7
292 Vol. 36, No. 2 Biol. Pharm. Bull. 36(2) 292–298 (2013) © 2013 The Pharmaceutical Society of Japan Regular Article Differentiation of Monkey Embryonic Stem Cells to Hepatocytes by Feeder-Free Dispersion Culture and Expression Analyses of Cytochrome P450 Enzymes Responsible for Drug Metabolism Junya Maruyama, a Tamihide Matsunaga, b Satoshi Yamaori, a Sakae Sakamoto, c Noboru Kamada, c Katsunori Nakamura, b Shinji Kikuchi, c and Shigeru Ohmori* ,a a Department of Pharmacy, Shinshu University Hospital; 3–1–1 Asahi, Matsumoto 390–8621, Japan: b Graduate School of Pharmaceutical Sciences, Nagoya City University; 3–1 Tanabe-dori, Mizuho-ku, Nagoya 467–8603, Japan: and c Kissei Pharmaceutical Co., Ltd.; 4365–1 Kashiwabara, Hotaka, Azumino 399-8304, Japan. Received October 3, 2012; accepted November 15, 2012; advance publication released online December 8, 2012 We reported previously that monkey embryonic stem cells (ESCs) were differentiated into hepatocytes by formation of embryoid bodies (EBs). However, this EB formation method is not always efficient for as- says using a large number of samples simultaneously. A dispersion culture system, one of the differentiation methods without EB formation, is able to more efficiently provide a large number of feeder-free undifferenti- ated cells. A previous study demonstrated the effectiveness of the Rho-associated kinase inhibitor Y-27632 for feeder-free dispersion culture and induction of differentiation of monkey ESCs into neural cells. In the present study, the induction of differentiation of cynomolgus monkey ESCs (cmESCs) into hepatocytes was performed by the dispersion culture method, and the expression and drug inducibility of cytochrome P450 (CYP) enzymes in these hepatocytes were examined. The cmESCs were successfully differentiated into he- patocytes under feeder-free dispersion culture conditions supplemented with Y-27632. The hepatocytes dif- ferentiated from cmESCs expressed the mRNAs for three hepatocyte marker genes (α-fetoprotein, albumin, CYP7A1) and several CYP enzymes, as measured by real-time polymerase chain reaction. In particular, the basal expression of cmCYP3A4 (3A8) in these hepatocytes was detected at mRNA and enzyme activity (testosterone 6β-hydroxylation) levels. Furthermore, the expression and activity of cmCYP3A4 (3A8) were significantly upregulated by rifampicin. These results indicated the effectiveness of Y-27632 supplementa- tion for feeder-free dispersed culture and induction of differentiation into hepatocytes, and the expression of functional CYP enzyme(s) in cmESC-derived hepatic cells. Key words embryonic stem cell; differentiation; hepatocyte; monkey; cytochrome P450; feeder-free dis- persed culture Investigation of drug metabolism with human hepatocytes is important in the early stages of drug development. How- ever, primary human hepatocytes are short-lived and cannot be maintained in culture over the long term. In addition, there are large donor-dependent variations in drug metabolism. On the other hand, human embryonic stem cells (ESCs) are able to replicate infinitely and differentiate into various types of somatic cells including germ cells. 1) Thus, they represent an attractive source to provide large numbers of cells that can be utilized for the development of candidate drug-screening strategies in place of primary cells. 2) However, ethical and legal restrictions have limited the availability of human ESCs. The phenotype of human ESCs is known to closely resemble that of monkey ESCs but not mouse ESCs with regard to morphology, leukemia inhibitory factor responsiveness, gene expression profiles, and some disease models. 1,3–6) Thus, mon- key ESCs are a more suitable model for preclinical research of drug development. In particular, hepatocytes derived from monkey ESCs may be useful for pharmacokinetic studies, such as investigation of drug–drug interactions and the induc- ibility of drug-metabolizing enzymes, including cytochrome P450 (CYP). We reported previously that monkey ESCs were success- fully differentiated into hepatocytes by the formation of embryoid bodies (EBs) and treatment with specific growth factors and cytokines critical for hepatic differentiation. 7) EBs can mimic the inductive microenvironment required for liver organogenesis 8–10) and develop into many different cell types in culture. However, this EB formation method is not always appropriate for assays with large numbers of samples, such as high-throughput screening, because the formation of EBs is inefficient. A dispersion culture system, one of the differentiation methods without EB formation, can more ef- ficiently provide a large number of feeder-free undifferentiated cells. The Rho-associated kinase (ROCK) inhibitor Y-27632 enables expansion from single-cell culture of human ESCs under dispersion culture conditions because the ROCK inhibi- tor markedly reduces dissociation-induced apoptosis of human ESCs. 11) Furthermore, Takehara et al. 12) conducted direct neu- ral stem cell induction from cynomolgus monkey (Macaca fascicularis ) ESCs (cmESCs) using Y-27632 and demonstrated the effectiveness of Y-27632 supplementation for feeder-free culture and induction of differentiation. However, it is not clear whether this dispersion culture method is effective for differentiation of monkey ESCs into hepatocytes. In the present study, we carried out induction of hepatocyte differentiation from cmESCs by the dispersion culture method and examined expression and drug inducibility of CYP in the differentiated cells. MATERIALS AND METHODS Materials Growth Factor Reduced BD Matrigel Ma- trix (Matrigel reduced) was obtained from BD Biosciences * To whom correspondence should be addressed. e-mail: [email protected] The authors declare no conflict of interest.

