, chloroform, isopropanol, and kit), 1.c method3 (CTAB/PBS (1/1), proteinase K-lyticase, chloroform, RNase A,isopropanol, and kit), 1.d method 4 (CTAB/PBS (1/2), proteinase K-lyticase, chloroform, RNase A, isopropanol and kit), 1.e method 5(CTYAB, proteinase K-lyticase, phenol/chloroform, RNase A, NaCl,isopropanol, ethanol, and kit), 1.f method 6 (CTAB, RNase A,

proteinase K, chloroform, isopropanol, and ethanol), 1.g method 7(CTAB, PVP, chloroform, NaCl, ethanol, and RNase A), 1.h method8 (CTAB, SDS, chloroform, RNase A, and isopropanol). Lane 1Penicillium camemberti CECT 2267, Lane 2 P. commune CBS311.48, Lane 3 P. commune CBS 341.59, Lane 4 Penicilliumdipodomyicola IBT 26223, Lane 5 P. expansum CECT 2278, Lane6 P. expansum CECT 2279, Lane 7 P. expansum CECT 2280, Lane8 P. griseofulvum CBS 485.84, Lane 9 P. griseofulvum CBS 110.420,Lane 10 Aspergillus terreus CBS 601.65, Lane 11 Non-inoculateddry-fermented sausage “salchichón”

690 Food Anal. Methods (2012) 5:684–694

8). The use of commercial kits to detect contaminantsmolds have been reported to increase the ability for rapidextraction and reducing the time-consuming and reactiveamount (Karthikeyan et al. 2010; Loeffler et al. 1999).However, in the present work, yield of E.Z.N.A. kit inDNA extraction depends of the additional combinedmethod used. Thus, presence of CTAB/PBS (1:2) andenzymatic treatment combined with E.Z.N.A. kit yieldedthe highest amount of DNA and with highest quality.CTAB is a cationic surfactant that is added to solubilizethe membranes (Alamäe and Järviste 1995) improving theremoval of capsular polysaccharides (Spitzer and Spitzer1992) and the precipitation of DNA (Sibatani 1970).Despite the fact that CTAB is usually used in protocols ofDNA extraction (Demeke and Jenkins 2010), in this work,CTAB buffer was only efficient in DNA extraction when itwas combined with PBS-tween buffer and enzymatictreatment by using lyticase and proteinase K. Thus, PBS-tween buffer should be essential to obtain good yield ofDNA from food to be used in the detection of patulin-producing molds, probably due to the additional washingeffect of PBS-tween. Proteinase K and lyticase digestion

has been reported as essential to improve efficiency offungal DNA extraction (Sánchez et al. 2008). However, inthe present work, this enzymatic treatment was onlyeffective in DNA extraction when it was associated withCTAB and PBS-tween buffer. In addition, the combinationof CTAB extraction buffer and chloroform have beenreported as essential to remove proteins and polysacchar-ides from food samples (Demeke and Jenkins 2010),which may explain the highest efficiency in DNAextraction obtained with method 4 that used CTAB bufferand chloroform.

When DNA obtained with method 5 was tested for PCR,there was no amplification in those samples which reacheda concentration lower than 5 ng/μl, which probably affectedthe yield of PCR. In addition, presence of phenol may actas PCR inhibitors in this method. Phenol at concentration ofmore than 0.2% has been reported to inhibit PCR (Peist etal. 2001). The addition of SDS, PVP, and NaCl to CTABextraction buffer (method 6–8) described by Dellaporta etal. (1983) as suitable to remove contaminants from matricesdecreased the DNA yield in this study. This is explainedbecause ionic detergents such as SDS are reported to be

(b.4.)

(b.6.)1 4 5 6 7 8 92 3

(b.5.)

1 6 7 8 93 4 52

1 6 7 8 93 4 52

1 6 7 8 93 4 52

(a.4.)

(a.5.)

(a.6.) 1 4 5 6 7 8 92 3

(a.1.)

(a.2.)

(a.3.) 1 6 7 8 93 4 52

1 6 7 8 93 4 52

(b.1.)

(b.2.)

