Available online at www.sciencedirect.com

www.elsevier.com/locate/toxinvit

Toxicology in Vitro 22 (2008) 632–642

Differential toxic effects of azathioprine, 6-mercaptopurine and6-thioguanine on human hepatocytes

Elise Petit, Sophie Langouet, Hanane Akhdar, Christophe Nicolas-Nicolaz,Andre Guillouzo, Fabrice Morel *

INSERM U620, Universite de Rennes 1, 2 Avenue du Professeur Leon Bernard, 35043 Rennes, France

Universite de Rennes 1, IFR140, Rennes, F-35043, France

Received 23 July 2007; accepted 6 December 2007Available online 25 January 2008

Abstract

Thiopurines (azathioprine, 6-mercaptopurine and 6-thioguanine) are therapeutic compounds widely administered in the clinic fortheir multiple uses (autoimmune diseases, post-transplant immunosuppression and cancer). Despite these advantages, their therapeuticpotential is limited by occasional adverse effects (myelotoxicity and hepatotoxicity) and by a relatively frequent lack of efficacy. Previousstudies have demonstrated that azathioprine decreased the viability of rat hepatocytes. In order to investigate cytotoxic effects of thiop-urines in human liver, we used primary human hepatocytes and a highly differentiated human hepatoma cell line, HepaRG, treated ornot with azathioprine, 6-mercaptopurine and 6-thioguanine. In parallel, expression of the genes involved in the metabolism of thiopu-rines, glutathione synthesis and antioxidant defences was measured by quantitative PCR. We clearly demonstrate that human liverparenchymal cells were much less sensitive than rat hepatocytes to thiopurine treatments. The toxic effects appeared after 96 h of treat-ment while ATP depletion was observed after a 24 h incubation with azathioprine and 6-mercaptopurine. Toxic effects were more pro-nounced for azathioprine and 6-mercaptopurine, when compared to 6-thioguanine, and might explain glutathione synthesis andantioxidant enzyme induction only by these two drugs. Finally, we also demonstrate for the first time an up-regulation by azathioprineand 6-mercaptopurine of inosine monophosphate dehydrogenase which might have consequences on the de novo biosynthesis of guaninenucleotides and thiopurines metabolism.� 2007 Elsevier Ltd. All rights reserved.

Keywords: Human; Hepatocytes; HepaRG; Hepatoma cells; Metabolism; Toxicity; Thiopurine

0887-2333/$ - see front matter � 2007 Elsevier Ltd. All rights reserved.

doi:10.1016/j.tiv.2007.12.004

Abbreviations: AZA, azathioprine; 6-MP, 6-mercaptopurine; 6-TG, 6-thioguanine; DHE, dihydroethidium; DMSO, demethylsulfoxide; FCS,fetal calf serum; GLCR, c-glutamyl-cysteine synthase, regulatory subunit;GS, glutathione synthase; GSH, glutathione; GST, glutathione transfer-ase; H2DCFDA, dichlorodihydrofluorescein diacetate; HGPRT, hypo-xanthine-guanine phosphoribosyl transferase; IMPDH, inosinemonophosphate dehydrogenase; MnSOD, manganese superoxide dismu-tase; GPX, glutathione peroxidase; TPMT, thiopurine methyl transferase;XOD, xanthine oxidase.

* Corresponding author. Address: INSERM U620, Universite deRennes 1, 2 Avenue du Professeur Leon Bernard, 35043 Rennes, France.Tel.: +33 2 23 23 48 10.

E-mail address: Fabrice.Morel@rennes.inserm.fr (F. Morel).

1. Introduction

Over the last forty-five years, three thiopurine drugs havebeen in common use. Two of these drugs, 6-mercaptopurine(6-MP) and 6-thioguanine (6-TG) are used in the treatmentof acute leukaemia. Another drug, azathioprine (AZA), iswidely used as an immunosuppressant for the treatmentof diseases such as inflammatory bowel disease, autoim-mune conditions and following transplantation to avoidorgan rejection (Lennard et al., 1997; Dubinsky, 2004; El-Azhary, 2003). Thiopurines exert a cytotoxic effect vianon-specific mechanisms (block of replication by incorpora-tion into DNA and of transcription by incorporation into

E. Petit et al. / Toxicology in Vitro 22 (2008) 632–642 633

RNA) or specific ones (block of Rac-1-mediated signaltransduction). However, production of 6-methyl thioino-sine monophosphate might also have an antimetaboliceffect, by inhibiting GTP synthesis (Cara et al., 2004).Besides their therapeutic effects, thiopurines have alsoadverse effects of which hematopoietic toxicity, includingneutropenia, anemia, and thrombocytopenia, is the mostcommon one, and is usually associated with thiopurinemethyl transferase (TPMT) activity. Liver adverse effectsare the second most common, and occur independently ofTPMT activity. In recent years, the hepatotoxic potentialof thiopurines, in particular 6-TG, has been discussed inthe literature. The use of 6-TG in inflammatory bowel dis-ease patients has currently been abandoned due to its pre-sumed hepatotoxic profile, as it has been associated withthe induction of nodular regenerative hyperplasia (Dubin-sky, 2004). The higher occurrence of histological liverabnormalities during 6-TG treatment in comparison withAZA or 6-MP may be explained by the significantly higher

Fig. 1. Pathways of azathioprine, 6-mercaptopurine and 6-thioguanine metabothiopurine methyltransferase, XOD: xanthine oxidase, 6-TIMP: 6-thioinosinTXMP: 6-thioxanthine monophosphate, 6-TGMP: 6-thioguanine monophosp

levels of 6-TG nucleotides derived from 6-TG. It has beenreported in two different studies that 3.5–4.5% of inflamma-tory bowel disease adult patients treated with 6-MP or AZAdeveloped hepatitis as a consequence of treatment (Giverh-aug et al., 1997; Shaye et al., 2007). Dubinsky et al. havedemonstrated drug-induced hepatotoxicity in 10–15% ofpediatric patients which has been associated with the 6-MP metabolite 6-methylmercaptopurine ribonucleotide(Dubinsky et al., 2000). Finally, two other studies demon-strated that (i) levels of 6-MP and its methylated metabo-lites are correlated with the degree of hepatotoxicityduring methotrexate and 6-MP maintenance therapy (Nyg-aard et al., 2004) and ii) two cases of cholestatic hepatocel-lular injury associated with 6-MP toxicity after orthotopicliver transplantation (Kontorinis et al., 2004).