Differentiation of Monkey Embryonic Stem Cells to ... fileenables expansion from single-cell culture of human ESCs under dispersion culture conditions because the ROCK inhibi-tor markedly

  • Upload
    others

  • View
    5

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Differentiation of Monkey Embryonic Stem Cells to ... fileenables expansion from single-cell culture of human ESCs under dispersion culture conditions because the ROCK inhibi-tor markedly

292 Vol. 36, No. 2Biol. Pharm. Bull. 36(2) 292–298 (2013)

© 2013 The Pharmaceutical Society of Japan

Regular Article

Differentiation of Monkey Embryonic Stem Cells to Hepatocytes by Feeder-Free Dispersion Culture and Expression Analyses of Cytochrome P450 Enzymes Responsible for Drug MetabolismJunya Maruyama,a Tamihide Matsunaga,b Satoshi Yamaori,a Sakae Sakamoto,c Noboru Kamada,c Katsunori Nakamura,b Shinji Kikuchi,c and Shigeru Ohmori*,a

a Department of Pharmacy, Shinshu University Hospital; 3–1–1 Asahi, Matsumoto 390–8621, Japan: b Graduate School of Pharmaceutical Sciences, Nagoya City University; 3–1 Tanabe-dori, Mizuho-ku, Nagoya 467–8603, Japan: and c Kissei Pharmaceutical Co., Ltd.; 4365–1 Kashiwabara, Hotaka, Azumino 399-8304, Japan.Received October 3, 2012; accepted November 15, 2012; advance publication released online December 8, 2012

We reported previously that monkey embryonic stem cells (ESCs) were differentiated into hepatocytes by formation of embryoid bodies (EBs). However, this EB formation method is not always efficient for as-says using a large number of samples simultaneously. A dispersion culture system, one of the differentiation methods without EB formation, is able to more efficiently provide a large number of feeder-free undifferenti-ated cells. A previous study demonstrated the effectiveness of the Rho-associated kinase inhibitor Y-27632 for feeder-free dispersion culture and induction of differentiation of monkey ESCs into neural cells. In the present study, the induction of differentiation of cynomolgus monkey ESCs (cmESCs) into hepatocytes was performed by the dispersion culture method, and the expression and drug inducibility of cytochrome P450 (CYP) enzymes in these hepatocytes were examined. The cmESCs were successfully differentiated into he-patocytes under feeder-free dispersion culture conditions supplemented with Y-27632. The hepatocytes dif-ferentiated from cmESCs expressed the mRNAs for three hepatocyte marker genes (α-fetoprotein, albumin, CYP7A1) and several CYP enzymes, as measured by real-time polymerase chain reaction. In particular, the basal expression of cmCYP3A4 (3A8) in these hepatocytes was detected at mRNA and enzyme activity (testosterone 6β-hydroxylation) levels. Furthermore, the expression and activity of cmCYP3A4 (3A8) were significantly upregulated by rifampicin. These results indicated the effectiveness of Y-27632 supplementa-tion for feeder-free dispersed culture and induction of differentiation into hepatocytes, and the expression of functional CYP enzyme(s) in cmESC-derived hepatic cells.

Key words embryonic stem cell; differentiation; hepatocyte; monkey; cytochrome P450; feeder-free dis-persed culture

Investigation of drug metabolism with human hepatocytes is important in the early stages of drug development. How-ever, primary human hepatocytes are short-lived and cannot be maintained in culture over the long term. In addition, there are large donor-dependent variations in drug metabolism. On the other hand, human embryonic stem cells (ESCs) are able to replicate infinitely and differentiate into various types of somatic cells including germ cells.1) Thus, they represent an attractive source to provide large numbers of cells that can be utilized for the development of candidate drug-screening strategies in place of primary cells.2) However, ethical and legal restrictions have limited the availability of human ESCs. The phenotype of human ESCs is known to closely resemble that of monkey ESCs but not mouse ESCs with regard to morphology, leukemia inhibitory factor responsiveness, gene expression profiles, and some disease models.1,3–6) Thus, mon-key ESCs are a more suitable model for preclinical research of drug development. In particular, hepatocytes derived from monkey ESCs may be useful for pharmacokinetic studies, such as investigation of drug–drug interactions and the induc-ibility of drug-metabolizing enzymes, including cytochrome P450 (CYP).

We reported previously that monkey ESCs were success-fully differentiated into hepatocytes by the formation of embryoid bodies (EBs) and treatment with specific growth factors and cytokines critical for hepatic differentiation.7)

EBs can mimic the inductive microenvironment required for liver organogenesis8–10) and develop into many different cell types in culture. However, this EB formation method is not always appropriate for assays with large numbers of samples, such as high-throughput screening, because the formation of EBs is inefficient. A dispersion culture system, one of the differentiation methods without EB formation, can more ef-ficiently provide a large number of feeder-free undifferentiated cells. The Rho-associated kinase (ROCK) inhibitor Y-27632 enables expansion from single-cell culture of human ESCs under dispersion culture conditions because the ROCK inhibi-tor markedly reduces dissociation-induced apoptosis of human ESCs.11) Furthermore, Takehara et al.12) conducted direct neu-ral stem cell induction from cynomolgus monkey (Macaca fascicularis) ESCs (cmESCs) using Y-27632 and demonstrated the effectiveness of Y-27632 supplementation for feeder-free culture and induction of differentiation. However, it is not clear whether this dispersion culture method is effective for differentiation of monkey ESCs into hepatocytes.

In the present study, we carried out induction of hepatocyte differentiation from cmESCs by the dispersion culture method and examined expression and drug inducibility of CYP in the differentiated cells.