(b.3.)

1 6 73 4 52 8 9

4 5 6 7 8 92 31

1 6 7 8 93 4 52

1 2 31 4 5 6 7 8 92 3

1 4 5 6 7 92 3 8 9

1 2 6 7 8 93 4 5

1 2 6 7 8 93 4 5 1 2 6 7 8 93 4 5

1 2 6 7 8 93 4 5

1 6 7 8 93 4 52 1 2 6 7 8 93 4 5

(a.7.)

(a.8.)

(a.9.)

(b.7.)

(b.8.)

(b.9.)

Fig. 2 Agarose gel electrophoresis of PCR products obtained usingprimer pair FC2/IDH2 comparing between DNA extraction methods 3(a) and 4 (b) (CTAB/PBS 1:/1 and 1:2, respectively) with three groups(cooked, cured, and fruits products) inoculated: cooked ham (a.1, b.1)and cooked turkey breast (a.2, b.2), and mortadella (a.3, b.3)inoculated with P. commune CBS 311.48, dry-fermented sausage“salchichón” (a.4, b.4), cured ham (a.5, b.5), and cured cheese (a.6,

b.6) with P. griseofulvum CBS 110.420, and apple (a.7, b.7), peach(a.8, b.8), and pear (a.9, b.9) with P. expansum CECT 2280. Lane 1molecular weight marker of 2.1–0.15 kbp. Lanes 2–7 5 μL of DNAfrom each inoculated food product with 106, 105, 104, 103, 102, and 10conidia/g, respectively. Lane 8 5 μL of DNA from pure culture ofpatulin-producing P. expansum CECT 2279. Lane 9 5 μL of DNAfrom non inoculated food samples used as negative controls

Food Anal. Methods (2012) 5:684–694 691

more inhibitory than non-ionic detergents such as Tween 20(Rossen et al. 1992). Both detergents are usually used earlyduring DNA extraction and thus residual amounts areremoved through the subsequent washing steps. PCRinhibition by CTAB and SDS concentrations higher than0.005% has been reported (Peist et al. 2001). On the otherhand, these methods employed high amount of ethanol. It isroutinely used for DNA extraction even though it couldinhibit PCR. Ethanol is reported to inhibit PCR atconcentrations of 1% or more (Peist et al. 2001).

For most of the methods, DNA purity, estimated bymeasuring the A260/280 ratio was low, always below 1.8considered as a good ratio (Sánchez et al. 2008), althoughthis value is from DNA obtained from pure cultures, and inthe present work, it was obtained from foods. The DNAobtained from foods by the most efficient method (4)showed an absorbance ratio from 1.17 to 1.70. However,amplification by PCR of these samples was alwaysachieved without the needing further purification step.Although the extracted DNA showed low purity values,the DNA concentration was ≥5 ng/μl, being appropriate tocarry out PCR amplification. That means that at least formethods 3–5, if DNA concentration obtained is higher than5 ng/μl, PCR may yield positive result regardless purity ofDNA. In spite of it, DNA quality obtained were higher thanthose reported by Pinto et al. (2007) who compared

different DNA extraction methods from food and they wereable to amplify by PCR assays DNA ranged from 0.1 to1.97 after being purified and similar than those reached byDatukishvili et al. (2010) who performed a comparativeevaluation of DNA extraction methods for food crops usingDNA kits and CTAB method.

Based on the obtained results, the quantity of DNA forconventional PCR analysis and the presence of PCRinhibitors are important factors to consider when choosingextraction method for DNA quantification from samplescontaminated with molds. Opposite that, for other techni-ques such as the real time PCR, quality is more importantthan quantity (Acevedo et al. 2007). Thus, from the eightDNA extraction methods tested, the most appropriate forthe detection of patulin-producing molds by PCR was themethod 4, since the detection limits for a given conidiaconcentration were significant lower than the other DNAextraction methods.