Thiopurines are pro-drugs and have to be metabolised inorder to exert their cytotoxic action (Fig. 1) (Lennard,1992). Reduction of AZA to 6-MP and an imidazole groupis catalyzed by glutathione transferases A1, A2 and M1

lism. HGPRT: hypoxanthine guanosyl phosphoribosyl transferase, TPMT:e monophosphate, IMPDH: inosine monophosphate dehydrogenase, 6-hate, ROS: reactive oxygen species.

634 E. Petit et al. / Toxicology in Vitro 22 (2008) 632–642

(GST) (Eklund et al., 2006). Both AZA and 6-MP undergoextensive metabolism before exerting cytotoxicity followingincorporation into DNA as thioguanine nucleotides (Berti-no, 1991) or in the case of 6-MP inhibition of de novo purinesynthesis. The main enzymes competing for the initialmetabolism of 6-MP and 6-TG are hypoxanthine-guaninephosphoribosyl transferase (HGPRT), thiopurine methyl-transferase (TPMT), and xanthine oxidase (XOD) whichhas the potential to generate reactive oxygen species (ROS).

In most cases, hepatotoxicity is an unpredictable side-effect of these drugs, whose pathogenic mechanism remainsunknown. Previous studies performed with rat hepatocyteprimary cultures showed that AZA metabolism leads tointracellular reduced glutathione (GSH) depletion, mito-chondrial injury, metabolic activity reduction, decreasedATP levels, and cell death (Lee and Farrell, 2001; Menoret al., 2004). However, marked species differences that arefrequent in drug metabolism as well as in the response todrugs prompted us to question as to whether pharmacolog-ical doses of AZA, 6-MP and 6-TG have similar effects onhuman liver parenchymal cells. In this work, we used pri-mary human hepatocytes and the differentiated humanhepatoma HepaRG cell line exposed to the three thiopu-rines to evaluate their effects on cell viability and expres-sion of enzymes involved in their metabolism andantioxidant defences. Highly differentiated HepaRG cellsexhibit unique features: they express various CYPs andother functions such phase 2 enzymes, apical and canalicu-lar ABC transporters and basolateral solute carrier trans-porters, albumin, haptoglobin as well as aldolase B, aspecific marker of adult hepatocytes, at levels comparableto those found in cultured primary human hepatocytes(Gripon et al., 2002; Aninat et al., 2006; Le Vee et al.,2006; Guillouzo et al., 2007). We report that thiopurinesare less toxic in human than in rodent cells and we showdifferent responses between AZA, 6-MP and 6-TG. Fur-thermore we demonstrate for the first time an inductionof inosine monophosphate dehydrogenase (IMPDH) bythese drugs.

2. Materials and methods

2.1. Hepatocyte culture

Human liver samples were obtained from patients under-going liver resection for primary or secondary hepatomas.Hepatocytes were isolated by a two-step collagenase perfu-sion procedure (Guguen-Guillouzo et al., 1982). The exper-imental procedures used were done in compliance withFrench laws and approved by the National Ethics Commit-tee. Cell viability was 70–85%, as estimated by the trypanblue exclusion test. Liver parenchymal cells were seeded ata density of 7 � 104 cells/cm2 in a nutrient medium consist-ing of Williams E medium supplemented with 0.2% bovineserum albumin, 1 mg/ml bovine insulin, 2 mM glutamine,100 U/ml penicillin, 10 mg/ml streptomycin, 2 mg/ml glu-cose and 10% fetal calf serum (FCS), and incubated at

37 �C under a 5% CO2 atmosphere. The medium was dis-carded 24 h after cell seeding and hepatocytes were thereaf-ter maintained in serum-free medium supplemented withhydrocortisone (10�7 mol/L) and renewed daily. Thiopu-rines, dissolved in dimethylsulfoxide (DMSO), were added48 h after cell seeding and at each medium renewal to givea final concentration of 1, 5 or 25 lM (in 0.1% DMSO).Control cultures received the same concentration of solvent.

HepaRG cells were obtained from a liver tumor of afemale patient suffering from hepatocarcinoma (Griponet al., 2002). For the present studies, HepaRG cells werecultured as previously described (Gripon et al., 2002; Anin-at et al., 2006). Briefly, HepaRG cells were seeded at a den-sity of 2.6 � 104 cells/cm2 in the growth medium composedof Williams E medium supplemented with 10% FCS,100 units/mL penicillin, 100 lg/mL streptomycin, 5 lg/mL insulin, 2 mM glutamine and 5 � 10�5 M hydrocorti-sone hemisuccinate. After 2 weeks they were shifted tothe same culture medium supplemented with 2% DMSO(differentiation medium) for 2 more weeks (confluentDMSO-treated cells). The medium was renewed every 2–3 days. High density differentiated HepaRG cells wereseeded in the differentiation medium lacking FCS andDMSO at 0.45 � 106 cells/cm2 and experiments werealways performed 48 h after seeding on these highly differ-entiated cells as described previously (Aninat et al., 2006).For availability of HepaRG cells, contact christiane.guillo-uzo@rennes.inserm.fr (academic laboratories) or bpicom-merce@biopredic.com (industrial laboratories).