MATERIAlS AND METHODS

Materials Growth Factor Reduced BD Matrigel Ma-trix (Matrigel reduced) was obtained from BD Biosciences

* To whom correspondence should be addressed. e-mail: [email protected]

The authors declare no conflict of interest.

Page 2: Differentiation of Monkey Embryonic Stem Cells to ... fileenables expansion from single-cell culture of human ESCs under dispersion culture conditions because the ROCK inhibi-tor markedly

February 2013 293

(Bedford, MA, U.S.A.); mitomycin C, Dulbecco’s modified Eagle’s medium (DMEM), William’s E medium with Glu-taMAX without phenol red, MEM non-essential amino acid solution (100×), and 6β-hydroxytestosterone from Sigma (St. Louis, MO, U.S.A.); murine embryonic fibroblasts (MEF) from Oriental Yeast (Tokyo, Japan); RPMI1640 medium sup-plemented with GlutaMAX, KnockOut™ DMEM, KnockOut Serum Replacement (KSR), minimum essential medium (MEM), l-glutamine, 0.25% (w/v) trypsin-ethylenediamine-tetraacetic acid (EDTA), and SuperScript™ III First-Strand Synthesis System for reverse transcription-polymerase chain reaction (RT-PCR) from Invitrogen life Technologies (Carls-bad, CA, U.S.A.); fetal bovine serum (FBS) from Equitech-Bio, Inc. (Kerrville, TX, U.S.A.); recombinant human activin A and recombinant human hepatocyte growth factor (HGF) from Funakoshi Co., Ltd. (Tokyo, Japan); modified Lanford medium from Charles River laboratories Japan Inc. (Yoko-hama, Japan); recombinant human basic fibroblast growth factor (bFGF), Y-27632, oncostatin M (OSM), dexamethasone (DEX), rifampicin (RIF), testosterone, and dimethyl sulfoxide (DMSO) from Wako Pure Chemicals (Osaka, Japan); [2H7]6β-hydroxytestosterone from BD Gentest (Franklin lakes, NJ, U.S.A.); illustra RNAspin Mini RNA Isolation kit from GE Healthcare (Tokyo, Japan); SYBR® Green real-time PCR Mas-ter Mix from TaKaRa Bio (Otsu, Japan). All other reagents used were of the highest quality available.

ESC Culture and Differentiation The cmESCs (CMK6) were generously provided by Tanabe Seiyaku Co., ltd. (Osaka, Japan)4) and maintained according to the method reported previously7) except that recombinant human bFGF

was added to ES medium. Feeder-free dispersed culture was carried out as follows (Fig. 1A). The cmESCs were cultured in the presence of 10 µm Y-27632 for 1 h before detaching the cells from the feeder layer. After detachment of the cmESCs, contaminating MEF were removed by incubating the cell suspension on gelatin-coated plates (BD Falcon, Franklin lakes, NJ, U.S.A.) at 37°C for 2 h. The cmESC clumps were recovered from the suspension by centrifugation, incubated in 0.25% (w/v) trypsin-EDTA solution at 37°C for 5 min, and dis-sociated into single cells by pipetting. The cells were passed through a Cell Strainer (40 µm mesh; BD Falcon) and seeded onto culture plates 6 cm in diameter (BD Falcon) coated with Matrigel reduced (25-fold dilution). The cmESCs were cul-tured in medium conditioned by contact with MEF with 4 ng/ml recombinant human bFGF and 10 µm Y-27632 for the first 24 h. The medium was changed for MEF-conditioned medium for cmESCs without Y-27632.

When cmESCs reached approximately 70% confluence, differentiation was initiated by replacing RPMI1640 me-dium supplemented with GlutaMax containing 0.5% FBS and 100 ng/ml activin A (Fig. 1B). After 72 h, the medium was changed to RPMI1640 medium supplemented with GlutaMax containing 2% KSR and 100 ng/ml activin A, and culture was continued for 48 h. The cells were passaged onto 24-well plates coated with Matrigel reduced (25-fold dilution) and cultured in KnockOut™ DMEM containing 20% KSR, 1 mm l-glutamine, 1% MEM nonessential amino acids, and 1% DMSO for 7 d. Finally, the cells were cultured in modified Lanford medium containing 10 ng/ml HGF, 20 ng/ml OSM, and 100 nm DEX. The medium was changed daily during differentiation.

Fig. 1. Scheme of in Vitro Differentiation of cmESCs into Hepatocytes(A) Illustration of the feeder-free dispersion culture of undifferentiated cmESCs. (B) Schematic procedure of differentiation of cmESCs into hepatocytes and drug treat-

ment.

Page 3: Differentiation of Monkey Embryonic Stem Cells to ... fileenables expansion from single-cell culture of human ESCs under dispersion culture conditions because the ROCK inhibi-tor markedly

294 Vol. 36, No. 2

Drug Treatment To clarify the effects of RIF on expres-sion of CYP, cmESC-derived hepatocytes were treated with 40 µm RIF for 72 h (Fig. 1B). The compound was dissolved in DMSO, which was added to the modified Lanford medium at a final concentration of 0.1%.

Primary Hepatocyte Culture Primary cynomolgus mon-key hepatocytes (primary cmHCs, Batch HEP 18605) were obtained from BIOPREDIC International (Renes, France). The primary cmHCs were thawed according to the manufac-turer’s instructions. Briefly, the primary cmHCs were cultured on 24-well plates (BD Falcon) in William’s E medium with GlutaMax without phenol red for 72 h, and the medium was changed daily.

