Da

GGN

a

ARR2AA

KSADKAV

1

pubdnikun

0d

Journal of Ethnopharmacology 128 (2010) 433–437

Contents lists available at ScienceDirect

Journal of Ethnopharmacology

journa l homepage: www.e lsev ier .com/ locate / je thpharm

iuretic activity and kidney medulla AQP1, AQP2, AQP3, V2R expression of thequeous extract of sclerotia of Polyporus umbellatus FRIES in normal rats

uowei Zhang, Xing Zeng ∗, Ling Han, Jian-an Wei, Haiding Huanguangdong Provincial Academy of Chinese Medical Sciences, Guangdong Provincial Traditional Chinese Medicine Hospital, Guangzhou University of Traditional Chinese Medicine,eihuanxi Road, University Town, Guangzhou, 510006, Guangdong Province, China

r t i c l e i n f o

rticle history:eceived 8 July 2009eceived in revised form9 December 2009ccepted 11 January 2010vailable online 18 January 2010

eywords:clerotia of Polyporus umbellatusqueous extractiuretic activityidney medullaquaporinsasopressin V2 receptor

a b s t r a c t

Aim of the study: Zhuling, sclerotia of Polyporus umbellatus FRIES, a Traditional Chinese Medicine, haslong been used as a diuretic. The aim of the present study was to evaluate the diuretic effect on theurinary electrolyte concentration (Na+, K+, and Cl−) and regulation of the relative mRNA expression ofaquaporin-1 (AQP1), aquaporin-2 (AQP2), aquaporin-3 (AQP3) and vasopressin V2 receptor (V2R) post-oral administration of sclerotia of Polyporus umbellata aqueous extract in normal rats.Materials and methods: Aqueous extract of sclerotia of Polyporus umbellatus (50 mg/kg, 250 mg/kg,500 mg/kg) or the reference drug, furosemide (10 mg/kg) were administrated orally to male SD rats andtheir urine output was quantified and collected 24 h and 8 days after the treatment. The kidney medullaAQP1, AQP2, AQP3 and V2R mRNA relative expressions were measured with RT-PCR.Results: After single dose of the exact of sclerotia of Polyporus umbellata, urine output was found to besignificantly increased, which began at 4 h, and at 24 h after the treatment, the sclerotia of Polyporusumbellatus extract and furosemide treatment produced the similar total volume of urine excreted. Theextract increases urinary levels of Na+, K+, and Cl−, to about the same extent, while furosemide increasedurinary levels of Na+ and Cl−. After the 8-day doses, all two substances induced significant diuresis,natriuresis and chloriuresis. These two substances do not regulate the AQP1 and AQP3 mRNA level innormal rat kidney medulla. The AQP2 mRNA level of sclerotia of Polyporus umbellata extract was down-

regulated significantly, the V2R mRNA level of sclerotia of Polyporus umbellata extract 50 mg/kg dose groupand 250 mg/kg dose group were down-regulated significantly too. Interestingly, the low-dose group hadhigher effect on regulation of AQP2 and V2R mRNA level.Conclusion: Aqueous extract of sclerotia of Polyporus umbellatus has conspicuous diuretic effect confirmingits ethnopharmacological use. From the pattern of excretion of water, sodium, potassium, chlorine, AQP2and V2R mRNA level, it may be logically concluded that it has effect from down-regulating AQP2, anddown-regulate AQP2 by down-regulating V R.

. Introduction

Zhuling, sclerotia of Polyporus umbellatus FRIES, is a mushroomroducing a white rot in hardwoods. The sclerotia of Polyporusmbellata are bumpy and rugged in shape and dark brown tolack in color. It is used widely in Traditional Chinese Medicine,escribed has a relative diuretic effect in ancient work as Shen-ong’s Herbal Classics (Shen Nong Ben Cao Jing) used as a diuretic

n the Traditional Chinese Medicine (Yuan et al., 2004), used foridney and other related diseases, also described that it promotesrination and leaves out dampness, the problems caused by stag-ance of dampness such as edema, scanty urine, vaginal discharge,

∗ Corresponding author. Tel.: +86 20 39318678.E-mail address: zengxing-china@163.com (X. Zeng).