Hepatocytes from adult male Sprague–Dawley rats wereisolated by a two-step collagenase perfusion procedure asdescribed previously (Guguen et al., 1975). Hepatocyteswere seeded at 7 � 104 cells/cm2 in the medium describedabove. After cell attachment (4 h later), the medium wasrenewed with the same medium deprived of fetal calf serumand supplemented with 7 � 10�5 M hydrocortisone hemi-succinate. This medium was renewed every day thereafter.

2.2. Evaluation of thiopurine cytotoxicity

Hepatotoxic effects of AZA, 6-MP and 6-TG dissolved inDMSO were evaluated after different exposure times. Incuba-tions with thiopurines were performed in a medium deprivedof FCS and containing only 0.1% DMSO (final concentrationof solvent). At the end of the incubation time, cultures wereobserved by phase-contrast microscopy using an Olympus1�70. Then the medium was discarded and replaced withFCS-free medium containing 0.5 mg MTT (3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl tetrazolium bromide)/mL. After2 h, formazan cristals were dissolved in DMSO and the inten-sity of color was determined at 540 nm using a microplatereader (iEMS Reader MF, Labs systems).

2.3. ATP concentration measurement

ATP concentration was measured with the CellTiter-Glo� Luminescent Cell Viability Assay kit (Promega,

E. Petit et al. / Toxicology in Vitro 22 (2008) 632–642 635

Charbonnieres, France) according to the manufacturer’sinstructions. After treatment, cells were lysed in 100 ll ofthe provided buffer and the luminescent substrate wasadded. Luminescence was measured with a fluorimeter/luminometer (Spectra Max Gemini XS, Moleculardevices). In parallel, cell viability was determined in wellsthat have been treated with thiopurines, but without celllysis buffer, by a Methylene Blue colorimetric assay afterethanol fixation as previously described (Micheau et al.,1997). After treatment, cells were washed twice in PBSand fixed for 30 min in 95% ethanol. Following removalof ethanol, fixed cells were dried and colored for 5 minin methylene blue. After three washes with water, 100 lLof 0.1 N HCl per well were added. Plates were analyzedwith a spectrometer at 620 nm.

2.4. Measurement of intracellular reactive oxygen species

(ROS) by flow cytometry

Dihydroethidium (DHE) was used to detect intracellularsuperoxide anion production in HepaRG cells. Since humanhepatocytes exhibited stronger autofluorescence with DHEin our experiments, we used dichlorodihydrofluoresceindiacetate (H2DCFDA) as previously described (Hempelet al., 1999), even though these two fluorogenic substratesdo not measure exactly the same type of ROS. Indeed,DHE is used to detect the superoxide anion whileH2DCFDA reflects peroxidase activity. These two fluoro-genic substrates are used to detect the oxidative status ofthe cell, not a type of ROS specifically. After treatment,floating and adherent cells (150.000 cells per well) wererecovered and incubated in PBS 1X containing 5 lM ofDHE for 20 min or 10 lM of H2DCFDA for 90 min at37 �C. Dye oxidation, which is visualized by an increase offluorescence (FL-2 for DHE and FL-1 for H2DCFDA),was measured using a FACScalibur flow cytometer (Bec-ton–Dickinson, Le Pont-de Claix, France) with excitationand emission settings at 488 and 585 nm, respectively forDHE and 488 and 530 nm for H2DCFDA. Positive controlswere obtained by incubating cells with 10 mM hydrogenperoxide.

Table 1Primers used for quantitative PCR

Forward

18S CGCCGCTAGAGGTGAAATTCGSTA1/2 TGCAACAATTAAGTGCTTTACCTAAGTGGSTM1 CGCCATCTTGTGCTACATTIMPDH 2 TCCCTGGGTACATCGACTTCTPMT AGACCGGGGACACAGTGHGPRT TGCTCGAGATGTGATGAAGGXOD TGAAGGAACTCTTCCGCCTACatalase ACCAGGGCATCAAAACCTTTMnSOD GGGTTGGCTTGGTTTCAATAGS CAGCGTGCCATAGAGAATGAGPX 2 ACAACCACCCGGGACTTCAGPX 3 GACCCCTTTCCTATCACTCAAGGGLCR ATTCCTGACATTCAAGCGCAC

2.5. RNA isolation and RT-qPCR analysis

Total RNA was prepared from 3 � 106 human hepato-cytes or 1 � 106 HepaRG cells with the SV total RNA iso-lation system (Promega, Madison, WI), which includes aDNase treatment step. RNAs were reverse-transcribed intocDNA using High-Capacity cDNA Archive Kit (AppliedBiosystems, Foster City, CA, USA). Real-time quantitativePCR for all genes was performed by the fluorescent dyeSYBR Green methodology using SYBR� Green PCRMaster Mix (Applied Biosystems) and the ABI Prism7000 (Applied Biosystems). Table 1 shows primer pairsfor each transcript chosen with Primer 3 (http://frod-o.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). Theamplification curves were read with the ABI Prism 7000SDS software using the comparative cycle thresholdmethod. The relative quantification of the steady-statemRNA levels was calculated after normalization of thetotal amount of cDNA tested by an active reference, 18SRNA. Furthermore, a dissociation curve was performedafter the PCR to verify the specificity of the amplification.

2.6. Statistical analysis

The non parametric Mann–whitney test was applied tocompare cell viability or ATP concentration between twogroups, i.e. cells treated with each concentration of drugsindependently vs control cells. One-tail p-values was chosenbecause we had preconception about which group wouldhave the larger mean before collecting any data. p-values<0.05 were interpreted as significant.