Real-time PCR Analysis Total RNA was isolated from the cells and the liver of an adult male monkey (Ina Research Inc., Ina, Japan) using the illustra RNAspin Mini RNA Isola-tion kit according to the manufacturer’s protocol. First-strand cDNA was generated from 5 µg of total RNA. Reverse tran-scription reaction was performed using the SuperScript™ III First-Strand Synthesis System for RT-PCR in accordance with the manufacturer’s instructions. For detection of mRNA expression levels, CYP mRNAs were analyzed by SYBR® Green real-time quantitative PCR. All PCR procedures were performed using the ABI Prism 7300 Real-time PCR System (Applied Biosystems, Foster City, CA, U.S.A.). PCR was per-formed in a mixture consisting of 10 µl of SYBR® Green real-time PCR Master Mix, 0.4 µl of 10 µm forward and reverse primers, 0.4 µl of dye, 7.8 µl of water, and 1 µl template cDNA in a total of 20 µl. The primers used are summarized in Table 1. The levels of these mRNAs were normalized relative to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA.

Measurement of Cellular Activity of Testosterone 6β-Hydroxylation Following drug treatment, cmESC-de-rived hepatocytes were incubated with 100 µm testosterone in modified Lanford medium for 6 h. On the other hand, primary cmHCs were incubated with 100 µm testosterone in MEM for 6 h. After incubation, each medium was collected and 6β-hydroxytestosterone was measured by lC-MS/MS under the conditions described below.

Instrument An Agilent 1100 series HPlC system (Agi-lent Technologies, Waldbronn, Germany) consisting of a bi-nary pump, a degasser linked to a CTC HTS PAl New Wash System Autosampler (AMR Inc., Tokyo, Japan) was used.

Mass spectrometry was performed on an API 4000 triple qua-druple instrument (Applied Biosystems/Sciex, Foster City, CA, U.S.A.) equipped with a TurboIonSpray® electrospray ioniza-tion (ESI) interface. Data processing was performed with the Analyst 1.4.2 software package (Applied Biosystems/Sciex).

Chromatographic Conditions Chromatographic separa-tion was performed on a reversed-phase CAPCEll PAK C18 MG III column (50×4.6 mm i.d., 5 µm; Shiseido Co., Inc., Tokyo, Japan). The column temperature was kept constant at 40°C. The mobile phase consisted of a mixture of 10 mm ammonium acetate in water (A) with 0.1% formic acid in methanol (B) and was delivered at a flow rate of 0.5 mL/min. A stepwise gradient was used as shown in Table 2.

Mass Spectrometry Conditions The mass spectrometer was operated using the ESI source in positive ion mode. To optimize all of the MS parameters, standard solutions (100 ng/ml) and internal standard were infused into the mass spec-trometer at a flow rate of 250 µl/min. The ion spray voltage (IS) was set at 4500 V. The TurboIonSpray probe temperature was maintained at 600°C. The instrument parameters viz., nebulizer gas, curtain gas, auxiliary gas, and collision gas, were set at 60, 15, 80, and 5, respectively. Compound param-eters viz., declustering potential, collision energy, entrance potential, and collision exit potential, were 40, 20, 10, and 15, respectively, for 6β-hydroxytestosterone and [2H7]6β-hydroxytestosterone. Zero air was used as the source gas, while nitrogen was used as both curtain and collision gas. The mass spectrometer was operated in ESI positive ion mode and detection of the ions was performed in the multiple reaction monitoring (MRM) mode, monitoring the transi-tion of m/z 305 precursor ion [M+ H] to the m/z 269 product ion for 6β-hydroxytestosterone (retention time 8.7 min) and m/z 312 precursor ion [M+ H] to the m/z 276 product ion for

Table 1. Primers Used for Real-Time PCR Analysis

Genes Forward primer (5′–3′) Reverse primer (5′–3′) Product (bp)

AFP ACTATTGGCCTGTGGTGAGG CACCCTGAGCTTGACACAGA 224AlB CTTCCTGGGCATGTTTTTGT GGCTCTTCCACAAGAGGTTG 177

CYP1A1 CTAGACACAGTGATTGGCAGGTC GGTTGACCCATAGCTTCTGGTCA 232cmCYP2B6 (2B30) GGGGCATTGAAGAAGAATGA ATTTTGCCCACACCACTCTC 188cmCYP2C9 (2C43) TGATTCCCAAGGGTACAACC AAATTGCCACCTTCATCCAG 118cmCYP2D6 (2D17) AGATCGACGACGTGATAGGG GTCCCCTTAGGGATGAGGAA 178cmCYP3A4 (3A8) CCAAGAAGCTTTTAAGATTTGATTTC ATCTACTCGGTGCTTTTGTGTA 191cmCYP3A5 (3A66) TTTGCCCAATAAGGCACCTG GGTTGGAATCACCACCATTG 181

CYP7A1 ATTTGGTGCCAATCCTCTTG CATCCTTTGGGTCAATGCTT 215AhR ACTCCACTTCAGCCACCATC CTCGTGCACAGTTCTGCTTC 146PXR AAGGATGCAAGGGCTTTTTC TTCTTCATGCCGCTCTCC 151

GAPDH GTCAGTGGACCTGACCT TGCTGTAGCCAAATTCGTTG 245AFP, α-fetoprotein; AlB, albumin; AhR, aryl hydrocarbon receptor; PXR, pregnane X receptor; GADPH, glyceraldehyde-3-phosphate dehydrogenase.