No presence of PCR inhibitors using the DNAextraction method 4 was observed, since positive resultsof PCR was obtained even at levels of patulin-producingmolds as low as 102–103 conidia/g in all of food tested.The lowest levels of molds detected in this study werelower to those found by other authors in inoculated foodmatrices without previous enrichment time (Luque et al.2011) or after using an enrichment period of 24 h previousto PCR (Färber et al. 1997). Although it could be possiblethat the type of sample used for DNA extraction hasinfluence on the quality and quantity of DNA, the resultsobtained with DNA extracted with method 4, seemsdemonstrate that with this method the influence of foodmatrix was very low.

In addition, all food samples assayed with this methodreached concentrations higher than 7 ng/μl and based onthe obtained results was demonstrated than all PCR gavepositive results from 5 ng/μl. This minimal concentrationof DNA to get PCR amplification was in the same valuereported by Sisea and Pamfil (2007) to reach positive RTi-PCR results with DNA extracted from cheese and pâté.The DNA extraction, purification and concentration, thefirst critical step in molecular analytical methodologies,requires methods able to remove the several inhibitorcompounds of the amplification reaction (Pinto et al.2007). Consequently, the efficiency of the optimizedmethod 4 was demonstrated since no inhibition of PCRwas observed.

In conclusion, the method based on thermal treatmentand E.Z.N.A. Fungal DNA Mini Kit mixed with theCTAB and PBS-tween extraction buffer, is appropriatedto obtain DNA from foods contaminated with patulin-producing molds and adequate to be used in PCR fordetecting them.

5 g food sample + 10 ml Tris-HCl

Filtration/centrifugation : 2,500 rpm 30 seg + 13,000 rpm 10 min

Extraction/ digestion: 500 µl CTAB :PBS-tween (1:2) + 20 µl proteinasa K+ 200 µl Lyticase (65 °C, 1h)

500 µLlchloroform, 13,000 rpm 20 min

supernatant + 20µl RNase A (37 °C, 2h)

supernatant + 500 µl isopropanol

Kit E.Z.N.A. Fungal “DNA mini kit”

DNA

Incubation 95 °C 10 min+ ice 15 min

500 µl chloroform, 13,000 rpm 5 min

Fig. 3 Summary of the workflow of the optimized DNA extractionmethod (thermal conidia breakdown, CTAB/PBS-tween extractionbuffer and E.Z.N.A. Fungal DNA Mini Kit) to be used with PCRtarget to detect patulin-producing molds

692 Food Anal. Methods (2012) 5:684–694

Acknowledgements This work has been funded by projectAGL2007-64639 by the Spanish Comision Interministerial de Cienciay Tecnología, Carnisenusa CSD2007-00016, Consolider Ingenio 2010,and GRU08100 and GRU09158 of the Junta of Extremadura andFEDER. M. Isabel Luque was the recipient of a contract from theTechnician formation program from the Spanish Ministerio deEducación y Ciencia.

References

Acevedo FE, Navarro L, Constantino LM, Gil ZN, Benavides P(2007) Método rápido y económico para la extracción de ADNgenómico en la broca del café y su uso en PCR. Cenicafé58:134–141

Alamäe T, Järviste A (1995) Permeabilization of the methylotrophicyeast Pichia pinus for intracellular enzyme analysis: a quantitativestudy. J Microbiol Methods 22:193–205

Chen SC, Halliday CL, Meyer W (2002) A review of nucleic acid-baseddiagnostic test for systemic mycoses with an emphasis onpolymerase chain reaction-based assays. Med Mycol 40:333–357

Cheraghali AM, Mohammadi HR, Amirahmadi M, Yazdanpanah H,Abouhossain G, Zamanian F, Khansari MG, Afshar M (2005)Incidence of patulin contamination in apple juice produced inIran. Food Control 16:165–167

Datukishvili N, Gabriadze I, Kutateladze T, Karseladze M, VishnepolskyB (2010) Comparative evaluation of DNA extraction methods forfood crops. Int J Food Sci Technol 45:1316–1320

Dean TR, Betancourt D, Menetrez MY (2004) A rapid DNAextraction method for PCR identification of fungal indoor aircontaminants. J Microbiol Methods 56:431–434

Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation:version II. Plant Mol Biol Rep 1:19–21