378-8741/$ – see front matter © 2010 Elsevier Ireland Ltd. All rights reserved.oi:10.1016/j.jep.2010.01.032

2

© 2010 Elsevier Ireland Ltd. All rights reserved.

cloudy painful urinary dysfunction, as well as jaundice and diar-rhea (Bensky et al., 2003). It was reported that the aqueous extractof the sclerotia of Polyporus umbellata had diuretic effects on ani-mals (Linwen et al., 1964). However, the diuretic mechanism ofsclerotia of Polyporus umbellata has not been investigated by scien-tifically controlled studies, especially we have not seen any reporton its effects on kidney medulla aquaporin expression of sclerotiaof Polyporus umbellate.

Water reabsorption in different regions of the kidney largelydepends on water channels consisted of several members of theaquaporin (AQP) family (Agre et al., 1998). Most reabsorption in the

proximal tubule occurs constitutively, with water movement beingfacilitated by AQP1 (Nielsen et al., 1993) and AQP1 plays an impor-tant role in the thin descending limb of the loop of Henle (Nielsenet al., 1993, 1995). The main site at which urine output, and hencebody water balance is regulated is the collecting duct, where AQP2,

4 ophar

Aoiattcciw

caro

2

2

fumtcsratcd

2

fPmtdola

2

ea

2

glb

ffilge

34 G. Zhang et al. / Journal of Ethn

QP3 are all involved (Terris et al., 1996). The water permeabilityf the collecting duct can change rapidly (within a few minutes)n response to vasopressin (VP, antidiuretic hormone, ADH). Thiscute response is mediated by V2R in the basolateral membrane ofhe cells, with cAMP acting as the second messenger, triggering theransfer of AQP2 water channels from stored in intracellular vesi-les to the apical plasma membrane of the collecting duct principalells. When vasopressin levels decline, AQP2 is retrieved endocyt-cally, causing the membrane returning to the resting state of low

ater permeability (Hasler et al., 2002).In this study, we report the changes of urinary electrolyte

oncentrations (Na+, K+, and Cl−), and aquaporin-1 (AQP1),quaporin-2 (AQP2), aquaporin-3 (AQP3) and vasopressin V2eceptor (V2R) mRNA relative expression post-oral administrationf sclerotia of Polyporus umbellata aqueous extract in normal rats.

. Materials and methods

.1. Experimental animals

Adult male SD rats weighing between 180 and 200 g, purchasedrom the Experimental Animal Center of Guangdong Medical, weresed in the experiments after 3 days of acclimatization. All experi-ental animals were handled following the Guiding Principles for

he Care and Use of Experimental Animals from Guangdong provin-ial TCM hospital, in accordance with the internationally acceptedtandard guidelines for use of animals, and the care and handling ofats was approved by our Institutional Committee on Animal Cares well. Our animals were housed under standard environmen-al conditions (23 ± 2 ◦C, 55 ± 5% humidity and 12 h/12 h light/darkycle). The animals were allowed free access to tap water and stan-ard laboratory rat food.

.2. Materials

The sclerotia of Polyporus umbellata aqueous extract, purchasedrom Tianjiang Pharmaceuticals Limited, China. The sclerotia ofolyporus umbellata was mixed with water 1:10 (g/ml), and theixture was boiled at 100 ◦C under reflux for 30 min. The decoc-

ion obtained was centrifuged, filtered, concentrated, then sprayedrying, yielding approximately 5% (w/w) of dry extract of sclerotiaf Polyporus umbellata. The product (sclerotia of Polyporus umbel-

ata) was dissolved in water (5 mg/ml, 25 mg/ml, 50 mg/ml) beforedministration at the stated doses.

