REGULAR ARTICLE

Diverse Mesorhizobium spp. with unique nodA nodulatingthe South African legume species of the genus Lessertia

Macarena Gerding & Graham William O’Hara &

Lambert Bräu & Kemanthie Nandasena &

John Gregory Howieson

Received: 26 October 2011 /Accepted: 26 January 2012 /Published online: 7 March 2012# Springer Science+Business Media B.V. 2012

AbstractBackground and aims Legumes of the genus Lessertiahave recently been introduced to Australia in an attemptto increase the range of forage species available inAustralian farming systems capable of dealing with achanging climate. This study assessed the diversity andthe nodulation ability of a collection of Lessertia rootnodule bacteria isolated from different agro-climaticareas of the Eastern and Western Capes of South Africa.Methods The diversity and phylogeny of 43 strains wasdetermined via the partial sequencing of the dnaK,16srRNA and nodA genes. A glasshouse experimentwas undertaken to evaluate symbiotic relationships be-tween six Lessertia species and 17 rhizobia strains.Results The dnaK and 16S rRNA genes of the majorityof the strains clustered with the genus Mesorhizobium.The position of the strains at the intra-genus level wasincongruent between phylogenies with few exceptions.

The nodA genes from Lessertia spp. formed a cluster ontheir own, separate from the previously known Meso-rhizobium nodA sequences. Strains showed differencesin their nodulation and nitrogen fixation patterns thatcould be correlated with nodA gene phylogeny. L. dif-fusa, L. herbacea and L. excisa nodulated with nearly allthe strains examined while L. capitata, L. incana and L.pauciflora were more stringent.Conclusion Root nodule bacteria from Lessertiaspp. were identified mainly as Mesorhizobium spp.Their nodA genes were unique and correlated withthe nodulation and nitrogen fixation patterns of thestrains. There were marked differences in promis-cuity within Lessertia spp. and within strains of rootnodule bacteria.

Keywords Mesorhizobium . Lessertia capitata .

Lessertia excisa . Lessertia diffusa . Lessertiaherbacea . Lessertia incana . Lessertia pauciflora .

Symbiotic nitrogen fixation

AbbreviationsWSM Western soil microbiologyOD Optical density½ LA Half lupin agar

Introduction

The legume genus Lessertia DC comprises more than50 species, that include prostrate to decumbent herbs,

Plant Soil (2012) 358:385–401DOI 10.1007/s11104-012-1153-3

Responsible Editor: Euan K. James.

M. Gerding (*)Facultad de Agronomía, Universidad de Concepción,Chillán, Chilee-mail: mgerding@udec.cl

G. W. O’Hara :K. Nandasena : J. G. HowiesonCentre for Rhizobium Studies, Murdoch University,Perth, Western Australia, Australia

L. BräuDeakin University,School of Life and Environmental Sciences,Burwood, Australia

sub-shrubs (Allen and Allen 1981; Harvey 1862; Lockand Schrire 2005) and erect shrubs up to 1.5 m tall(Balkwill and Balkwill 1999). Lessertia capitata, L.diffusa, L. excisa, L. herbacea, L. incana and L. pau-ciflora are perennial species (Balkwill and Balkwill1999; Nkonki 2003) that are part of natural rangelandpastures in the Western and Northern Cape of SouthAfrica. These species have been reported to be palat-able for grazing ruminants, and have shown toleranceto grazing (Anderson and Hoffmann 2007; Breebaart2003; Howieson et al. 2008; Nkonki 2004). Lessertiaspecies have recently been introduced into WesternAustralia (Howieson et al. 2008) to increase the diver-sity of perennial legumes in farming systems, with aview to overcoming climatic and agricultural systemschanges (Cocks 2001; Cransberg and McFarlane 1994;Dear et al. 2003). The renewed interest in these speciesarose from their ability to grow in areas of acid andinfertile soils (Anderson and Hoffmann 2007; Nkonki2003), their prolific seed production and their deep rootsystems relative to annual legumes (Howieson et al.2008).

The rhizobia associated with Lessertia spp. havenot been studied in detail. So far, the only reports ofLessertia microsymbionts have been those of de Fariaet al. (1989) and Allen and Allen (1981) who reportedthe presence of nodules in Lessertia spp. in situ, andthat of the ICMP database (International Collection ofMicro-organisms from Plants, Landcare Research,Auckland, New Zealand) which includes Lessertia asone of the genera able to nodulate with one of theMesorhizobium sp. strains listed. To enable an agro-nomic assessment of the Lessertia requires a moredetailed understanding of the nodule bacteria for thisgenus, including their genetic diversity, their host rela-tionships and their adaptation to different soil types inthe target zones of Western Australia.

The phylogenetic relationships and genetic diversi-ty within different bacterial strains can be assessedthrough several molecular and phenotypic methods.Traditionally in the molecular era, phylogenetic relat-edness in the order Rhizobiales has been estimatedthrough 16S rRNA sequence comparison (Brenner etal. 2005; Jaspers and Overmann 2004; Laguerre et al.1997; McArthur 2006; Olsen et al. 1994). Neverthe-less, the use of alternative genes as phylogeneticmarkers, particularly protein encoding genes, is be-coming a common approach (Chelo et al. 2007; Gauntet al. 2001; Konstantinidis and Tiedje 2005; Zeigler

2003). The variable 3’ end fragment of the proteincoding gene dnaK has a strong phylogenetic signaland is congruent with other housekeeping genes(Martens et al. 2007; Stępkowski et al. 2003a). Fur-thermore, the dnaK sequences provide a higher levelof sequence divergence than 16S rRNA and havetherefore proven to be useful to distinguish closelyrelated bacteria (Chelo et al. 2007; Martens et al.2007).

Rhizobia nodulation genes are responsible for thesynthesis of Nod-factors, which are produced in re-sponse to root exudates and are determinant in initialroot hair infection (Kobayashi and Broughton 2008;Maunoury et al. 2008). Of these, the common nodu-lation gene nodA is one of the most frequently se-quenced and studied, because it plays a critical rolein determining the structure of the Nod-factor andtherefore in determining host specificity (Broughtonand Perret 1999; Kobayashi and Broughton 2008;Roche et al. 1996). The characterisation and phyloge-netic classification of symbiotic genes have become animportant basis for the understanding of the Rhizobi-um-legume symbiosis (Laguerre et al. 2001). As aprelude to developing inoculant strains, this workreports on the symbiotic gene diversity and phyloge-netic relationships among 43 strains of root nodulebacteria from Lessertia spp nodules collected in SouthAfrica. Given the importance of understanding therelationship between legumes and their symbionts be-fore their establishment in the field, this work alsoreports on the symbiotic interactions between six spe-cies of Lessertia (L. capitata, L. diffusa, L. excisa, L.herbacea, L. incana and L. pauciflora) and their rhi-zobia, particularly with respect to nitrogen fixingbacteria.