Demeke T, Jenkins GR (2010) Influence of DNA extraction methods,PCR inhibitors and quantification methods on real-time PCRassay of biotechnology-derived traits. Anal Bioanal Chem396:1977–1990

Desalle R,Williams A,GeorgeM (1993) Isolation and characterization ofanimal mitochondrial DNA. Methods Enzymol 224:176–203

Dickison JH, Kroll RG, Grant KA (1995) The direct application of thepolymerase chain reaction to DNA extracted from foods. LettAppl Microbiol 20:212–216

Dombrink-Kurtzman MA, Blackburn JA (2005) Evaluation of severalcultural media for production of patulin by Penicillium species.Int J Food Microbiol 98:241–248

Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure fromsmall quantities of fresh leaf tissues. Phytochem Bull 19:11–15

Drake MA, Small CL, Spence KD, Swanson BG (1996) Rapiddetection and identification of Lactobacillus spp. in dairyproducts by using the polymerase chain reaction. J Food Prot59:1031–1036

Erdogan A, Sert S (2004) Mycotoxin-forming ability of twoPenicillium roqueforti strains in blue moldy tulum cheese ripenedat various temperatures. J Food Prot 67:533–535

Erdogan A, Gurses M, Sert S (2003) Isolation of molds capable ofproducing mycotoxins from blue moldy Tulum cheeses producedin Turkey. Int J Food Microbiol 85:83–85

Färber P, Geisen R, Holzapfel WH (1997) Detection of aflatoxigenicfungi in figs by a PCR reaction. Int J Food Microbiol 36:215–220

Filion M, St-Arnaud M, Jabaji-Hare SH (2003) Direct quantificationof fungal DNA from soil substrate using real-time PCR. JMicrobiol Methods 53:67–76

International Organization for Standardization (2005) ISO 21571:2005.Foodstuffs-methods of analysis for the detection of genetically

modified organisms and derived products-nucleic acid extraction.http://www.iso.org/iso/iso_catalogue/catalogue_tc/catalogue_detail.htm?csnumber=34616

Karakousis A, Tan L, Ellis D, Alexiou H, Wormald PJ (2006) Anassessment of the efficiency of fungal DNA extraction methodsfor maximizing the detection of medically important fungi usingPCR. J Microbiol Methods 65:38–48

Karthikeyan V, Patharajan S, Palani P, Spadaro D, Gullino ML,Garibaldi A (2010) Modified simple protocol for efficient fungalDNA extraction highly suitable for PCR based molecularmethods. Global J Mol Sci 5:37–42

Loeffler J, Hebart H, Bialek R, Hagmeyer L, Schmidt D, Serey FP,Hartmann M, Eucker J, Einsele H (1999) Contaminationsoccurring in fungal PCR assays. J Clin Microbiol 37:1200–1202

Luque MI, Rodríguez A, Andrade MJ, Gordillo R, Rodríguez M,Córdoba JJ (2011) Development of a PCR protocol to detectpatulin producing molds in food products. Food Control22:1831–1838

Maaroufi Y, Ahariz N, Husson M, Crokaert F (2004) Comparison ofdifferent methods of isolation of DNA of commonly encounteredCandida species and its quantification by using real-time PCR-based assay. J Clin Microbiol 42:3159–3163

Mafra I, Silva SA, Moreira EJMO, Ferreira de Silva CS, Beatriz M,Oliveira PP (2008) Comparative study of DNA extraction methodsfor soybean derived food products. Food Control 19:1183–1190

Martin JP, Haider K (1971) Microbial activity in relation to soil humusformation. Soil Sci 111:54–63

Martín A, Jurado M, Rodríguez M, Núñez F, Córdoba JJ (2004)Characterization of molds from dry-cured meat products and theirmetabolites by micellar electrokinetic capillary electrophoresis andrandom amplified polymorphic DNAPCR. J Food Prot 67:2234–2239

Miller BC, Xu J, Walker MJ, Boyd NA, McMullan R, Moore JE(2003) Isolation of Alternaria alternata from an emollient cream:implications for public health. Mycopathology 156:273–277