.3. Reference drug

Furosemide, a high-ceiling loop diuretic, was used as the ref-rence drug (positive control). It was dissolved in water prior todministration.

.4. Biochemical methods

Urinary was collected with metabolic cage, obtained by centrifu-ation (600 × g at 4 ◦C), and stored at −20 ◦C until analyzed. Urinaryevels of ionized sodium, potassium and chlorine were measuredy flame spectrophotometry.

The animal kidneys were removed in toto, and the serosal sur-ace was dissected carefully. The left kidney of each rat was snaprozen in liquid nitrogen and kept at −80 ◦C for molecular stud-es. The right kidney was fixed in formalin. The medulla of theeft kidney was separated and immediately frozen in liquid nitro-en at −80 ◦C until measurement of AQP1, AQP2, AQP3, V2R mRNAxpression.

macology 128 (2010) 433–437

2.5. RNA isolation, cDNA synthesis and RT-PCR

Total RNA from the frozen tissue was isolated by Trizol (Invitro-gen, Carlsbad, CA), according to the manufacturer’s instructions. Invitro transcription-based RNA amplification was then performedon each sample. cDNA for each sample was synthesized using aTIANScript cDNA Synthesis Kit (TIANGEN). The PCR reactions werecarried out in 20 �l volumes using RealMasterMix (SYBR GreenI,TIANGEN). For the quantitative analysis of mRNA expression, weused the ABI 7500 Real-Time PCR System. Amplification conditionswere 35 cycles at 94 ◦C for 20 s, 60 ◦C for 20 s, and 68 ◦C for 33 s. PCRamplification was performed using the following primers:

AQP1 sense, ATTGCAGCGTCATGTCTGAG; antisense, GAAC-TAGGGGCATCCAAAC;AQP3 sense, ACTCCAGTGTGGAGGTGGAC; antisense, GCCCC-TAGTTGAGGATCACA;AQP2 sense, TTGCAGGAACCAGACACTTG; antisense, GCGGAGAC-GAGCACTTTTAC;V2R sense, TGTGGCTCTGTTTCA AGTGC; antisense, GCC AGGAT-CATGTAGGAGGA.

Primers were derived from published AQP sequences with Gen-Bank accession nos. NM 012778 (AQP1), D13906 (AQP2), D17695(AQP3), Z11932 (V2R). �-Actin specific primers were used for thepositive controls. The length of the amplification products wasAQP1 (100 bp), AQP2 (174 bp), AQP3 (147 bp), V2R (135 bp), and�-actin (150 bp).

2.6. Experimental design

Each animal was placed in an individual metabolic cage 24 hprior to commencement of the experiment for adaptation. The ani-mals were divided into five groups of six rats per group for the study(repeated dose) study. Rats were fasted overnight with free accessto water, and subjected to the stated treatment as described below.The rats were observed occasionally for apparent toxicity.

Before treatment, all animals received physiological saline (0.9%NaCl) at an oral dose of 5 mL/100 g body weight (BW), to impose auniform water and salt load (Benjumea et al., 2008).

The first group received orally physiological saline 10 ml/kg BW,and served as the control group. The second group was treatedwith an oral dose of 10 mg/kg BW of furosemide. The third, fourthand fifth group were administered orally 50 mg/kg, 250 mg/kg and500 mg/kg BW of sclerotia of Polyporus umbellata extract. Urinewas collected and measured at 1 h, 2 h, 4 h, 6 h, and 24 h aftersingle dose. Sodium, potassium and chlorine concentrations weredetermined in the 24 h urine samples from rats. Daily oral dosesof furosemide (10 mg/kg BW) and sclerotia of Polyporus umbellataextract (50 mg/kg, 250 mg/kg and 500 mg/kg BW) were adminis-tered to four groups of rats for 8-day; the control animals receivedphysiological saline (10 mL/kg) every day.