Materials and methods

Bacterial strains and cultural conditions

The 43 strains, originally from root nodules of Lesser-tia spp. collected in South Africa (Table 1), wereobtained from the Western Australian Soil Microbiol-ogy (WSM) culture collection. Bacterial cultures weregrown on half lupin-agar (½ LA) plates (Howieson etal. 1988) for 5 to 10 days at 28°C.

The template for PCR reactions was prepared usingwhole cells that were suspended and washed in sterile

386 Plant Soil (2012) 358:385–401

Table 1 Origin of root nodule bacteria used in this study

Strain Host plant Geographic origin Lat Long Source (year isolated)

WSM2211 Lessertia frutescens Graaf Reinet, Eastern Cape NK Yates and Real (2002)

WSM2559 Lessertia microphylla Klawer, Western Cape SK 31°41′512″S 18°41′640″E Yates and Real (2002)

WSM2561 Lessertia diffusa Nieuwoudtville, Northern Cape SK 31°25′684″S 19°10′616″E Yates and Real (2002)

WSM2566 Lessertia pauciflora Rooiberg pass, Western Cape SK 32°29′997″S 21°37′158″E Yates and Real (2002)

WSM2607 Lessertia microphylla Beaufort West, Western Cape NK 32°10′394″S 22°32′598″E Yates and Real (2002)

WSM2622 Lessertia microphylla Beaufort West, Western Cape NK 32°10′394″S 22°32′598″E Yates and Real (2002)

WSM2623 Lessertia annularis Beaufort West, Western Cape NK 32°21′109″S 22°36′127″ Yates and Real (2002)

WSM2628 Lessertia diffusa Nieuwoudtville, Northern Cape SK 31°25′684″S 19°10′616″E Yates and Real (2002)

WSM2808 Lessertia frutescens Eastern Cape NK Yates and Real (2002)

WSM3059 Lessertia annularis Beaufort West, Western Cape NK 32°21′109″S 22°36′127″ Law (2003)

WSM3270 Lessertia annularis Middelburg, Eastern Cape NK Law (2004)

WSM3310 Lessertia frutescens Stellenbosch, Western Cape F Law (2003)

WSM3472 Lessertia excisa Lamberts Bay, Western Cape F 32°03′ 562″S 18°18′ 965″E Howieson et al. (2004)

WSM3492 Lessertia diffusa Garies, Northern Cape SK 30°32′419″ S 17°57′031″E Howieson et al. (2004)

WSM3493 Lessertia diffusa Springbok, Northern Cape SK 29°39′473″S 17°54′309″E Howieson et al. (2004)

WSM3495 Lessertia capitata Komkans, Western Cape SK 31°13′359″S 18°03′ 07″E Howieson et al. (2004)

WSM3502 Lessertia diffusa Northern Cape SK 29°39′473″S 17°54′309″E Howieson et al. (2004)

WSM3503 Lessertia diffusa Springbok, Northern Cape SK 29°34′506″S 18°01′611″ Howieson et al. (2004)

WSM3507 Lessertia capitata Komkans, Western Cape SK 31°13′359″S 18°03′ 07″E Howieson et al. (2004)

WSM3513 Lessertia diffusa Springbok, Northern Cape SK 29°39′473″S 17°54′309″E Howieson et al. (2004)

WSM3564 Lessertia diffusa Grotto Bay, Western Cape F 33°29′21″S 18°19′36″E Howieson et al. (2004)

WSM3565 Lessertia diffusa Grotto Bay, Western Cape F 33°29′21″S 18°19′36″E Howieson et al. (2004)

WSM3592 Lessertia herbacea Citrusdal, Western Cape F 32°43′92″S 19°02′42″E Howieson et al. (2004)

WSM3596 Lessertia herbacea Citrusdal, Western Cape F 32°43′92″S 19°02′42″E Howieson et al. (2004)

WSM3598 Lessertia herbacea Citrusdal, Western Cape F 32°43′92″S 19°02′42″E Howieson et al. (2004)

WSM3602 Lessertia herbacea Middelberg pass, Western Cape F 32°38′99″S 19°11′937″E Howieson et al. (2004)

WSM3606 Lessertia herbacea Marcuskraal, Western Cape F 32°25′43″S 18°57′ 60″E Howieson et al. (2004)

WSM3612 Lessertia excisa Lamberts Bay, Western Cape F 32°03′ 562″S 18°18′ 965″E Howieson et al. (2004)

WSM3620 Lessertia diffusa Garies, Northern Cape SK 30°32′419″ S 17°57′031″E Howieson et al. (2004)

WSM3626 Lessertia diffusa Kamieskroon, Northern Cape SK 30°11′261″S 17°59′350″E Howieson et al. (2004)

WSM3636 Lessertia capitata Komkans, Western Cape SK 31°13′359″S 18°03′ 07″E Howieson et al. (2004)

WSM3803 Lessertia herbacea Citrusdal, Western Cape F 32°43′92″S 19°02′42″E Law (2004)

WSM3804 Lessertia herbacea Citrusdal, Western Cape F 32°43′92″S 19°02′42″E Law (2004)

WSM3805 Lessertia herbacea Citrusdal, Western Cape F 32°43′92″S 19°02′42″E Law (2004)

WSM3806 Lessertia herbacea Citrusdal, Western Cape F 32°43′92″S 19°02′42″E Law (2004)

WSM3891 Lessertia excisa Lamberts Bay, Western Cape F 32°03′ 562″S 18°18′ 965″E Howieson et al. (2004)

WSM3893 Lessertia excisa Lamberts Bay, Western Cape F 32°03′ 562″S 18°18′ 965″E Howieson et al. (2004)

WSM3894 Lessertia excisa Lamberts Bay, Western Cape F 32°03′ 562″S 18°18′ 965″E Howieson et al. (2004)

WSM3898 Lessertia excisa Lamberts Bay, Western Cape F 32°03′ 562″S 18°18′ 965″E Howieson et al. (2004)

WSM3900 Lessertia excisa Lamberts Bay, Western Cape F 32°03′ 562″S 18°18′ 965″E Howieson et al. (2004)

WSM3917 Lessertia diffusa Springbok, Northern Cape SK 29°34′506″S 18°01′611″ Howieson et al. (2004)

WSM3919 Lessertia incana Springbok, Northern Cape SK 29°34′506″S 18°01′611″ Howieson et al. (2004)

WSM3920 Lessertia incana Springbok, Northern Cape SK 29°34′506″S 18°01′611″ Howieson et al. (2004)

BIOMES: F: Fynbos, NK: Nama Karoo, SK: Succulent Karoo

Plant Soil (2012) 358:385–401 387

saline solution (0.89%w/v NaCl) and standardized toan optical density (OD) of 2.0 at 600 nm wavelength.