Table 2. Timetable for HPlC

Time (min) Solvent A (%) Solvent B (%)

0 10 903 10 906 90 109 90 109.1 10 90

16 10 90Solvents A: 10 mm ammonium acetate in water. Solvents B: 0.1% formic acid in

methanol.

Page 4: Differentiation of Monkey Embryonic Stem Cells to ... fileenables expansion from single-cell culture of human ESCs under dispersion culture conditions because the ROCK inhibi-tor markedly

February 2013 295

[2H7]6β-hydroxytestosterone (8.7 min). Quadrupoles Q1 and Q3 were set to unit resolution. Data acquisition and quantifica-tion were performed using Analyst software version 1.4.2 (Ap-plied Biosystems, MDS Sciex, Toronto, ON, Canada).

Calibration Standards Calibration standards to cover the assay range of 10–5000 nm 6β-hydroxytestosterone were pre-pared by adding 10 µl of 0.1, 0.5, 1, 5, 10, and 50 µm working standards to 0.1 ml aliquots of control reaction mixture.

Statistical Analysis Statistical significance was assessed using the unpaired t test. In all analyses, p < 0.05 was taken to indicate statistical significance.

RESUlTS

Morphology of cmESCs at Individual Culture Steps A typical colony of undifferentiated cmESCs is shown in Fig. 2A. As reported previously for primate ESCs, undifferentiated cmESCs formed tightly packed and flat colonies.4) Each cell had a high nucleus/cytoplasm ratio and prominent nucleolus. In an effort to circumvent the problem of apoptosis in cmESC culture, the single-cell dispersed culture was performed under feeder-free cell culture conditions using Y-27632. The undif-ferentiated cmESCs were cultured in the presence of 10 µm Y-27632 for 1 h before detaching the cells from the feeder layer. After the cmESC colonies were dissociated by trypsin and suspended, the cells were seeded on gelatin-coated plates. In this procedure, contaminating MEF adhered to the plate bottom, whereas the cmESCs did not (Fig. 2B). The cmESC clumps were recovered from the suspension and dissociated into single cells by pipetting. The single cells were cultured on culture plates 6 cm in diameter coated with Matrigel re-duced (25-fold dilution) in the presence of 10 µm Y-27632 for first 24 h. The cmESCs proliferated on the feeder-free culture plates (Fig. 2C). Twenty-seven days after initiation of

hepatocyte differentiation, cells showed characteristic mor-phologies of hepatocytes, i.e., polygonal in shape and multiple nuclei (Fig. 2D). Y-27632 was effective for cmESC survival under dispersion culture conditions.

Expression of Hepatocyte Markers and CYP Enzymes in Primary cmHCs and cmESC-Derived Hepatocytes The mRNA expression levels of hepatocyte marker genes and CYP enzymes in primary cmHCs and differentiated cells from cmESCs were measured by a real-time PCR method. As shown in Fig. 3, the mRNAs of hepatocyte marker genes, α-fetoprotein (AFP), albumin (AlB), and CYP7A1, were detected in cmESC-derived hepatocytes together with those of CYP1A1, cmCYP2B6 (2B30), cmCYP2C9 (2C43), cmCYP2D6 (2D17), cmCYP3A4 (3A8), cmCYP3A5 (3A66), pregnane X receptor (PXR), and aryl hydrocarbon receptor (AhR). The mRNA levels of AFP and CYP7A1 in differenti-ated cells from cmESCs were 16- and 21-fold, respectively, higher than those in primary cmHCs, although the expression level of AlB was approximately 80-fold lower in cmESC-derived hepatocytes than in primary cmHCs. The mRNA levels of CYP1A1, cmCYP2B6 (2B30), cmCYP2C9 (2C43), cmCYP2D6 (2D17), cmCYP3A4 (3A8), cmCYP3A5 (3A66), and PXR in the cells differentiated from cmESCs were 386-, 7.4-, 284-, 1.6-, 136-, 5.9-, and 13-fold, respectively, lower than those in primary cmHCs. In contrast, the expression level of AhR mRNA in cmESC-derived hepatocytes was 2.2-fold higher than that in primary cmHCs.

Testosterone 6β-Hydroxylase Activity of Primary cmHCs and cmESC-Derived Hepatocytes Testosterone 6β-hydroxylase activity as a marker of CYP3A, especially cmCYP3A4 (3A8), was evaluated with primary cmHCs and cmESC-derived hepatocytes. Testosterone 6β-hydroxylase activity was detected in the cells differentiated from cmESCs (Fig. 4). The activity was about one sixth that of the primary

Fig. 2. Morphology of cmESCs in Individual Culture Processes(A) Undifferentiated cmESCs. (B) Suspended cmESCs incubated on gelatin-coated plates for 2 h. (C) cmESCs cultured on plates 6 cm in diameter coated with Matrigel

reduced (25-fold dilution) for 24 h. (D) cmESC-derived cells at 27 d after the initiation of hepatocyte differentiation. The cells were visualized by phase microscopy. Bars, 200 µm; 30 µm for A and D insets.

Page 5: Differentiation of Monkey Embryonic Stem Cells to ... fileenables expansion from single-cell culture of human ESCs under dispersion culture conditions because the ROCK inhibi-tor markedly

296 Vol. 36, No. 2

cmHCs.Effects of RIF on the Expression Level and Activity of

cmCYP3A4 (3A8) in the Cells Differentiated from cmESCs The induction potency of cmCYP3A4 (3A8) by RIF, which is known as a cmCYP3A4 (3A8) inducer,13,14) was examined with the cells differentiated from cmESCs. The expression of cmCYP3A4 (3A8) mRNA was significantly induced by RIF in the cmESC-derived hepatocytes (Fig. 5A). The activity of tes-tosterone 6β-hydroxylase in the cmESC-derived hepatocytes was significantly enhanced by RIF (Fig. 5B).