3. Results

3.1. Effects of azathioprine, 6-mercaptopurine and 6-

thioguanine on cell viability, ATP concentration and reactive

oxygen species production

Previous studies demonstrated that tissue levels to thiop-urines are unlikely to exceed 10 lmol/l after therapeuticdoses (2–3 mg/kg body weight) (Lennard, 1992; Lennard

Reverse

TTGGCAAATGCTTTCGCTCTTAACTAAGTGGGTGAATAGGAGTTGTATTATGGTTGTCCATGGTCTGGAGAGGAAACCAGTGGGGTCTCAGGAATTTCGGTGATTGGTAATCCAGCAGGTCAGCAAAGCACACAGGGTGGTGAACTTGCCGGATGCCATAGTCAGGATCTGATTTGGACAAGCAGCAATTCAAATGTTCGTCGGATCACCAAATTGGTTGCAAGGGAACACATGCCTGGCAGTACACAGTTCCTCTACTTTTCACAATGACCGA

636 E. Petit et al. / Toxicology in Vitro 22 (2008) 632–642

et al., 1997). Thus, HepaRG cells and hepatocyte popula-tions obtained from three different donors were exposedto two pharmacological concentrations (1 and 5 lM) or asupra-pharmacological concentration (25 lM) of AZA, 6-MP or 6-TG for different times (24, 48, 72 and 96 h). As

Azathioprine

60

80

100

120

**

Human hepatocytes

**

0

20

40

60

24 48 72 96Hours of treatment

Cel

l via

bilit

y (%

of c

ontro

l)

6-Mercaptopurine

40

60

80

100

120

140

***

*

0

20

40

24 48 72 96Hours of treatment

Cel

l via

bilit

y (%

of c

ontro

l)

6-Thioguanine

20

40

60

80

100

120

140

C 1 μM

0

20

24 48 72 96Hours of treatment

Cel

l via

bilit

y (%

of c

ontro

l)

Fig. 2. Effects of azathioprine, 6-mercaptopurine and 6-thioguanine treatmentshuman hepatocytes and HepaRG cells was assessed by MTT test after differentMP or 6-TG. Each graph represents the means ± SD of three independent exptriplicates. Regarding HepaRG cells, graphs also represent three independentviability in vehicle- or thiopurine-treated cells compared to control cells (culthiopurine-treated cells and control (0.1% DMSO) cells (*, p < 0.05).

assessed by MTT reduction assay, the AZA and 6-MPexerted dose- and time-dependent toxicity to human hepa-tocytes (Fig. 2). Similar results were observed in HepaRGcells. By contrast, 6-TG had no significant effect on humanhepatocytes while HepaRG cell viability decreased by 30%

Azathioprine

80

100

120

140

HepaRG cells

***

0

20

40

60

24 48 72 96Hours of treatment

Cel

l via

bilit

y (%

of c

ontro

l)

***

6-Mercaptopurine

40

60

80

100

120

****

0

20

40

24 48 72 96Hours of treatment

Cel

l via

bbilit

y (%

of c

ontro

l)

6-Thioguanine120

20

40

60

80

100

****

5 μM 25 μM

0

20

24 48 72 96Hours of treatment

Cel

l via

bilit

y (%

of c

ontro

l)

on viability of human hepatocytes and HepaRG cells. Viability of primarytimes of treatment with 0.1% DMSO (vehicle) and 1, 5 or 25 lM AZA, 6-eriments (hepatocytes obtained from three different donors) performed inexperiments performed in triplicates. Results are expressed as percent of

tured without DMSO). Statistical analysis was performed by comparing

E. Petit et al. / Toxicology in Vitro 22 (2008) 632–642 637

after 72 h of treatment with either 5 or 25 lM (p < 0.05).Regarding ATP concentrations, we observed a decreasein human hepatocytes treated with AZA or 6-MP for24 h dropping under less than 50% of control values after48 h of treatment (Fig. 3). ATP concentration decreasewas delayed in HepaRG cells incubated with AZA or 6-MP, when compared to human hepatocytes; however the

Human hepatocytesAzathioprine

40

60

80

100

120

% o

f con

trol

** *

* *

*

*

**

*

*

*

0

20

5 24 48 72 96Hours of treatment

6-Mercaptopurine140

*

2040

60

80

100120

% o

f con

trol

***

*** *

*

**

*

*

05 24 48 72 96

Hours of treatment

6-Thioguanine

100

120

140

*

0

20

40

60

80

100

5 24 48 72 96H f t t t

% o

f con

trol

* * ****

Hours of treatment

C 1 μM

Fig. 3. Effects of azathioprine, 6-mercaptopurine and 6-thioguanine treatmIntracellular concentrations of ATP were measured in primary human hepatoc(vehicle) and 1, 5 and 25 lM of AZA, 6-MP or 6-TG. ATP in control samples wHepaRG cells. Each graph represents the means ± SD of three independent extriplicates. Regarding HepaRG cells, graphs represent three independent expeconcentration in DMSO- or thiopurine-treated cells compared to control cells (thiopurine-treated and control cells (0.1% DMSO) cells (*, p < 0.05).

levels were also less than 50% of control cells after 96 hof treatment. In the presence of 6-TG, depletions of ATPwere less pronounced than those observed with AZA and6-MP.