2.7. Statistical analysis

The results are expressed as means ± S.D. Statistical signifi-cance of differences was evaluated by one-way analysis of variancefollowed by Dunnett’s t-test (SPSS11.5). A value of P < 0.05 wasconsidered as statistically significant.

3. Results

3.1. Effect on urine volume

Treatment with a once daily dose of sclerotia of Polyporus umbel-lata extract increased diuresis, the group 50 mg/kg, 100 mg/kg of

G. Zhang et al. / Journal of Ethnophar

Fig. 1. The volume of excreted urine was measured at 1 h, 2 h, 4 h, 6 h and 24 h aftertgAt

ssidhhcosb

3

ptuNwopo

TE

V

TE

V

he treatment; cumulative values are reported as mean ± S.D. for six rats in eachroup. *P < 0.05; **P < 0.01; ***P < 0.001 compared to controls using Dunnett’s t-test.ll rats were pre-treated with an oral dose of 5 mL/100 g BW of normal saline prior

o the administration of the test substances.

clerotia of Polyporus umbellata extract produced significant diure-is at 1 and 4 h. All group produced significant diuresis at 6 h andncreasingly significant diuresis at 24 h (Fig. 1). The effect of onceaily dose of the reference diuretic, furosemide, was also rapid andigher than that of sclerotia of Polyporus umbellata extract (Fig. 1),owever, the 24 h cumulative urinary excretion was not signifi-antly different from the four substances (Fig. 1). Administrationf 8-day doses of sclerotia of Polyporus umbellata extract producedignificant diuresis (Table 2) and the diuresis effect was found toe similar to that of furosemide (Table 2).

.2. Effect on urinary electrolyte excretion

The effect of once daily dose of furosemide and sclerotia of Poly-orus umbellata extract on electrolyte (Na+, K+, and Cl−) excretion inhe 24 h urine is summarized in Table 1. Both sclerotia of Polyporusmbellata extract doses enhanced the excretion of the electrolytes

a+ (P < 0.001), K+ (P < 0.05 or P < 0.01) and Cl− (P < 0.05 or P < 0.01),hich were greater than produced by furosemide, especially that

f K+ (Table 1). Administration of 8-day doses of sclerotia of Poly-orus umbellata extract on electrolyte (Na+, K+, and Cl−) excretionn day 8 is presented in Table 2. Both sclerotia of Polyporus umbel-

able 1ffect of once oral dose of sclerotia of Polyporus umbellata (Zhuling) extract and furosemi

Treatmenta Dose (mg/kgBW) Urinary elect

Na+ (mmol/L

Control 87.98 ± 9.4Furosemide 10 120.15 ± 20.

Zhuling 50 125.15 ± 8.4250 121.33 ± 6.8500 136.40 ± 10.

alues are expressed as mean ± S.D. of six rats in each group. *P < 0.05; **P < 0.01; ***P < 0.a All rats were pre-treated with an oral dose of 5 mL/100 g BW of normal saline prior to

able 2ffect of 8-day oral dose of sclerotia of Polyporus umbellata (Zhuling) extract and furosem

Treatmenta Dose (mg/kg BW) Urine output (ml)

Control 22.50 ± 1.29Furosemide 10 28.50 ± 3.32**

Zhuling 50 24.75 ± 2.50250 24.75 ± 0.96*

500 28.67 ± 3.06**

alues are expressed as mean ± S.D. of six rats in each group. *P < 0.05; **P < 0.01; ***P < 0.a All rats were pre-treated with an oral dose of 5 mL/100 g BW of normal saline prior to

macology 128 (2010) 433–437 435

lata extract doses enhanced the excretion of the electrolytes Na+

(P < 0.05 or P < 0.01), K+ (P < 0.05 or P < 0.01) and Cl− (P < 0.05), whichwas greater than those produced by furosemide, especially for K+

(Table 2).