DISCUSSION

The method to induce differentiation of ESCs to hepatic cells was first established using mouse cells.15–17) Many of these methods involve a procedure to differentiate ESCs by EB formation and adhesion culture. EBs differentiate into three embryonic germ layers by suspended cell culture of ESCs, and these cells can then further differentiate into mul-tiple cell types, including hepatocytes, in vitro.18) This method was applied to the induction of differentiation of monkey ESCs into hepatic cells.7) In recent studies, however, a method to add some direct inducing factors to a monolayer culture system of an undifferentiated ESC colony without EB forma-tion has been used extensively. Furthermore, some improved methods for more efficient differentiation into hepatocytes have been reported. Among these methods, the stepwise ad-dition of two or more factors is most common.19–23) However, if these complicated operations are not performed adequately, the death of ESCs can easily occur. In previous culture sys-tems, remarkable reduction of the number of live cells was a technical obstacle to the induction of differentiation. Watanabe et al.11) found that the death of human ESCs occurring after cell dissociation is triggered by activation of ROCK, and that the ROCK inhibitor Y-27632 can control the death of ESCs. Interestingly, Takehara et al.12) demonstrated that Y-27632 also promotes survival of cmESCs and enables expansion from single cells without loss of their pluripotent characteristics. These findings suggest that reactions to the ROCK inhibitor may be preserved in primate ESCs. In addition, it has been shown that Y-27632 supplementation also enables cmESC

expansion in feeder-free culture.12) Feeder cells supply secreto-ry components, extracellular matrix, and intercellular contacts for maintenance of an undifferentiated state and pluripotency of ESCs. However, the use of feeder cells leads to the poten-tial for cross-contamination, such as the passing of animal pathogens to ESCs. On the other hand, feeder-free culture is a system to maintain ESCs in an undifferentiated state without direct contact with feeder cells. The ROCK inhibitor, Y-27632, is an important factor to enable adhesion and proliferation of primate ESCs in feeder-free culture. In the present study, we confirmed that dissociated cmESCs treated with Y-27632 were protected from cell death in feeder-free culture and formed clumps (Fig. 2B). Furthermore, the cells differentiated from cmESCs showed multinuclear morphology characteristic of hepatocytes at the final stage of differentiation (Fig. 2D). This feeder-free dispersion culture method was reproducible with-out any technical obstacles.

Although AlB is the most abundant protein synthesized by mature hepatocytes, its expression starts in early fetal hepa-tocytes and reaches the maximal level in adult hepatocytes.24) Our study showed that the expression of AlB mRNA in

Fig. 3. Expression levels of mRNAs for Hepatocyte Markers and CYP Enzymes in Primary cmHCs and cmESC-Derived HepatocytesTarget mRNAs were analyzed by SYBR Green real-time PCR as described in Materials and Methods. Data are presented as the relative levels (means±S.D., n=3) of pri-

mary cmHCs (open columns) or cmESC-derived hepatocytes (closed columns) to adult monkey liver. Significantly different from primary cmHCs (* p < 0.05, ** p < 0.01).

Fig. 4. Testosterone 6β-Hydroxylase Activity of Primary cmHCs and cmESC-Derived Hepatocytes

Primary cmHCs and cmESC-derived hepatocytes were incubated with testoster-one at a final concentration of 100 µm for 6 h. Testosterone 6β-hydroxylase activity as a marker of CYP3A, especially cmCYP3A4 (3A8), was measured by lC-MS/MS as described in Materials and Methods. Values are expressed as the means±S.D. (n=3). Significantly different from primary cmHCs (** p<0.01).

Page 6: Differentiation of Monkey Embryonic Stem Cells to ... fileenables expansion from single-cell culture of human ESCs under dispersion culture conditions because the ROCK inhibi-tor markedly

February 2013 297

hepatocytes differentiated from cmESCs was markedly lower than in primary cmHCs and adult monkey liver. On the other hand, AFP is a marker of endodermal differentiation as well as an early fetal hepatic marker; its expression level decreases as the liver develops into the adult phenotype. In this study, the expression of AFP mRNA in cmESC-derived hepatocytes was higher than that in primary cmHCs, although the mRNA level in the former cells was comparable to that in adult mon-key liver. These results suggest that cmESC-derived hepato-cytes may be differentiated into more immature cells rather than into mature cells.