It has been suggested that ROS production by mito-chondria caused by thiopurines could damage membranesand macromolecules (Lee and Farrell, 2001), although

HepaRG cellsAzathioprine

40

60

80

100

120

140

%

*

* *

*

0

20

40

5 24 48 72 96Hours of treatment

% o

f con

trol

6-Mercaptopurine140

20

4060

80100

120140

% o

f con

trol

**

**

**

05 24 48 72 96

Hours of treatment

6-Thioguanine

100

120

140

**

0

20

40

60

80

100

5 24 48 72 96H f t t t

% o

f con

trol

*

*

*

Hours of treatment

5 μM 25 μM

ents on human hepatocytes and HepaRG cells ATP concentrations.ytes and HepaRG cells after different times of treatment with 0.1% DMSOas 1.5 ± 1 lmol ATP per 30000 hepatocytes and 4 ± 1 lM ATP per 30000

periments (hepatocytes obtained from three different donors) performed inriments performed in triplicates. Results are expressed as percent of ATPcultured without DMSO). Statistical analysis was performed by comparing

638 E. Petit et al. / Toxicology in Vitro 22 (2008) 632–642

there are no convincing results supporting this hypothesis.In order to determine whether thiopurine effects were asso-ciated with ROS production in human hepatic cells, hepa-tocytes and HepaRG cells were treated with 5 lM AZA, 6-MP or 6-TG and ROS were measured by following DCFor ethidium fluorescence in both control and treated cells.As shown in Fig. 4, treatment by 5 lM of AZA, 6-TG or6-MP induced only a very slight increase of ROS after 24or 48 h of treatment in human hepatocytes. A minor pro-duction of ROS was observed in HepaRG cells withAZA and 6-TG, but only after 72 h of treatment.

In order to compare hepatotoxicity of AZA, 6-MP and6-TG between human and rat, viability of rat hepatocytes

250Human Hepatocytes

150

200

50

100

05 24 48 72flu

ores

cenc

e In

tens

ity (%

of c

ontro

l)

Hours of treatment Azathioprine 6-mercap

Fig. 4. Effects of different times of treatment with thiopurines on ROS proethidium. Human hepatocytes and HepaRG cells were incubated with 5 lMintracellular superoxide anion production in HepaRG cells. Since human hefluorescein diacetate (H2DCFDA). Each graph represents the mean of threeHepaRG cells (*, p < 0.05).

Fig. 5. Effects of azathioprine, 6-mercaptopurine and 6-thioguanine treatmentassessed by MTT test after different times of treatment with 1, 5 or 25 lMthiopurine-treated cells and control (*, p < 0.05).

cultured in the absence or the presence of these thiopurineswas investigated with the MTT reduction assay. As demon-strated in Fig. 5, rodent cells were much more sensitivethan human hepatocytes to the toxic effects of AZA, 6-MP and 6-TG.

3.2. Expression of mRNAs encoding thiopurine metabolizing

enzymes in primary human hepatocytes and HepaRG cells

In order to compare the toxic effects of thiopurines inprimary human hepatocytes and in HepaRG cells, we haveinvestigated mRNA expression for genes involved in thio-purine metabolism, i.e. GSTA1/2, GSTM1, TPMT,

HepaRG cells*

80

100

120

140

20

40

60

05 24 48 72

fluor

esce

nce

Inte

nsity

(% o

f con

trol)

Hours of treatment topurine 6-thioguanine

duction. ROS production was evaluated by the fluorescence of DCF orof AZA, 6-MP or 6-TG. Dihydroethidium (DHE) was used to detect

patocytes exhibit autofluorescence with DHE, we used dichlorodihydro-independent experiments on primary human hepatocytes as well as on

s on rat hepatocyte cell viability. Viability of primary rat hepatocytes wasAZA, 6-MP or 6-TG. Statistical analysis was performed by comparing

4

0

2

-2

-4

Diff

eren

tial e

xpre

ssio

n (L

og2

fold

)

-8

-6

IMPDH2 HGPRT TPMT XOD GSTA1/2 GSTM1Genes

Fig. 6. Expression of mRNAs coding for thiopurine metabolizing enzymes in cultured human hepatocytes and HepaRG cells. RNAs were isolated fromhuman hepatocytes cultured for 72 j and 120 h of culture (which correspond to the times of treatment by thiopurines: 24 and 72 h). RNAs from HepaRGcells were prepared from 48 and 96 h h (which also correspond to the times of treatment by thiopurines: 24 and 72 h). The basal line (0) corresponds to apool of RNA isolated from 3 different populations of freshly isolated hepatocytes (FIH). Data are expressed as log2 of fold change relative to FIH. Negativevalues indicate lower expression compared to FIH. The relative quantification of the steady-state mRNA levels was calculated after normalization of thetotal amount of cDNA tested by an active reference, 18S RNA. GST: glutathione transferase; IMPDH2: inosine monophosphate dehydrogenase 2; TPMT:thiopurine methyl transferase; XOD: xanthine oxidase; HGPRT: hypoxanthine-guanine phosphoribosyl transferase.

E. Petit et al. / Toxicology in Vitro 22 (2008) 632–642 639

HGPRT, inosine monophosphate dehydrogenase 2(IMPDH2) and xanthine oxidase (XOD). Fig. 6 showsthe relative levels of mRNAs encoding these enzymes inhuman hepatocyte cultures and HepaRG cells comparedto a pool of freshly isolated hepatocytes (FIH). The resultsdemonstrate comparable amounts of the different tran-scripts in HepaRG cells and human hepatocytes with theexception of GSTA1/2 mRNA levels which were lower inhuman hepatocytes.