Phylogeny of dnaK, 16rRNA and nodA genes

To investigate phylogenetic relationships among the43 Lessertia rhizobial strains, the variable 3’ end frag-ment of the protein encoding gene dnaK (330 bp) wasamplified using the primers TSdnak2 and TSdnak3(Table 2) (Stępkowski et al. 2003a). The cyclingparameters were: 7 min at 95°C followed by 35 cyclesof 94°C for 30 s, 62°C for 30 s and 72°C for 45 s and afinal hold at 72°C for 5 min. The 16s rRNA gene wassequenced for a subset of 17 strains chosen from eachof the clusters of the phylogenetic tree developed withdnaK and including strains isolated from six Lessertiaspp. The primers 20F and 1540R (Table 2) were initiallyused to amplify a 1,500 bp internal region of the 16SrRNA and this was followed by sequencing with theother 16S rRNA primers listed in Table 2. The cyclingparameters were: 5 min at 95°C followed by 30 cyclesof 94°C for 30 s, 55°C for 30 s and 30°C for 45 s and afinal hold at 72°C for 7 min. The annealing temperaturewas adjusted for some strains as follows: WSM2559and WSM3270 reduced to 54.5°C; WSM3602 reducedto 53.5°C; WSM2622 and WSM2623 increased to56.5°C; WSM3598 and WSM3626 increased to 58°C.

The symbiotic phylogeny of the 43 strains wasdetermined through the sequencing of the 600 bp par-tial nodA gene. The primers used in this study werenodA1 and nodA2 (Table 2). The cycling conditions

were: 5 min at 94°C followed by 5 cycles of 94°C for30 s, 52°C for 30 s and 72°C for 1 min; 30 cycles of94°C for 30s, 55°C for 30s and 72°C for 1 min; and afinal hold at 72°C for 5 min. The annealing tempera-ture was reduced to 52°C for the strain WSM3310.The amplification of the gene sequences (330 bpdnaK, 1,500 bp 16SrRNA and 600 bp nodA) wasverified by agarose gel electrophoresis in 1.5% (w/v)agarose gels pre-stained with 1:10,000 SYBR ® SafeDNA gel stain (Invitrogen). The marker used was 1KbDNA ladder (Promega G5711). Electrophoresis wascarried out in tanks buffered with 1×TAE (40 mMTris-Acetate, 1 mM EDTA, pH 8.0) at 100 V for 3 h.

The PCR products were column-purified using theQia-quick purification kit (QIAGEN) as recommen-ded by the manufacturer, with a final elution in 50 μlof buffer EB (10 mM Tris-Cl, pH 8.5). In a 96 wellplate, purified PCR products were sequenced in bothdirections with the primers nodA1 and nodA2 (Table 2).The Sequencing PCR products were ethanol/EDTA/So-dium acetate precipitated in a 96well plate following theprotocol recommended by Applied Biosystems 3730DNA Analyzers sequencing chemistry guide. TheDNA sequence chromatograms were obtained using anautomated ABI Prism ® 377 DNA sequencer (AppliedBiosystems).

Phylogenetic analysis

The chromatograms were analysed and edited in theGene Tool Lite 1.0 (2000) software (Doubletwist, Inc.,

Table 2 Sequences of primers used in this work

Name Target gene Sequence (5’→3’) Source

20F 16S rRNA AGTTTGATCCTGGCTCAa Yanagi and Yamasato 1993

420F 16S rRNA GATGAAGGCCTTAGGGTTGT Yanagi and Yamasato 1993

800F 16S rRNA GTAGTCCACGCCGTAAACGA Yanagi and Yamasato 1993

1540R 16S rRNA AAGGAGGTGATCCAGCCGCA Yanagi and Yamasato 1993

1190R 16S rRNA GACGTCATCCCCACCTTCCT Yanagi and Yamasato 1993

820R 16S rRNA CATCGTTTACGGCGTGGACT Yanagi and Yamasato 1993

520R 16S rRNA GCGGCTGCTGGCACGAAGTT Yanagi and Yamasato 1993

TSdnak2 dnaK GTACATGGCCTCGCCGAGCTTCA Stępkowski et al. 2003aTSdnak3 dnak AAGGAGCAGCAGATCCGCATCCA Stępkowski et al. 2003anodA1 nodA TGCRGTGGAARNTRNNCTGGGAAA Haukka et al. 1998

nodA2 nodA GGNCCGTCRTCRAAWGTCARGTA Haukka et al. 1998

a Symbols: A, C, G, T–standard nucleotides; R: A, G; W: A, T; N: all

388 Plant Soil (2012) 358:385–401

Oakland, CA, USA). Sequences alignments and phylo-genetic analyses were conducted in MEGA4 (Tamura etal. 2007). The alignments were made by ClustalX andwere edited manually. The phylogenetic tree was in-ferred by the Neighbor-Joining method (Saitou andNei 1987) with a bootstrap analysis based on 1,000replicates to evaluate the confidence of the nodes. Thegenetic distances were computed using the MaximumComposite Likelihood method (Tamura et al. 2004).The BLAST search tool from the National Centre forBiotechnological Information (NCBI) was used to findspecies closely related to Lessertia spp. strains and todownload type strain’s genetic sequences to be includedin the phylogenetic trees.

Nodulation specificity and symbiotic effectiveness

A subset of 17 Lessertia strains (WSM2559, 2561,2566, 2622, 2623, 3270, 3310, 3495, 3565, 3598,3602, 3612, 3626, 3636, 3804, 3898 and 3919) select-ed from different dnaK and nodA phylogenetic clus-ters, were examined for their nodulating and nitrogenfixing abilities with six Lessertia species: L. capitata, L.diffusa, L.excisa, L. herbacea, L. incana and L. pauci-flora. The experiment was designed as a split-pot systemwith one rhizobial strain per pot as a main treatment, twoLessertia spp. per pot as sub-treatments and three repli-cates per treatment. Two sets of uninoculated controls,with added nitrogen (N+) and nitrogen free (N−), wereincluded for all species.

Experimental preparation, planting and inoculation

Seeds of the six Lessertia species were scarified, steril-ized and germinated in 1.5% (w/v) water agar plates.Following radicle emergence, the seedlings were plantedin 500 ml free-draining plastic pots filled with a steamedsand mix consisting of 2 parts of river sand and 3 parts ofleached yellow sand [modified from Howieson et al.(1995)]. The substrate was flushed with boiling sterileDI water to remove inorganic N before sowing.

The bacterial cultures were grown on ½ LA platesfor 5 to 10 days at 28°C. Inoculation was performed3 days after planting with 1 ml of bacterial suspensionaseptically washed from fresh colonies and suspendedin 1% (w/v) sucrose solution to an OD600nm of 1.0.