3.3. mRNA levels of AQP1, AQP3, AQP2 and V2R with RT-PCR

The AQP1 and AQP3 mRNA relative expression of 8-day dos-ing of furosemide and sclerotia of Polyporus umbellata extract innormal rats kidney medulla resulted no significant variation com-pared to controls (Table 3). The AQP2 mRNA relative expressionspost-furosemide and sclerotia of Polyporus umbellata extract treat-ment were found to be down-regulated compared to controls(P < 0.05 or P < 0.01) (Table 3). The V2R mRNA relative expres-sions of sclerotia of Polyporus umbellata extract 50 mg/kg dosegroup and 250 mg/kg dose group were down-regulated comparedto controls (P < 0.05) (Table 3). Interestingly, the AQP2 mRNAdown-regulation level in the low-dose group (sclerotia of Poly-porus umbellata extract 50 mg/kg) was at maximum, the high-dose(sclerotia of Polyporus umbellata extract 500 mg/kg) was at mini-mum in the experiment (Fig. 2). The V2R mRNA down-regulationlevel of middle-dose group (sclerotia of Polyporus umbellata extract250 mg/kg) was at maximum, high-dose (sclerotia of Polyporusumbellata extract 500 mg/kg) was at minimum in the experiment(Fig. 3).

4. Discussion

In this study, the diuretic effect of orally administered sclerotiaof Polyporus umbellata extract was evaluated on normal rats afteronce daily dose for 8-day. The pharmacological response was com-pared with that produced by furosemide, a widely used diuretic inclinical practice. The effect on electrolyte balance was determined.The mechanism of action by which diuresis was induced by sclero-tia of Polyporus umbellata extract was explored by comparing the

effect of that of furosemide, a high-ceiling loop diuretic (Jackson,1996). Diuresis has two elements, increase in urine volume (waterexcretion) and a net loss of solutes (i.e. electrolytes) in the urine(Jackson, 1996). The reference drug, furosemide, increases urineoutput and urinary excretion of sodium by inhibiting Na+/K+/2Cl−

de on 24 h urinary electrolyte excretion Na+, K+, and Cl− levels in normal rats.

rolyte concentration

) K+ (mmol/L) Cl− (mmol/L

2 79.78 ± 18.19 128.73 ± 25.1111* 92.12 ± 9.91 180.25 ± 34.68*

7*** 111.25 ± 25.72* 185.83 ± 17.57**

7*** 110.42 ± 19.96* 185.28 ± 30.55*

54*** 119.95 ± 12.16** 200.75 ± 28.45**

001 compared to controls using Dunnett’s t-test.the administration of the test substances.

ide on 24 h urinary electrolyte excretion of Na+, K+, and Cl− in normal rats.

Urinary electrolyte concentration

Na+ (mmol/L) K+ (mmol/L) Cl− (mmol/L)

90.98 ± 5.66 81.14 ± 16.76 124.48 ± 40.78111.08 ± 4.36*** 92.79 ± 6.94 164.78 ± 6.75*

125.75 ± 13.96** 111.25 ± 25.72* 184.65 ± 21.91*

111.30 ± 14.64* 101.93 ± 5.74* 172.05 ± 13.40*

134.75 ± 33.54* 132.02 ± 23.54** 219.68 ± 54.92*

001 compared to controls using Dunnett’s t-test.the administration of the test substances.

436 G. Zhang et al. / Journal of Ethnopharmacology 128 (2010) 433–437

Table 3Quantification of AQP1, AQP3, AQP2 and V2R expression by RT-PCR assay in each group.