CYP1A1 is a major CYP1A isoform expressed in the monkey liver,25) in contrast to the human liver, which mainly expresses CYP1A2 but not CYP1A1.26) cmCYP2B6 (2B30), cmCYP2C9 (2C43), cmCYP2D6 (2D17), cmCYP3A4 (3A8), and cmCYP3A5 (3A66) are major CYP enzymes in the cyno-molgus monkey liver.27) These monkey CYP enzymes show a high degree of amino acid sequence identity (>90%) with corresponding human CYP enzymes and catalyze typical drug oxidations of corresponding human CYP isoforms.28) To characterize the expression of CYP1A1, cmCYP2B6 (2B30), cmCYP2C9 (2C43), cmCYP2D6 (2D17), cmCYP3A4 (3A8), and cmCYP3A5 (3A66) in hepatocytes differentiated from cmESCs, the basal gene expression patterns of these CYP en-zymes were compared with primary cmHCs. The expression levels of the CYP enzymes examined were lower in cmESC-derived hepatocytes than in primary cmHCs. The lower expression of these CYP enzymes may be associated with hepatocyte maturity. In this study, the cmESC-derived hepatic cells were found to express cmCYP3A4 (3A8) mRNA. This enzyme function in differentiated hepatocytes was confirmed by testosterone 6β-hydroxylase activity. To our knowledge, this is the first study showing the functional expression of cer-tain CYP enzyme in cmESC-derived hepatic cells. Further-more, these cells showed inducibility of cmCYP3A4 (3A8) by RIF at mRNA and activity levels. This inducibility was quali-tatively reproducible. The effects of RIF on mRNA expres-sion of cmCYP3A4 (3A8) in the cmESC-derived hepatic cells was consistent with the findings reported previously.7) It was previously reported that cmCYP3A4 (3A8) is induced by RIF

through the transcription factor PXR.29) Our study showed that PXR is expressed in cmESC-derived hepatic cells. These results suggest that PXR is active in these hepatocytes. This has important implications for the application of cmESC-de-rived hepatic cells as an in vitro model for drug development. However, the functional significance of cmCYP3A4 (3A8) and PXR in cmESC-derived hepatocytes was limited in this study because the data were partially qualitative. Further improve-ments are required, particularly with regard to maturation and quantitative analysis, for use of cmESC-derived hepatocytes in drug screening.

In conclusion, cmESCs were successfully differentiated into hepatocytes under feeder-free dispersion culture conditions supplemented with Y-27632. In addition, the basal expression and drug inducibility of CYP enzymes were characterized in these hepatocytes. These results suggest that cmESC-derived hepatocytes may be used as a potential source for stable sup-ply of hepatocytes for drug metabolism analysis, although fur-ther investigations are needed to improve this method.

Acknowledgments This work was partly supported by Grants-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan (Nos. 20926015, 22926013, and 23926012). We also thank Ms. K. Aikawa for technical assistance. We are grateful to Tanabe Seiyaku Co., ltd. (Osaka, Japan) for generously providing cmESCs (CMK6).

REFERENCES

1) Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM. Embryonic stem cell lines derived from human blastocysts. Science, 282, 1145–1147 (1998).

2) Davila JC, Cezar GG, Thiede M, Strom S, Miki T, Trosko J. Use and application of stem cells in toxicology. Toxicol. Sci., 79, 214–223 (2004).

3) Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A. Embry-onic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat. Biotechnol., 18, 399–404 (2000).

4) Suemori H, Tada T, Torii R, Hosoi Y, Kobayashi K, Imahie H, Kondo Y, Iritani A, Nakatsuji N. Establishment of embryonic stem

Fig. 5. Effects of RIF on cmCYP3A4 (3A8) mRNA Expression level and Testosterone 6β-Hydroxylase Activity in Cells Differentiated from cmESCs

cmESC-Derived hepatocytes were treated with vehicle (0.1% DMSO) or 40 µm RIF for 72 h. After treatment with RIF, the cells were incubated with testosterone at a concentration of 100 µm for 6 h. (A) cmCYP3A4 (3A8) mRNA was analyzed by SYBR Green real-time PCR as described in Materials and Methods. Data are presented as the relative levels (means±S.D., n=3) of RIF treatment to vehicle treatment. (B) Testosterone 6β-hydroxylase activity was measured by lC-MS/MS as described in Materi-als and Methods. Significantly different from control (* p<0.05, ** p<0.01).

Page 7: Differentiation of Monkey Embryonic Stem Cells to ... fileenables expansion from single-cell culture of human ESCs under dispersion culture conditions because the ROCK inhibi-tor markedly

298 Vol. 36, No. 2

cell lines from cynomolgus monkey blastocysts produced by IVF or ICSI. Dev. Dyn., 222, 273–279 (2001).

5) Ginis I, luo Y, Miura T, Thies S, Brandenberger R, Gerecht-Nir S, Amit M, Hoke A, Carpenter MK, Itskovitz-Eldor J, Rao MS. Differ-ences between human and mouse embryonic stem cells. Dev. Biol., 269, 360–380 (2004).

6) Suemori H, Nakatsuji N. Generation and characterization of mon-key embryonic stem cells. Methods Mol. Biol., 329, 81–89 (2006).

7) Momose Y, Matsunaga T, Murai K, Takezawa T, Ohmori S. Dif-ferentiation of monkey embryonic stem cells into hepatocytes and mRNA expression of cytochrome p450 enzymes responsible for drug metabolism: comparison of embryoid body formation condi-tions and matrices. Biol. Pharm. Bull., 32, 619–626 (2009).

8) lavon N, Benvenisty N. Study of hepatocyte differentiation using embryonic stem cells. J. Cell. Biochem., 96, 1193–1202 (2005).

9) Asahina K, Fujimori H, Shimizu-Saito K, Kumashiro Y, Okamura K, Tanaka Y, Teramoto K, Arii S, Teraoka H. Expression of the liver-specific gene Cyp7a1 reveals hepatic differentiation in embry-oid bodies derived from mouse embryonic stem cells. Genes Cells, 9, 1297–1308 (2004).

10) Heo J, Factor VM, Uren T, Takahama Y, lee JS, Major M, Fein-stone SM, Thorgeirsson SS. Hepatic precursors derived from murine embryonic stem cells contribute to regeneration of injured liver. Hepatology, 44, 1478–1486 (2006).