The pots were initially covered with plastic film toavoid contamination with air-borne rhizobia. Once theplants emerged and were 2 cm in height, the plastic

film was removed and the exposed soil covered withsterile alkathene beads. A sterile Polyvinyl chloride(PVC) watering tube with cap was pushed in thecentre of each pot to a depth of 5 cm for supply ofwater and nutrient solution.

The plants were grown in a naturally-lit, temperaturecontrolled phytotron under axenic conditions for 8weeks.The pots were arranged on the bench in a completelyrandomized design. Plants were supplied weekly with anutrient solution devoid of nitrogen [0.31 gL−1

MgSO4.7H2O; 0.21 gL−1 KH2PO4; 0.44 gL−1 K2SO4;0.06 gL−1 FeEDTA; 0.05 gL−1 CaSO4; 0.116 mgL−1

H3BO3 0.116; 0.0045 mgL−1 Na2MoO4.2H2O;0.134 mgL−1 ZnSO4.7H2O; 0.01 mgL−1 MnSO4,4H2Oand 0.06 mgL−1 CoSO4.7H2O (Howieson 1995)] at arate of 20 ml per pot. The nitrogen fed controls wereadditionally supplied with 10ml of 0.1MKNO3 solutionon a weekly basis. All plants were watered every 2 dayswith 20 ml of sterile DI water.

Evaluations and statistical analysis

At harvest plants were carefully removed from thepots and the roots were washed under running tapwater. The colour and general appearance of theplant was recorded as well as the number, morphol-ogy and distribution of the nodules. Shoot tops weredried at 60°C for 48 h and weighed. Two noduleswere collected from each of the replicates and thebacteria were re-isolated to verify strain identitythrough RPO1-PCR fingerprinting (Richardson etal. 1995).

Dry weight data were analysed and presented aspercentage of the nitrogen fed control. The analysis ofvariance of the yields of each of the plant hosts acrossthe different inoculants was carried out with the sta-tistics programme SPSS 13.0 for Windows (2004).The mean separation test used was the Fisher’s leastsignificant difference (LSD) test with α00.05.

Strains were classified into three groups based onthe average plant yield across replicates; effective0>75% of + N control (E), partially effective0 >20%but <75% of + N control (PE) and ineffective 0 <20%of + N control (I) (Yates 2008). This classification wasmodified for L. herbacea increasing the limit betweenPE and I strains from 20% to 40%, due to the high dryweight of the uninoculated plants caused by a largerseed size.

Plant Soil (2012) 358:385–401 389

Nucleotide sequence accession numbers

The Genbank accession numbers for the dnaK partialsequences of strains WSM2211, 2559, 2561, 2566,2607, 2622, 2623, 2628, 3270, 3310, 3495, 3502,3564, 3565, 3596, 3598, 3612, 3620, 3626, 3636,3804, 2808, 3059, 3472, 3492, 3493, 3503, 3507,3513, 3592, 3606, 3803, 3805, 3806, 3891, 3893,3894, 3898, 3900, 3917, 3919 and 3920, areJN375762–JN375803 respectively. Accession numb-ers for 16S rRNA gene sequences of strainsWSM2559, 2561, 2566, 2622, 2623, 3270, 3310,3495, 3565, 3598, 3612, 3626, 3636, 3804, 3898,3919 and 3602, are JN544900–JN544916 respective-ly. Accession numbers for nodA partial sequences ofstrains WSM2559, 2561, 2566, 2607, 2622, 3270,3310, 3495, 3502, 3564, 3565, 3598, 3612, 3620,3626, 3636, 3804, 3472, 3492, 3503, 3507, 3513,3803, 3805, 3806, 3891, 3893, 3804, 3898, 3900,3917, 3919, 3920 and 3602 are JN375804–JN375837. Genbank accession numbers for dnaK,16S rRNA and nodA gene sequences are indicated inbrackets after each strain in Figs. 1, 2 and 3.

Results

dnaK phylogenetic analysis

A single DNA fragment of 318 bp representing thevariable 3’ end fragment of the dnaK gene was ampli-fied in 42 of the 43 strains. All the 42 strains formed awell supported cluster (88% bootstrap support) togeth-er with the Mesorhizobium type strains (Fig. 1). Thesequences were distributed in 10 clades (A to J) withinthe Mesorhizobium genus. The strains WSM3472,3900, 3898, 3893, 3891 and 3894 from L. excisa,WSM3596 and 3592 from L. herbacea, WSM3495and 3507 from L. capitata, WSM3059 from L. annu-laris and the strain WSM2808 isolated from L. frutes-cens all clustered with WSM3872, a strain isolatedfrom Biserrula sp. growing in Eritrea, Africa . CladeD, comprising L. herbacea strains: WSM 3606, 3806and 3803, and clade E comprising strains WSM3564,3565, 3598, 3626 and 3636, were closely grouped toone another and were not related to any known Mes-orhizobium species. There were 18 strains closelyrelated to the type strains M. mediterraneum, M. tian-shanense and M. temperatum; most of these strains

had been isolated from L. diffusa (WSM2561, 2628,3492, 3502, 3503, 3513, 3620, 3493 and 3917), andthe others from L. microphylla (WSM2607, 2559 and2622), L. incana (WSM 3919 and 3920), L. frutescens(WSM3310 and 2211), WSM2623 from L. annularisand WSM2566 from L. pauciflora.

16s rRNA phylogeny

An internal fragment of the 16S rRNA gene of1,210 bp was successfully amplified for the 17 strains.Consistent with the dnaK phylogeny, 16 of the strainsclustered within theMesorhizobium genus (Fig. 2), andwere distributed in four major clades. However, strainWSM3602 (from which a PCR product from dnaKcould not be generated) clustered with the genus Bur-kholderiawhich belongs to β-proteobacteria, and close-ly related to the species B. tuberum.

The strains WSM2623, 3310, 3919, 2559, 2622and 2566 clustered together in the 16S rRNA phylo-genetic tree (Fig. 2), consistently with the groupingand position of the strains in the dnaK tree. There wereseven Lessertia strains (WSM3626, 3598, 3495, 3636,3898, 3612 and 3565) with identical 16s rRNAsequences that clustered close to the type strains ofM. australicum and M. shangrilense. There was nocongruence between the position of these strains in16S rRNA and dnaK phylogenies, as theywere includedin different clades in the dnaK tree. Another incongru-ence detected between 16S rRNA and dnaK phyloge-nies was the position ofWSM3270, which was not closeto any known Mesorhizobium species in the dnaK phy-logenetic tree (Fig. 1), but was closely related to fourMesorhizobium type strains: M. metallidurans, M. tar-imense, M. gobiense and M. tianshanense in the 16SrRNA phylogeny.