Treatment Dose (mg/kg BW) Relative gene expression

AQP1 AQP3 AQP2 V2R

Control 1 (0.7–1.4) 1 (0.7–1.5) 1 (0.6–1.6) 1 (0.4–2.3)Furosemide 10 0.4 (0.2–0.6) 0.6 (0.4–0.7) 0.6 (0.3–0.9) 0.3 (0.2–0.5)*

Zhuling 50 0.9 (0.7–1.2) 0.7 (0.4–1.0) 0.4 (0.2–0.5)** 0.4 (0.3–0.6)*

250 0.9 (0.5–1.7) 0.6 (0.5–0.7) 0.5 (0.4–0.5)* 04 (0.2–0.6)*

A . Statisg esent

st

ui5nbSfood

iwIriiTaftws

P(21ppo

Fy*A

250 mg/kg) was at maximum, while the high-dose (sclerotia of

500 0.8 (0.4–1.5)

QP1, AQP3, AQP2 and V2R relative expression level in normal rat kidney medullaroup. *P < 0.05; **P < 0.01; compared to controls using Dunnett’s t-test. Values repr

ymporter (co-transporter system) in the thick ascending limb ofhe Loop of Henle.

In the saline primed rats, once daily dose of sclerotia of Polyporusmbellata extract 50 mg/kg and 250 mg/kg caused a significant

ncrease in urine output beginning from 4 h while for the dose of00 mg/kg, it took 6 h after the dose to increase urine output sig-ificantly. In comparison, once daily dose of furosemide induced arisk and significant diuresis within 1 h of administration (Fig. 1).timulation of diuresis by once daily dose of any one of the drug wasound to be continued for at least 24 h (Fig. 1). In the 8-day dosesf sclerotia of Polyporus umbellata extract study, both P sclerotiaf Polyporus umbellata extract and furosemide induced significantiuresis on day 8 (Table 2).

Once daily dose of sclerotia of Polyporus umbellata extractnduced significant increases in urinary excretion of Na+, K+, and Cl−

hile furosemide only increased Na+ and Cl− excretion (Table 1).n the 8-day doses of sclerotia of Polyporus umbellata extract study,epeat administration of all substances caused significant increasen natriuresis, kaliuresis and chloriuresis (Table 2). In the exper-ment, furosemide failed to produce its normal kaluretic effect.hough they did not have a significant increase, we still could seen increasing tendency with the results (Tables 1 and 2). The reasonor lacking of statistical significance in the study may be attributedo the small animal sample size. In this study, no apparent toxicityas observed in the rats during the 8-day of repeated dosing with

clerotia of Polyporus umbellata extract.A number of compounds have been identified in sclerotia of

olyporus umbellatus FRIES, including Polyporus polysaccharideYan, 1988), ergosterol (Yazawa et al., 2000), ergone (Yuan et al.,003, 2004), polyporusterone A, B, C, D, E, F, G (Ohsawa et al.,

992), acetosyringone (Ishida et al., 1999). These compounds in theast have been shown to have various biological effects. For exam-le, more than 20 years ago, alkali-soluble polysaccharide obtainedn sclerotia of Polyporus umbellata was found to have antitumor

ig. 2. AQP2 relative expression level in normal rat kidney medulla. Statistical anal-ses of RT-PCR data were performed using �Ct values of six rats in each group.P < 0.05; **P < 0.01; compared to controls using Dunnett’s t-test. Values representQP1, AQP2 and AQP3 mRNA quantitated with 2−��CT method.

0.6 (0.5–0.8) 0.5 (0.3–0.7)* 0.5 (0.3–0.7)

tical analyses of RT-PCR data were performed using �Ct values of six rats in eachAQP1, AQP2 and AQP3 mRNA quantitated with 2−��CT method.

activity against Sarcoma 180 (Ueno et al., 1982). In addition, it wasreported that the combined administration of sclerotia of Polyporusumbellata and mitomycin C increased the life span of tumor-bearing(Sarcoma 180-induced liver tumor) mice by inhibiting the syntheticrates of DNA, RNA and protein in tumor cells (You et al., 1994).According to Yuan et al., ergone may be used as a marker com-ponent for the chemical standardization of Polyporus umbellatusFRIES. It was reported that ergone has an anti-aldosteronic diureticeffect (Yuan et al., 2004). Moreover, ergosterol isolated from sclero-tia of Polyporus umbellata reportedly provides significant protectionagainst bladder tumor in rats (Yazawa et al., 2000). Other biologicalactivities such as antiviral, antiinflammatory, and antitumor activ-ities of ergosterol peroxide have also been investigated (Bok et al.,1999).