To determine the effects of thiopurines on expression ofenzymes involved in their metabolism or antioxidantenzymes, we also measured mRNA levels of TPMT,HGPRT, IMPDH2, XOD, GLCR and GS, catalase,GPX and MnSOD in human hepatocytes in either theabsence or the presence of 5 lM AZA, 6-MP or 6-TG(Fig. 7). Regarding thiopurine metabolism enzymes, ourresults clearly demonstrate that IMPDH was up-regulatedin human hepatocytes as early as 24 h of treatment byAZA, 6-MP or 6-TG (fold induction >2). Although induc-tion was observed for each experiment, variations wereobserved in the range of response between the three hepa-tocyte populations. We also observed an induction ofenzymes involved in glutathione metabolism (GLCLRand GS) and antioxidant defences (MnSOD, GPX2 and3), but only in presence of AZA or 6-MP.

4. Discussion

Previous studies have demonstrated that thiopurineswhich are generally well tolerated are hepatotoxic in a lim-

ited number of patients. Moreover nodular regenerativehyperplasia, veno-occlusive disease, peliosis hepatitis,fibrosis and sinusoidal dilatation are regarded as signs ofdose-dependent hepatotoxicity. The present study aims toinvestigate whether clinically relevant concentrations(1 and 5 lM) and a supra-pharmacological concentration(25 lM) of AZA, 6-MP or 6-TG are cytotoxic to humanhepatic cells by using two in vitro models: human hepato-cytes obtained from three different donors and the highlydifferentiated hepatoma cell line, HepaRG. By usingMTT assay, our results clearly demonstrate that humancells are much less sensitive than rat hepatocytes to hepato-toxic effects induced by these three drugs. Indeed, in con-trast to primary rat hepatocytes which are significantlyinjured by AZA, 6-MP and 6-TG as early as 24 h of treat-ment with 5 and 25 lM, primary human hepatocytes andHepaRG cells showed significant cell death after incuba-tion with AZA or 6-MP at concentrations of at least5 lM (5 and 25 lM) only after 96 h of treatment. This celldeath could be related to a cumulative effect of the metab-olites in cells leading to cytotoxic effects after several daysof treatment. Although 6-TG undergoes a quicker transfor-mation into active metabolites, 6-TG nucleotides (seeFig. 1), it was less cytotoxic than AZA and 6-MP to humanhepatocytes. This result strongly suggests that AZA, 6-MPor their metabolites produced during early steps of theirmetabolism (upstream of 6-TG formation) are responsiblefor the toxic effects observed in human hepatocytes. Bycontrast, we observed HepaRG cell death after 72 h oftreatment with 5 and 25 lM 6-TG. Since 6-TG nucleotides

5

6

7

8Azathioprine

*

*

0

1

2

3

4 24h

48h

72h

Fold

Cha

nge

(Tre

ated

/Con

trol)

Fold

Cha

nge

(Tre

ated

/Con

trol)

** **

6

7

86 mercaptopurine

*

*

0

1

2

3

4

5

24h

48h

72h

** *

*

0

3

3,56 ioguanine

3

0,5

1

1,5

2

2,5

24h

48h

72h

2

1

00Fold

Cha

nge

(Tre

ated

/Con

trol)

Fig. 7. Effects of azathioprine, 6-mercaptopurine and 6-thioguanine onexpression of mRNAs encoding thiopurine metabolizing enzymes(IMPDH2, TPMT, HGPRT, XOD), glutathione metabolism enzymes(GLCR, GSS) and antioxidant enzymes (catalase, GPX2, GPX3,MnSOD) in primary culture of human hepatocytes. Human hepatocyteswere treated for 24, 48 our 72 h and total RNA was isolated to performRT-qPCR. Results are expressed as treated/control ratio. Statisticalanalysis was performed by comparing thiopurine-treated cells anduntreated cells (*, p < 0.05).

640 E. Petit et al. / Toxicology in Vitro 22 (2008) 632–642

exert a cytotoxic effect by incorporating into DNA, it couldblock replication of HepaRG cells, which have a low pro-liferating activity in their differentiated state, while havingno effect on primary hepatocytes which do not proliferate.

Although MTT variations were significant only after96 h of treatment by AZA and 6-MP, we showed dramaticeffects of AZA and 6-MP on ATP levels as early as 24 h ofincubation with these two drugs, a more pronounced

decrease being observed for primary hepatocytes whencompared with HepaRG cells. Similar results have beendemonstrated with cultured rat hepatocytes with an intra-cellular ATP depletion which precedes the decrease ofMTT reduction and cell death (Lee and Farrell, 2001).As previously demonstrated in rat hepatocytes, changesin cellular ATP levels might invoke mitochondrial injuryin the mechanism of thiopurine hepatotoxicity (Menoret al., 2004).

It has been suggested that, in rat hepatocytes treatedwith AZA, ROS production by mitochondria could dam-age membranes and macromolecules at this level (Leeand Farrell, 2001), although there are no convincing resultssupporting this hypothesis. Another potential source ofROS that could initiate oxidative stress is XOD, which cat-alyzes at least two steps in the metabolism of AZA and 6-MP. Thus, ROS may be formed during thiopurine metab-olism as well as during the cell death process as a result ofinduced mitochondrial damage. To test this hypothesis, wemeasured ROS in both primary hepatocytes and HepaRGcells in the presence or absence of 5 lM AZA, 6-MP or 6-TG. However, a significant increase of ROS productionwas observed only after 96 h in HepaRG cells treated with6-TG.