Fig. 1 Neighbor joining phylogenetic tree based on partial dnaKgene sequencing of 42 strains of Lessertia spp. root nodule bacte-ria. Bootstrap values are indicated on branches only when higherthan 50%. The type strains sequences in the phylogram wereobtained from GenBank (accession number in parentheses). M.:Mesorhizobium; S.: Sinorhizobium; R.: Rhizobium and B.: Bra-dyrhizobium. Strains from Lessertia spp. are labeled in bold.Initials in parentheses after the strain number indicate originalhost: L. annularis (La); L. capitata (Lc); L. diffusa (Ld); L.excisa(Le); L.frutescens (Lf); L.herbacea (Lh); Li: L.incana; L.micro-phylla (Lm); L.pauciflora (Lp)

b

390 Plant Soil (2012) 358:385–401

Plant Soil (2012) 358:385–401 391

392 Plant Soil (2012) 358:385–401

Sequencing of partial nodA

The partial nodA gene was successfully amplified for34 strains and the assembled sequence was 605 bplong. Most of the strains were grouped in a largemonophyletic clade (Fig. 3), that was subdivided into6 well supported clades. All the sequences included inthe Lessertia nodA clade shared little similarities withany other published nodA sequences on GenBank.The only exceptions were the L. herbacea strainsWSM3803, 3804, 3805 and 3806 that clustered andhad more than 96% similarity with the nodA sequenceof the Mesorhizobium sp. strain DUS835. This strainwas originally isolated from the South African speciesAspalathus linearis in the Western Cape (Elliott et al.2007). The two strains that were not included in thelarge clade described above were WSM3602 whichclustered with Burkholderia tuberum DUS833 (Elliottet al. 2007) and with Burkholderia sp. WSM3937nodA sequences (Garau et al. 2009), and strainWSM3310 from L. frutescens that was closely relatedto Sinorhizobium medicae WSM419 nodA sequence(Reeve et al. 2010).

Nodulation specificity and symbiotic effectiveness

There were differences in nodulation patterns andsymbiotic effectiveness depending on the strain andthe plant host combination. L. herbacea, L. excisa andL. diffusa were able to nodulate with most of thestrains, whereas L. capitata, L. pauciflora and L.incana could only nodulate with a small number ofstrains (Table 3). Numbers of nodules per plant werein general low, ranging from two to seven nodules perroot system. Nodules, in most of the cases, were eitherfan-shaped or bifurcate indeterminate, the only excep-tion was the strain WSM3602 that formed more than30 round white nodules on L .herbacea.

L. diffusa was able to form nodules with 14 strainsand 10 of these produced significantly higher dryweights than the uninoculated control (P≤0.05). Thestrains WSM3598, 3636 and 3898 formed effectivenodules (shoot dryweight > 70% nitrogen fed control)(Table 3). L. herbacea was able to nodulate with 16strains, of which WSM2559, 2566, 3636, 3598, 3898,3612 and 3565 resulted in larger dry weights than theuninoculated control (P≤0.05).

Ten strains formed nodules with L. capitata, albeitonly six of these (WSM3636, 3612, 3898, 3565 and3626) significantly increased dryweights in compari-son to the uninoculated plants (P≤0.05) and none ofthem to the level of the nitrogen fed control (Table 3).L. incana was able to nodulate with ten strains, butonly WSM3598 and WSM3598 were partially effec-tive and differed from the uninoculated control (P≤0.05). L. excisa formed nodules with 13 of the 17inoculated strains, of which WSM3612, 3898, 3565and 3626 were able to increase shoot dry weight (P≤0.05) in comparison to the uninoculated control (Table 3).However, none of these treatments increased dry weightto the level of the nitrogen fed control. L. paucifloranodulated only with the strains WSM3495, 2623 and3270 and in every case nodulation was ineffective.

Some strains effectively nodulated more than oneLessertia host (Table 3). WSM3636 effectively nodu-lated L. diffusa and L. herbacea, and while only par-tially effective with L. capitata, it was the strain thatproduced the highest dry weight with that host. Sim-ilarly, WSM3598 was effective with the same speciesand partially effective when inoculated onto L. incana,where it also produced the highest dry weight. Thestrains WSM3612 and 3898 effectively nodulated L.herbacea and L. diffusa respectively, but also wereable to increase dry weights in all the other species,with the exception of L. pauciflora.

Discussion

The purpose of this study was to assess the ability tonodulate and fix atmospheric nitrogen, and the geneticdiversity, of a collection of Lessertia root nodule bac-teria isolated from different agro-climatic areas of theNorthern, Eastern and Western Capes of South Africa.

The species diversity of Lessertia isolates was in-ferred from the partial sequencing of the genes dnaKand 16S rRNA. The overall taxonomic position of

Fig. 2 Neighbor joining phylogenetic tree based on 16S rRNAgene sequencing of 17 strains of Lessertia spp. root nodulebacteria. The type strain sequences in the phylogram wereobtained from GenBank (accession number in parentheses).M.: Mesorhizobium; S.: Sinorhizobium and R.: Rhizobium.Strains from Lessertia spp. are labeled in bold. Initials in paren-theses after the strain number indicate original host: L. annularis(La); L. capitata (Lc); L. diffusa (Ld); L.excisa (Le); L.frutes-cens (Lf); L.herbacea (Lh); Li: L.incana; L.microphylla (Lm); L.pauciflora(Lp)

R

Plant Soil (2012) 358:385–401 393

Fig. 3 Neighbor joiningtree based on partial nodAsequencing of 34 strains ofLessertia spp. root nodulebacteria. The type strainsequences in the phylogramwere obtained from Gen-Bank (accession number).Strains from Lessertia spp.are labeled in bold. Initialsafter WSM strain numberindicate original host L.annularis (La); L. capitata(Lc); L. diffusa (Ld); L.excisa (Le); L. frutescens(Lf); L. herbacea (Lh); Li: L.incana; L. microphylla (Lm);L. pauciflora(Lp)