In the present study, the AQP1 and AQP3 mRNA level of 8-daydoses of furosemide and sclerotia of Polyporus umbellata extractin normal rats kidney medulla showed no significant variation(Table 3). That may imply these substances do not regulate theAQP1 and AQP3 mRNA level in normal rat kidney medulla. How-ever, the AQP2 mRNA level of sclerotia of Polyporus umbellataextract was down-regulated significantly (Table 3). The V2R mRNAlevel of sclerotia of Polyporus umbellata extract 50 mg/kg dose groupand 250 mg/kg dose group were down-regulated significantly aswell (Table 3). Interestingly, the AQP2 mRNA down-regulation levelof the low-dose group (sclerotia of Polyporus umbellata extract50 mg/kg) was at maximum, while the high-dose (sclerotia ofPolyporus umbellata extract 500 mg/kg) was at minimum in theexperiment (Fig. 2). The V2R mRNA down-regulation level ofthe middle-dose group (sclerotia of Polyporus umbellata extract

Polyporus umbellata extract 500 mg/kg) was at minimum in theexperiment (Fig. 3). These results show that sclerotia of Polyporusumbellata extract could down-regulate the AQP2 and V2R mRNA

Fig. 3. V2R relative expression level in normal rat kidney medulla. Statistical anal-yses of RT-PCR data were performed using �Ct values of six rats in each group.*P < 0.05; compared to controls using Dunnett’s t-test. Values represent AQP1, AQP2and AQP3 mRNA quantitated with 2−��CT method.

G. Zhang et al. / Journal of Ethnophar

FA

ldmwssl(

tanociuii

A

d

R

A

Yuan, D., Yamamoto, K., Bi, K., Zhang, P., Liu, F., Kano, Y., 2003. Studies on the marker

ig. 4. AQP1, AQP3, AQP2 and V2R RT-PCR products of expected sizes AQP1 (100 bp),QP3 (147 bp), AQP2 (174 bp), V2R (135 bp), and �-actin (150 bp).

evel, but higher of sclerotia of Polyporus umbellata did not furtherecrease their regulation. Yet, furosemide down-regulated the V2RRNA level. Contrarily, furosemide’s effect on AQP2 mRNA levelas not significant different from the controls (Table 3). That may

uggest sclerotia of Polyporus umbellata extract carries out its diure-is effect by regulating AQP2, and the down-regulate of AQP2 mRNAevel may be resulted from the down-regulating of V2R mRNA levelFig. 4).

In conclusion, the present studies provided strong evidences forhe use of sclerotia of Polyporus umbellata extract for its diureticpplication in Traditional Chinese Medicine. Although, the compo-ents diuretic effect have not been identified, based on the patternf its effects on the excretion of water, sodium, potassium andhlorine, it appears the extract has the loop diuretics-like activ-ty. With these findings, we conclude that sclerotia of Polyporusmbellata aqueous extract carries out its diuretic effect by regulat-

ng AQP2, and the down-regulation of AQP2 may be resulted fromts down-regulation of V2R.

cknowledgement

This work was supported by the National Natural Science Foun-ation of China (no. 30873426).

eferences

gre, P., Bonhivers, M., Borgnia, M.J., 1998. The aquaporins, blueprints for cellularplumbing systems. Journal of Biological Chemistry 273, 14659–14662.

macology 128 (2010) 433–437 437

Benjumea, D., Abdala, S., Hernandez-Luis, F., Pı̌erez-Paz, P., Martin-Herrera, D., 2008.Diuretic activity of Artemisia thuscula, an endemic canary species. Journal ofEthnopharmacology 100, 205–209.