In order to determine whether the low toxic effects ofthiopurines observed with HepaRG cells and human hepa-tocytes result from low expression of thiopurine metaboliz-ing enzymes, we measured mRNA levels of major enzymesinvolved in thiopurine metabolism 72 and 120 h afterhuman hepatocyte seeding (which corresponded to the 24and 72 h of treatment times in toxicity studies) and 48and 96 h after splitting differentiated HepaRG cells (whichalso corresponded to the 24 and 72 h of treatment times intoxicity studies). Interestingly, our results demonstrate sim-ilar levels of expression of mRNAs coding for TPMT,HGPRT, IMPDH2, XOD and GSTM1 in human hepato-cytes and HepaRG cells close to those found in freshly iso-lated hepatocytes. By contrast, GSTA1/2 mRNA levelswere lower in human hepatocytes. These observations indi-cate that both human hepatocytes and HepaRG cells arepotentially able to metabolize thiopurines. To furtherinvestigate the expression of these enzymes as well as anti-oxidant enzymes, we measured their mRNA levels in con-trol and thiopurine-treated human hepatocytes. Our resultsdemonstrate for the first time an induction of IMPDH2,glutathione synthesis and antioxidant enzymes in humanhepatocytes from three different donors. Indeed, whileIMPDH2 mRNA levels were significantly increased byAZA and 6-MP, GLCR, GS, GPX2, GPX3 and MnSODwere induced by AZA and 6-MP. Up-regulation of theseenzymes was not found in HepaRG cells (data not shown).The lack of response of these latter cells might be due to theabsence or low expression of transcription factors involvedin gene regulation by thiopurines. Little is known about theregulation of IMPDH and only few studies demonstratedits up-regulation by drugs. Interestingly, investigation oferythrocyte IMPDH in immunodeficient children demon-

E. Petit et al. / Toxicology in Vitro 22 (2008) 632–642 641

strated an induction of IMPDH by ribavirin, anothernucleoside antimetabolite (Montero et al., 1995). Long-term treatment with mycophenolate mofetil was also asso-ciated with an induction of IMPDH activity in erythrocytes(Weigel et al., 2001). Finally, an increase in the levels oftype I and type II IMPDH proteins have been observedafter mitogenic stimulation in peripheral blood mononu-clear cells (Jain et al., 2004). Since IMPDH catalyzes therate-limiting step in de novo biosynthesis of guanine nucle-otides, induction of hepatic IMPDH2 by AZA, 6-MP or 6-TG might have consequences on the metabolism of thesethiopurines but also on guanine nucleotide metabolism.Induction by AZA and 6-MP of glutathione synthesis(GLCR and GS) and antioxidant enzymes (MnSOD,GPX2 and GPX3), might be involved in hepatocyte protec-tion against ROS oxidative damage.

In conclusion, we clearly demonstrate that human hepa-tic cells are less sensitive than rat hepatocytes to thiopurinetreatments. Toxic effects appear after 96 h of treatment;however ATP depletion is observed earlier (i.e. after 24 hincubation with AZA and 6-MP). While AZA and 6-MPhave similar effects on both cell damage and gene expres-sion, results obtained with 6-TG treatment are slightly dif-ferent (less toxicity in human hepatocytes and no inductionof antioxidant enzymes). Another original observation isthe up-regulation of IMPDH2 and antioxidant enzymesin human hepatocytes treated by the three thiopurines.Consequences of these inductions will have to be furtherinvestigated. Finally, our results demonstrate thatHepaRG cells are a good surrogate to human hepatocytesfor studying thiopurine toxicity since these hepatoma cellsexpress the main enzymes involved in thiopurine metabo-lism and are also sensitive to different concentrations ofAZA, 6-MP and 6-TG. They differ from the human hepa-toma HepG2 cells which are resistant to high concentra-tions of AZA (Lee and Farrell, 2001), probably becausethey do not express several GST, and more particularlyGSTM1, the main enzyme involved in the first step ofAZA transformation.

In conclusion, our study demonstrates that primaryhuman hepatocytes and HepaRG cells represent powerfulin vitro models to study toxicity of thiopurines. Further-more, we show for the first time up-regulation by AZAand 6-MP of a key enzyme involved in thiopurine metabo-lism, IMPDH2.

Acknowledgements

We thank the Biological Resource Centre (BRC) of Re-nnes for the supply of isolated human hepatocytes. Thiswork was supported in part by the Institut National de laSante et de la Recherche Medicale and the Associationpour la Recherche sur le Cancer (ARC) and an EEC con-tract (LIINTOP-STREP-037499). Elise Petit is the recipi-ent of a fellowship from the Ligue Contre le Cancer. Wethank Dr. Julie Dumont for advice on statistical analysis.

References

Aninat, C., Piton, A., Glaise, D., Le Charpentier, T., Langouet, S.,Morel, F., Guguen-Guillouzo, C., Guillouzo, A., 2006. Expressionof cytochromes P450, conjugating enzymes and nuclear receptors inhuman hepatoma HepaRG cells. Drug Metab. Dispos. 34, 75–83.

Bertino, J.R., 1991. Improving the curability of acute leukemia: pharma-cologic approaches. Semin. Hematol. 28, 9–11.

Cara, C.J., Pena, A.S., Sans, M., Rodrigo, L., Guerrero-Esteo, M.,Hinojosa, J., Garcia-Paredes, J., Guijarro, L.G., 2004. Reviewing themechanism of action of thiopurine drugs: towards a new paradigm inclinical practice. Med. Sci. Monit. 10, RA247–RA254.

Dubinsky, M.C., Lamothe, S., Yang, H.Y., Targan, S.R., Sinnett, D.,Theoret, Y., Seidman, E.G., 2000. Pharmacogenomics and metabolitemeasurement for 6-mercaptopurine therapy in inflammatory boweldisease. Gastroenterology 118, 705–713.

Dubinsky, M.C., 2004. Azathioprine, 6-mercaptopurine in inflammatorybowel disease: pharmacology, efficacy, and safety. Clin. Gastroenterol.Hepatol. 2, 731–743.

Eklund, B.I., Moberg, M., Bergquist, J., Mannervik, B., 2006. Divergentactivities of human glutathione transferases in the bioactivation ofazathioprine. Mol. Pharmacol. 70, 747–754.