394 Plant Soil (2012) 358:385–401

Lessertia spp. strains in the dnaK phylogeny waswithin the genus Mesorhizobium, a position that wasfurther confirmed with the sequencing of 16S rRNA,however, when comparing where the strains clusteredwithin the genus using dnaK and 16S rRNA, differ-ences were observed. In some cases this was due to alower sequence divergence between strains in the 16SrRNA analysis than with the dnaK sequences. Clearexamples of this were strains WSM3626, 3598, 3495,3636, 3898, 3565 and 3612 that showed identical 16SrRNA sequences (Fig. 2) but in the dnaK phylogenywere split into three well supported clusters (Fig. 1).Furthermore, the strain WSM3270 clustered on itsown in the dnaK phylogenetic tree, whereas its 16SrRNA sequence was closely related to the type strainsM. metallidurans, M. tarimense, M. gobiense and M.tianshanense. The inconsistency between the array of16S rRNA sequences and those of other housekeeping

genes has been widely reported within the orderRhizobiales (Ba et al. 2002; Eardly et al. 2005; Gaoet al. 2004; Gaunt et al. 2001; Nandasena et al. 2009;Ormeño-Orrillo et al. 2006; van Berkum et al. 2003).This could in part be attributed to the differential ratesof evolution between core genes; as 16S rRNA hasbeen shown to be a slowly evolving gene in compar-ison to other housekeeping genes and therefore lacksthe required level of resolution to distinguish similarspecies (Chelo et al. 2007; Eardly et al. 2005; Hanageet al. 2006; Stępkowski et al. 2003b). There is alsoevidence that 16S rRNA can occasionally undergolateral transfer and genetic recombination betweensimilar species distorting some of the relationshipsinferred from its sequencing (Gaunt et al. 2001;Hanage et al. 2006; Stępkowski et al. 2003b; vanBerkum et al. 2003). Partial dnaK has shown a betterresolution of internal branches especially within the

Table 3 Shoot dry weights (mg plant−1) for L. diffusa, L. herbacea, L. capitata, L. incana, L. excisa and L. pauciflora inoculated with17 different rhizobia strains. Nodulation categories are: E, effective; PE, partially effective; I, Ineffective; X, no nodulation

Strain Host legume species

WSM L. capitata L. diffusa L. excisa L. herbacea L. incana L. pauciflora

DW Nod DW Nod DW Nod DW Nod DW Nod DW Nod

2559 27.70 PE 30.37 PE 15.67 I 38.74 PE 14.34 PE 6.05 X

2561 7.33 X 35.28 PE 15.04 I 15.67 I 6.83 X 4.85 X

2566 23.24 PE 15.30 PE 11.33 I 40.06 PE 5.07 X 5.90 X

2622 11.81 X 8.17 X 9.21 I 18.48 I 8.75 X 5.24 X

2623 18.04 X 19.67 PE 11.05 X 25.08 X 8.03 I 5.88 I

3270 11.02 I 30.22 PE 12.13 I 14.33 I 6.22 X 13.34 PE

3310 16.77 X 19.32 PE 10.30 X 23.71 PE 7.91 X 5.06 X

3495 13.67 I 39.02 PE 17.33 I 30.66 I 11.02 PE 4.11 I

3565 29.56 PE 36.12 PE 65.41 PE 47.50 E 9.33 I 6.77 X

3598 25.66 X 101.30 E 17.32 I 50.53 E 26.05 PE 3.44 X

3602 15.62 X 27.09 X 20.23 X 21.47 I 7.40 X 10.24 X

3612 30.23 PE 38.77 PE 86.02 PE 72.08 E 19.78 PE 4.05 X

3626 38.67 PE 35.41 PE 88.67 PE 23.35 PE 6.84 I 4.11 X

3636 57.30 PE 61.30 E 37.67 I 48.51 E 8.42 I 3.48 X

3804 14.02 X 8.67 I 8.67 X 26.12 I 5.03 X 4.75 X

3898 33.68 PE 48.64 E 62.33 PE 28.42 PE 8.71 PE 3.24 X

3919 7.84 I 7.25 X 15.30 I 15.06 I 6.19 I 3.42 X

N+ 118.31 X 63.58 X 361.33 X 56.08 X 45.81 X 40.05 X

N− 6.12 X 7.28 X 7.40 X 21.35 X 6.31 X 5.28 X

N+: Nitrogen control, N−: Uninoculated control. Dry weights in bold were significantly different from the uninoculated control for eachhost species (P≤0.05)

Plant Soil (2012) 358:385–401 395

genus Mesorhizobium and Bradyrhizobium (Alexandreet al. 2008; Eardly et al. 2005; Kwon et al. 2005;Stępkowski et al. 2003a). There is no evidence so far oflateral transfer of the dnaK gene, but there have beendifferences between that loci and groups of other wellcorrelated housekeeping genes suggesting that dnaKtransfermay be possible aswell (Parker 2004; Stępkowskiet al. 2007).

In spite of the differences between both phyloge-nies, there were strains that were consistently clusteredtogether in the dnaK and 16S rRNA trees. This groupwas composed of seven strains (WSM 2559, 2623,3919, 3310, 2566, 2561 and 2622) that were closelyrelated to M. temperatum and M. mediterraneum inboth phylogenetic trees (Figs. 1 and 2). Interestingly,all the strains grouped in this clade, including the other12 strains that were clustered with these species in thednaK phylogeny, were characterised as slow growingbacteria (unpublished results). Gao et al. (2004) alsodescribedM. temperatum as slow growing (able to forma single 1 mm colony within 7 to 10 days), whereas M.mediterraneum forms colonies in 4 to 5 days (Nour et al.1995). The similarities in rate of growth and the highsequence similarity between this group of slow growingLessertia strains andM. temperatum suggests that thesestrains are more closely related to the latter than to M.mediterraneum.

While the dnaK gene for the strain WSM3602 couldnot be amplified, its 16S rRNA and nodA partial genesclustered with those of Burkholderia tuberum. Nodula-tion with β-proteobacteria by plants that normally nod-ulate withα-rhizobia has been previously reported and inmost of the cases the relationship has resulted an inef-fective symbiosis (Chen et al. 2003; Yan et al. 2007) andattributed to the ability of Burkholderia spp. to competeparticularly well in infertile soils (Elliott et al. 2009;Lindeque 2005). Consistent with this, WSM3602formed ineffective nodules on its original host L. herba-cea (Table 3). However as the Cape Floristic region isbecoming increasingly examined for legumes that areadapted to infertile soils and dry climate, nodulation byBurkholderia spp. is becoming more widely reported(Garau et al. 2009; Howieson et al. 2008).

The phylogeny of the common nodulation gene nodAwas determined for 34 strains of Lessertia spp. ThenodA genes were shown to be clustered in a robust(100% bootstrap support) monophyletic clade separatedfrom other knownMesorhizobium spp. nodA sequences.This indicates that nodA has diverged from a common

ancestor for this group of strains (Lecointre and LeGuyader 2006) and has had a long history of separateevolution (Ochman et al. 2000; Wei et al. 2009).