Niessen L (2007) PCR-based diagnosis and quantification ofmycotoxin producing fungi. Int J Food Microbiol 119:38–46

Niu C, Kebede H, Auld DL,Woodward JE, Burow G,Wright RJ (2008) Asafe inexpensive method to isolate high quality plant and fungal DNAin an open laboratory environment. Afr J Biotechnol 7:2818–2822

Núñez F, Westphal CD, Bermúdez E, Asensio MA (2007) Productionof secondary metabolites by some terverticillate Penicillia oncarbohydrate rich and meat substrates. J Food Prot 70:2829–2836

Paterson RRM (2007) The isoepoxydon dehidrogenase gene PCR profileis useful in fungal taxonomy. Rev Iberoam Micol 24:289–293

Peist R, Honsel D, Twieling G, Löffert D (2001) PCR inhibitors inplant DNA preparations. Qiagen news 3:7–9

Pinto AD, Forte VT, Guastadisegni MC, Martino C, Schena FP,Tantillo G (2007) A comparison of DNA extraction methods forfood analysis. Food Control 18:76–80

Rodríguez A, García T, González I, Asensio L,Mayoral B, López-CallejaI, Hernández PE, Martín R (2003) Identification of goose, muleduck, chiken, turkey, and swine in foie gras by species-specificpolymerase chain reaction. J Agric Food Chem 51:1524–1529

Rodríguez A, Luque MI, Andrade MJ, Rodríguez M, Asensio MA,Córdoba JJ (2011) Development of real-time PCR methods toquantify patulin-producing molds in food products. Food Microbiol28:1190–1199

Rossen L, Norskov P, Holmstrom K, Rasmussen OF (1992) Inhibition ofPCR by components of food samples, microbial diagnostic assaysand DNA-extraction solutions. Int J Food Microbiol 17:37–45

Sambrook J, Russel DW (2001) Rapid isolation of yeast DNA. In:Sambrook J, Russel DW (eds) Molecular cloning, a laboratorymanual. Cold Spring Harbor Laboratory, New York, pp 631–632

Sánchez B, Rodríguez M, Casado EM, Martín A, Córdoba JJ (2008)Development of an efficient fungal DNA extraction method to beused in random amplified polymorphic DNA-PCR analysis to

Food Anal. Methods (2012) 5:684–694 693

differentiate cyclopiazonic acid mold producers. J Food Prot71:2497–2503

Selma MV, Martínez-Culebras PV, Aznar R (2008) Real-time PCRbased procedures for detection and quantification of Aspergilluscarbonarius in wine grapes. Int J Food Microbiol 122:126–134

Shokere LA, Holden MJ, Jenkins GR (2009) Comparison offluorometric and spectrophotometric DNA quantification forreal-time quantitative PCR of degraded DNA. Food Control20:391–401

Sibatani A (1970) Precipitation and counting of minute quantities oflabeled nucleic acid as cetytrimethylammonium salt. AnalBiochem 22:279–285

Sisea CR, Pamfil D (2007) Comparison of DNA extraction methodsfor GMO analysis of food products. Bulletin USAMV-CN 63:64

Spitzer ED, Spitzer S (1992) Use of dispersed repetitive DNA elementto distinguish clinical isolates of Cryptococcus neoformans. JClin Microbiol 30:1094–1097

Steiman R, Seiglle-Murandi F, Saye L, Krivobks S (1989) Productionof patulin by micromycetes. Mycopathologia 105:129–133

Varga J, Rigó K, Molnár J, Toth B, Szencz S, Téren J, Kozakiewicz Z(2003) Mycotoxin production and evolutionary relationshipsamong species of Aspergillus section Clavati. Anton Leeuw IntJ G 83:191–200

Wilson IG (1997) Inhibition and facilitation of nucleic acid amplification.Appl Environ Microbiol 63:3741–3751

Zur G, Shimoni E, Hallerman E, Kashi Y (2002) Detection ofAlternaria fungal contamination in cereal grains by a polymerasechain reaction-based assay. J Food Prot 65:1433–1440

694 Food Anal. Methods (2012) 5:684–694