11) Watanabe K, Ueno M, Kamiya D, Nishiyama A, Matsumura M, Wataya T, Takahashi JB, Nishikawa S, Nishikawa S, Muguruma K, Sasai Y. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat. Biotechnol., 25, 681–686 (2007).

12) Takehara T, Teramura T, Onodera Y, Kakegawa R, Fukunaga N, Takenoshita M, Sagawa N, Fukuda K, Hosoi Y. Rho-associated kinase inhibitor Y-27632 promotes survival of cynomolgus monkey embryonic stem cells. Mol. Hum. Reprod., 14, 627–634 (2008).

13) Nishimura M, Koeda A, Suganuma Y, Suzuki E, Shimizu T, Na-kayama M, Satoh T, Narimatsu S, Naito S. Comparison of induc-ibility of CYP1A and CYP3A mRNAs by prototypical inducers in primary cultures of human, cynomolgus monkey, and rat hepato-cytes. Drug Metab. Pharmacokinet., 22, 178–186 (2007).

14) Ohtsuka T, Yoshikawa T, Kozakai K, Tsuneto Y, Uno Y, Utoh M, Yamazaki H, Kume T. Alprazolam as an in vivo probe for studying induction of CYP3A in cynomolgus monkeys. Drug Metab. Dispos., 38, 1806–1813 (2010).

15) Hamazaki T, Iiboshi Y, Oka M, Papst PJ, Meacham AM, Zon lI, Terada N. Hepatic maturation in differentiating embryonic stem cells in vitro. FEBS Lett., 497, 15–19 (2001).

16) Chinzei R, Tanaka Y, Shimizu-Saito K, Hara Y, Kakinuma S, Watanabe M, Teramoto K, Arii S, Takase K, Sato C, Terada N, Tera oka H. Embryoid-body cells derived from a mouse embry-onic stem cell line show differentiation into functional hepatocytes. Hepatology, 36, 22–29 (2002).

17) Maezawa K, Miyazato K, Matsunaga T, Momose Y, Imamura T, Johkura K, Sasaki K, Ohmori S. Expression of cytochrome P450

and transcription factors during in vitro differentiation of mouse embryonic stem cells into hepatocytes. Drug Metab. Pharmaco-kinet., 23, 188–195 (2008).

18) Doetschman TC, Eistetter H, Katz M, Schmidt W, Kemler R. The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium. J. Embryol. Exp. Morphol., 87, 27–45 (1985).

19) Cai J, Zhao Y, liu Y, Ye F, Song Z, Qin H, Meng S, Chen Y, Zhou R, Song X, Guo Y, Ding M, Deng H. Directed differentiation of human embryonic stem cells into functional hepatic cells. Hepatol-ogy, 45, 1229–1239 (2007).

20) Agarwal S, Holton KL, Lanza R. Efficient differentiation of func-tional hepatocytes from human embryonic stem cells. Stem Cells, 26, 1117–1127 (2008).

21) Hay DC, Zhao D, Fletcher J, Hewitt ZA, Mclean D, Urruticoechea-Uriguen A, Black JR, Elcombe C, Ross JA, Wolf R, Cui W. Ef-ficient differentiation of hepatocytes from human embryonic stem cells exhibiting markers recapitulating liver development in vivo. Stem Cells, 26, 894–902 (2008).

22) Touboul T, Hannan NR, Corbineau S, Martinez A, Martinet C, Branchereau S, Mainot S, Strick-Marchand H, Pedersen R, Di Santo J, Weber A, Vallier l. Generation of functional hepatocytes from human embryonic stem cells under chemically defined conditions that recapitulate liver development. Hepatology, 51, 1754–1765 (2010).

23) Zhou M, li P, Tan l, Qu S, Ying Ql, Song H. Differentiation of mouse embryonic stem cells into hepatocytes induced by a com-bination of cytokines and sodium butyrate. J. Cell. Biochem., 109, 606–614 (2010).

24) Sellem CH, Frain M, Erdos T, Sala-Trepat JM. Differential ex-pression of albumin and alpha-fetoprotein genes in fetal tissues of mouse and rat. Dev. Biol., 102, 51–60 (1984).

25) Sakuma T, Hieda M, Igarashi T, Ohgiya S, Nagata R, Nemoto N, Kamataki T. Molecular cloning and functional analysis of cynomol-gus monkey CYP1A2. Biochem. Pharmacol., 56, 131–139 (1998).

26) Schweikl H, Taylor JA, Kitareewan S, linko P, Nagorney D, Gold-stein JA. Expression of CYP1A1 and CYP1A2 genes in human liver. Pharmacogenetics, 3, 239–249 (1993).

27) Uehara S, Murayama N, Nakanishi Y, Zeldin DC, Yamazaki H, Uno Y. Immunochemical detection of cytochrome P450 enzymes in liver microsomes of 27 cynomolgus monkeys. J. Pharmacol. Exp. Ther., 339, 654–661 (2011).

28) Iwasaki K, Uno Y. Cynomolgus monkey CYPs: a comparison with human CYPs. Xenobiotica, 39, 578–581 (2009).

29) Kim S, Dinchuk JE, Anthony MN, Orcutt T, Zoeckler ME, Sauer MB, Mosure KW, Vuppugalla R, Grace JE Jr, Simmermacher J, Dulac HA, Pizzano J, Sinz M. Evaluation of cynomolgus monkey pregnane X receptor, primary hepatocyte, and in vivo pharmacoki-netic changes in predicting human CYP3A4 induction. Drug Metab. Dispos., 38, 16–24 (2010).