The overall topology of the nodA tree was not con-gruent with 16S rRNA and dnaK phylogenies, as somestrains that had clustered with distinct Mesorhizobiumspp. in the core gene phylogenies shared similar nodAgenes. Several studies have reported the discordance ofsymbiotic and core loci phylogenies in rhizobial strains(Chen et al. 2003; Donate-Correa et al. 2007; Haukka etal. 1998; Laguerre et al. 2001; Moulin et al. 2004;Ormeño-Orrillo et al. 2006; Parker and Kennedy 2006;Parker et al. 2002; Stępkowski et al. 2003b, 2007;Suominen et al. 2001; Wernegreen and Riley 1999) aswell as the tendency of symbiotic genes from strainsfrom a particular legume to cluster in separate cladesdespite their chromosomal background (Andam et al.2007; Ba et al. 2002; Chen et al. 2008; Donate-Correa etal. 2007; Han et al. 2010; Haukka et al. 1998; Kalita etal. 2006; Moulin et al. 2004; Stępkowski et al. 2005;Vinuesa et al. 2005b;Wei et al. 2009). Both phylogeneticdiscordances and monophyletic clustering are often at-tributed to lateral gene transfer during the diversificationof the family (Ochman et al. 2000; Sullivan et al. 1995;van Berkum et al. 2003) causing the separation of pop-ulations into subgroups that differ in symbiotic proper-ties but share a common core gene pool (Doolittle andPapke 2006).

The discordance between nodA and housekeepinggenes from Lessertia strains could imply that there hasbeen lateral transfer of symbiotic elements. However,when a gene transfer event takes place it would beexpected that strains would share a high degree ofsimilarity for the gene in question (Ochman et al.2000). This does not seem to be the case, as the nodAsequences are divided in deep divergent branches.Therefore, symbiotic gene transfer within differentMes-orhizobium spp. associated with Lessertia spp. seems tohave happened early in the symbionts’ evolution andrecent lateral transfer events do not seem to have playedan important role.

Legume symbionts from undisturbed environmentsoften show congruence between symbiotic and house-keeping genes suggesting that vertical gene transmis-sion is a more significant event than symbiotic genetransfer during rhizobial evolution (Aguilar et al.2006; Chen et al. 2003, 2008; Elliott et al. 2009; Hanet al. 2010; Wei et al. 2009; Wernegreen et al. 1997;Wernegreen and Riley 1999; Zhang et al. 2001). Lateral

396 Plant Soil (2012) 358:385–401

transfer of symbiotic genes is more evident, wherestrains are subject to human selective pressures (Han etal. 2010; Laguerre et al. 2001; Wernegreen et al. 1997;Wernegreen and Riley 1999).

In this work, the only clear evidence of recentlateral symbiotic gene transfer is the case of the L.frutescens strain WSM3310, that had showed nearlyidentical 16S rRNA and dnaK sequences to M. medi-terraneum, M. temperatum and to at least five otherLessertia symbionts (Figs. 1 and 2) but its nodA genematched with 100% similarity to that of Sinorhi-zobium medicae strain WSM419 (Reeve et al. 2010).Transfer of genes from Sinorhizobium to Mesorhi-zobium species has been previously demonstrated(van Berkum et al. 2003) and the close phylogeneticproximity between both genera (Jarvis et al. 1997) aswell as the fact that plasmids are quite promiscuousmakes genetic transfer among them possible (Doolittleand Papke 2006).

The divergence of nodA clades may be explainedby the geographical origin of the symbionts, as in mostcases strains grouped in a particular clade were isolat-ed from plants collected from closely related sites(Table 1). For example, strains WSM3503, 3917,3920, 3513, 3919, 3492, 3502 and 3620 were allcollected from areas in the Northern Cape that matchwith the Succulent Karoo biome distribution, whereasstrains WSM2607 and 2622 were from the NamaKaroo and the group of strains: WSM3891, 3898,3565, 3612, 3472, 3564, 3598, 3893, 3894 and 3900were isolated from areas in the Fynbos biome (West-ern Cape). The only nodA sequence from a differenthost included in the nodA cluster of Lessertia micro-symbionts was that of the Mesorhizobium strainDUS835 (Elliott et al. 2007). This strain was original-ly isolated from the South African legume Aspalathuslinearis (Boone et al. 1999; Muofhe and Dakora 1999)from the Fynbos biome of the Western Cape Province(Joubert et al. 2008). The biome from where thislegume was collected matches with the geographicorigin of the Lessertia strains included in that clade(WSM3804, 3803, 3805 and 3806), suggesting eitherthat these strains have evolved together with DUS835,adapting to a similar legume flora, or that at somepoint in time there was transfer of symbiotic genesbetween symbionts.

The clustering of rhizobial symbiotic genes follow-ing geographic origin has been reported by other re-search groups (Gao et al. 2004; Han et al. 2010; Parker

et al. 2002). It seems that geographic distribution ofthe host plant is consistently influencing symbioticgenes phylogenetic structure rather than geographicbarriers (Andam et al. 2007; Ba et al. 2002; Han etal. 2010; Ormeño-Orrillo et al. 2006; Parker et al.2002) or the host range associated with them (Chenet al. 2008; Donate-Correa et al. 2007; Haukka et al.1998; Jarabo-Lorenzo et al. 2003; Laguerre et al. 2001;Perret et al. 2000; Vinuesa et al. 2005a, b; Wernegreenand Riley 1999). This supports the hypothesis thatthe biogeography of symbiotic microorganismsshould be similar to that of the host with which it isassociated (Martiny et al. 2006). While this may be truewhen examining plant host and symbiotic genes it is notthe case when looking at phylogeny based on 16S rRNAor dnaK.

Roche et al. (1996) suggested that nodABC geneshave evolved to contribute to the adaptation to specificlegume hosts. Consequently, symbiotic gene classifi-cation is often associated with host specificity (Laguerreet al. 2001; Perret et al. 2000). It is thus likely that basedon nodA sequences, symbionts from Lessertia spp.diverged forming distinct clades to adapt to thelegumes present within each different biome, rather thanby effect of the geographic distance or environmentalconditions.

One of the nodA sequences that was not located inthe Lessertia spp. strains nodA clade was that ofWSM3602 (L. herbacea), which clustered with nodAfrom B. tuberum STM678 (Elliott et al. 2007) andBurkholderia sp. WSM3937 (Garau et al. 2009). Thisis not surprising as WSM3602 had been identified as aBurkholderia spp. through sequencing of 16S rRNA(Fig. 2). It is notable that STM678 was originallyisolated from Aspalathus carnosa, and WSM3937from Rhynchosia ferulifolia, both native to the fynbosvegetation in South Africa’s Western Cape (Elliott etal. 2007; Garau et al. 2009) which corresponds to thearea from where WSM3602 was collected (Table 1),reinforcing the idea that nodA clusters are based onadaptation to a particular biome.