El-Azhary, R.A., 2003. Azathioprine: current status and future consider-ations. Int. J. Dermatol. 42, 335–341.

Giverhaug, T., Bergan, S., Loennechen, T., Rugstad, H.E., Aarbakke, J.,1997. Analysis of methylated 6-mercaptopurine metabolites in humanred blood cells: comparison of two methods. Ther. Drug Monit. 19,663–668.

Gripon, P., Rumin, S., Urban, S., Le Seyec, J., Glaise, D., Cannie, I.,Guyomard, C., Lucas, J., Trepo, C., Guguen-Guillouzo, C., 2002.Infection of a human hepatoma cell line by hepatitis B virus. Proc.Natl. Acad. Sci. U S A 99, 15655–15660.

Guguen, C., Guillouzo, A., Boisnard, M., Le Cam, A., Bourel, M., 1975.Ultrastructural study of monolayer hepatocytes in adult rat cultures inthe presence of hydrocortisone hemisuccinate. Biol. Gastroenterol.(Paris) 83, 223–231.

Guguen-Guillouzo, C., Campion, J.P., Brissot, P., Glaise, D., Launois, B.,Bourel, M., Guillouzo, A., 1982. High yield preparation of isolatedhuman adult hepatocytes by enzymatic perfusion of the liver. Cell Biol.Int. Rep. 6, 625–628.

Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C., 2007. The human hepatoma HepaRG cells: a highlydifferentiated model for studies of liver metabolism and toxicity ofxenobiotics. Chem. Biol. Interact. 168, 66–73.

Hempel, S.L., Buettner, G.R., O’Malley, Y.Q., Wessels, D.A., Flaherty,D.M., 1999. Dihydrofluorescein diacetate is superior for detectingintracellular oxidants: comparison with 20,70-dichlorodihydrofluores-cein diacetate, 5(and 6)-carboxy-20,70-dichlorodihydrofluorescein diac-etate, and dihydrorhodamine 123. Free Radical Biol. Med. 27, 146–159.

Jain, J., Almquist, S.J., Ford, P.J., Shlyakhter, D., Wang, Y., Nimmesg-ern, E., Germann, U.A., 2004. Regulation of inosine monophosphatedehydrogenase type I and type II isoforms in human lymphocytes.Biochem. Pharmacol. 67, 767–776.

Kontorinis, N., Agarwal, K., Gondolesi, G., Fiel, M.I., O’Rourke, M.,Schiano, T.D., 2004. Diagnosis of 6-mercaptopurine hepatotoxicitypost liver transplantation utilizing metabolite assays. Am. J. Trans-plant. 4, 1539–1542.

Le Vee, M., Jigorel, E., Glaise, D., Gripon, P., Guguen-Guillouzo, C.,Fardel, O., 2006. Functional expression of sinusoidal and canalicularhepatic drug transporters in the differentiated human hepatomaHepaRG cell line. Eur. J. Pharm. Sci. 28, 109–117.

Lee, A.U., Farrell, G.C., 2001. Mechanism of azathioprine-induced injuryto hepatocytes: roles of glutathione depletion and mitochondrialinjury. J. Hepatol. 35, 756–764.

Lennard, L., 1992. The clinical pharmacology of 6-mercaptopurine. Eur.J. Clin. Pharmacol. 43, 329–339.

642 E. Petit et al. / Toxicology in Vitro 22 (2008) 632–642

Lennard, L., Welch, J.C., Lilleyman, J.S., 1997. Thiopurine drugs in thetreatment of childhood leukaemia: the influence of inherited thiopurinemethyltransferase activity on drug metabolism and cytotoxicity. Brit.J. Clin. Pharmacol. 44, 455–461.

Menor, C., Fernandez-Moreno, M.D., Fueyo, J.A., Escribano, O.,Olleros, T., Arriaza, E., Cara, C., Lorusso, M., Di Paola, M., Roman,I.D., et al., 2004. Azathioprine acts upon rat hepatocyte mitochondriaand stress-activated protein kinases leading to necrosis: protective roleof N-acetyl-L-cysteine. J. Pharmacol. Exp. Ther. 311, 668–676.

Micheau, O., Solary, E., Hammann, A., Martin, F., Dimanche-Boitrel,M.T., 1997. Sensitization of cancer cells treated with cytotoxic drugs tofas-mediated cytotoxicity. J. Natl. Cancer Inst. 89, 783–789.

Montero, C., Duley, J.A., Fairbanks, L.D., McBride, M.B., Micheli, V.,Cant, A.J., Morgan, G., 1995. Demonstration of induction of

erythrocyte inosine monophosphate dehydrogenase activity in ribavi-rin-treated patients using a high performance liquid chromatographylinked method. Clin. Chim. Acta 238, 169–178.

Nygaard, U., Toft, N., Schmiegelow, K., 2004. Methylated metabolites of6-mercaptopurine are associated with hepatotoxicity. Clin. Pharmacol.Ther. 75, 274–281.

Shaye, O.A., Yadegari, M., Abreu, M.T., Poordad, F., Simon, K., Martin,P., Papadakis, K.A., Ippoliti, A., Vasiliauskas, E., Tran, T.T., 2007.Hepatotoxicity of 6-mercaptopurine (6-MP) and azathioprine (AZA)in adult IBD patients. Am. J. Gastroenterol. 102, 2488–2494.

Weigel, G., Griesmacher, A., Zuckermann, A.O., Laufer, G., Mueller,M.M., 2001. Effect of mycophenolate mofetil therapy on inosinemonophosphate dehydrogenase induction in red blood cells of hearttransplant recipients. Clin. Pharmacol. Ther. 69, 137–144.