Bensky, D., Gamble, A., Kaptchuk, T., 2003. Chinese Herbal Medicine Materia Medica,Revised edition. Eastland Press, Seattle.

Bok, J.W., Lermer, L., Chilton, J., Klingeman, H.G., Towers, G.H., 1999. Antitumorsterols from the mycelia of Cordyceps sinensis. Phytochemistry 51, 891–898.

Hasler, U., Mordasini, D., Bens, M., Bianchi, M., Cluzeaud, F., Rousselot, M., Vande-walle, A., Feraille, E., Martin, P.Y., 2002. Long term regulation of aquaporin-2expression in vasopressin-responsive renal collecting duct principal cells. Jour-nal of Biological Chemistry 22, 10379–10386 (review).

Ishida, H., Inaoka, Y., Shibatani, J., Fukushima, M., Tsuji, K., 1999. Studies of the activesubstances in herbs used for hair treatment. II. Isolation of hair regrowth sub-stances, acetosyringone and polyporusterone A and B, from Polyporus umbellatusFries. Biological and Pharmaceutical Bulletin 22, 1189–1192.

Jackson, E.K., 1996. Drugs affecting renal and cardiovascular function. In: Hardman,J.C., Gilman, A.G., Limbird, L.E. (Eds.), Goodman and Gilman’s the Phar-macological Basis of Therapeutics, 9th edition. Pergamon Press, New York,pp. 685–713.

Linwen, Wang, Chengye, Su, Guoxiong, Liu, Yi, Zhang, 1964. A preliminary report onthe diuretic action of Grifola umbellata. Yao Xue Xue Bao 11, 816–818.

Nielsen, S, Smith, B.L., Christensen, E.I., Knepper, M.A., Agre, P., 1993. CHIP28water channels are localized in constitutively water-permeable segments of thenephron. Journal of Cell Biology 120, 371–383.

Nielsen, S., Pallone, T., Smith, B.L., Christensen, E.I., Maunsbach, P., 1995. Aquaporin-1 water channels in short and long loop descending thin limbs and in descendingvasarecta in rat kidney. American Journal of Physiology 268, F1023–F1037.

Ohsawa, T., Yukawa, M., Takao, C., Murayama, M., Bando, H., 1992. Studies onconstituents of fruit body of Polyporus umbellatus and their cytotoxic activity.Chemical and Pharmaceutical Bulletin 40, 143–147.

Terris, J., Ecelbarger, C.A., Nielsen, S., Knepper, M.A., 1996. Long-term regula-tion of four renal aquaporins in rats. American Journal of Physiology 271,414–422.

Ueno, Y., Okamoto, Y., Yamauchi, R., Kato, K., 1982. An antitumor activity of thealkali-soluble polysaccharide (and its derivatives) obtained from the sclerotiaof Grifora umbellata (Fr.) Pilát. Carbohydrate Research 101, 160–167.

Yan, S.C., 1988. Clinical and experimental research on Polyporus umbellatus polysac-charide in the treatment of chronic viral hepatitis. Zhong Xi Yi Jie He Za Zhi 131,141–143.

Yazawa, Y., Yokota, M., Sugiyama, K., 2000. These findings in the literature point tothe potential usefulness of Zhuling. Chemical and Pharmaceutical Bulletin 23,1298–1302.

You, J.S., Hau, D.M., Chen, K.T., Huang, H.F., 1994. Combined effects of chuling(Polyporus umbellatus) extract and mitomycin C on experimental liver cancer.American Journal of Chinese Medicine 22, 19–28.

compounds for standardization of traditional Chinese Medicine “Polyporus scle-rotium”. Yakugaku Zazhi 123, 53–62.

Yuan, D., Mori, J., Komastu, K.I., Makino, T., Kano, T., Kano, Y., 2004. An anti-aldosteronic diuretic compent (drain dampness) in Polyporus sclerotium.Biological Pharmaceutical Bulletin 27, 867–870.