Although nodA is the nod gene with the mostavailable sequences in the data bases, most of theseare derived from rhizobia associated with crops orforage legumes and only a small number from non-commercial legumes (Doyle and Luckow 2003; Hirschet al. 2001; Moschetti et al. 2005; Willems 2006). Fur-ther studies of root nodule bacteria from additionallegumes from African habitats may reveal new rhizobia

Plant Soil (2012) 358:385–401 397

lineages, increasing the chances of Lessertia symbiontsnodA clade being intermingledwith those from other notyet studied hosts.

The symbiotic effectiveness experiment showedthat the species L. herbacea, L. diffusa. L. capitata,L. excisa and L. incana were able to nodulate withmany of the same strains and hence might belong tothe same cross inoculation group. L. pauciflora, seemsincongruent in this cross inoculation group as it couldonly nodulate with three of the strains tested and onlyone was partially effective. Further, it was not able tonodulate consistently even with the strain isolated fromit (WSM2566), so there may be other abiotic factors thatare affecting its successful nodulation in the substrateused to grow the plants.

Overall, the highest plant dry weights in compari-son to uninoculated controls were recorded for thespecies L. herbacea (in association with WSM3565and 3612) and L. diffusa (with WSM3636 and 3598)(Table 3). None of the strains inoculated was able toachieve more than 50% of the N control dry weightwith the species L. incana, L. excisa and L. pauciflora,although some of the strains increased dry weightsignificantly in comparison to uninoculated control.Considering the importance of selecting strains ableto form symbiosis and fix nitrogen with severallegumes (Howieson et al. 2000), the most promisingstrains are WSM3636, WSM3612, WSM3565 andWSM3898, which achieved dry weights as high as inthe nitrogen control with at least one of the species andwere able to nodulate and fix nitrogen with more thanthree other Lessertia spp.

There were wide differences in effectiveness and innumber of symbiotic partners within Lessertia strains,which is expected for legumes that associate withdifferent rhizobia lineages under natural conditions(Moschetti et al. 2005; Parker and Kennedy 2006). L.herbacea followed by L. diffusa were the species able toassociate with most of the strains tested. Both specieswere even able to form partially effective nodules withthe Mesorhizobium strain WSM3310 that contains nodgenes from Sinorhizobiummedicae (Table 3).Moreover,Burkholderia sp. WSM3602 formed ineffective noduleson L. herbacea as well. These two strains had shownwide differences between their nodA sequences and withthose of most of the Lessertia spp. strains (Fig. 3). It isthus apparent that L. herbacea and L. diffusa are able torecognize widely different Nod factors. Future studiesmight reveal the extent of this apparent symbiotic

“promiscuity” and the impacts this could have in theestablishment of these species in the field.

Acknowledgements The authors would like to thank Mrs.Regina Carr (Centre for Rhizobium studies, Murdoch University)for technical assistance.

References

Aguilar OM, López MV, Donato M, Morón B, Soria-Diaz ME,Mateos C, Gil-Serrano A, Sousa C, Megías M (2006) Phy-logeny and nodulation signal molecule of rhizobial popula-tions able to nodulate common beans—other than thepredominant species Rhizobium etli—present in soils fromthe northwest of Argentina. Soil Biol Biochem 38:573–586

Alexandre A, Laranjo M, Young JPW, Oliveira S (2008) dnaJ isa useful phylogenetic marker for alphaproteobacteria. Int JSyst Evol Microbiol 58:2839–2849

Allen ON, Allen EK (1981) The leguminosae: a source book ofcharacteristics, uses and nodulation. The University ofWisconsin Press, Wisconsin, p 812

Andam CP, Mondo SJ, Parker MA (2007) Monophyly of nodAand nifH genes across Texan and Costa Rican populationsof Cupriavidus nodule symbionts. Appl Environ Microbiol73:4686–4690

Anderson PML, Hoffmann MT (2007) The impacts of sustainedheavy grazing on plant diversity and composition in low-land and upland habitats across the Kamiesberg mountainrange in the Succulent Karoo, South Africa. J Arid Environ70:686–700

Ba S, Willems A, De Lajudie P, Roche P, Jeder H, Quatrini P,Neyra M, Ferro M, Promé J-C, Gillis M, Boivin-Masson C,Lorquin J (2002) Symbiotic and taxonomic diversity ofrhizobia isolated from Acacia tortilis subsp. raddiana inAfrica. Syst Appl Microbiol 25:130–145

Balkwill MJ, Balkwill K (1999) The genus Lessertia DC.(Fabaceae-Galegeae) in KwaZulu-Natal (South Africa). SAfr J Bot 65:339–356

Boone CM, Olsthoorn MMA, Dakora FD, Spaink HP, Thomas-Oates JE (1999) Structural characterisation of lipo-chitinoligosaccharides isolated from Bradyrhizobium aspalati,microsymbionts of commercially important South Africanlegumes. Carbohydr Res 317:155–163

Breebaart L (2003) Feeding selection in three grazing systems inthe Nama Karoo. In Conservation Farming Project. NationalBotanical Institute, South Africa

Brenner DJ, Staley JT, Krieg NR (2005) Classification of pro-caryotic organisms and the concept of bacterial speciation.In: Brenner DJ, Krieg NR, Staley JT, Garrity GM (eds)Bergey’s manual of systematic bacteriology. Springer, NewYork, pp 27–32

Broughton WJ, Perret X (1999) Genealogy of legume-Rhizobiumsymbiosis. Curr Opin Plant Biol 2:305–311

Chelo IM, Zé-Zé L, Tenreiro R (2007) Congruence of evolu-tionary relationships inside the Leuconostoc-Oenococcus-Weissella clade assessed by phylogenetic analysis of the16SrRNA gene, dnaA, gyrB, rpoC and dnaK. Int J SystEvol Microbiol 57:276–286

398 Plant Soil (2012) 358:385–401

Chen W-M, Moulin L, Bontemps C, Vandamme P, Béna G,Boivin-Masson C (2003) Legume symbiotic nitrogen fixa-tion by β-Proteobacteria is widespread in nature. J Bacteriol185:7266–7272

Chen WF, Guan SH, Zhao CT, Yan XR, Man CX, Wang ET,Chen WX (2008) Different Mesorhizobium species associ-ated with Caragana carry similar symbiotic genes and havecommon host ranges. FEMS Microbiol Lett 283:203–209

Cocks PS (2001) Ecology of herbaceous perennial legumes: areview of characteristics that may provide managementoptions for the control of salinity and waterlogging indryland cropping systems. Aust J Agric Res 52:137–151

Cransberg L, McFarlane DJ (1994) Can perennial pasturesprovide the basis for a sustainable farming system insouthern Australia? N Z J Agric Res 37:287–294

de Faria SM, Lewis GP, Sprent JI, Sutherland JM (1989) Oc-currence of nodulation in the Leguminosae. New Phytol111:607–619

Dear BS, Moore GA, Hughes SJ (2003) Adaptation and poten-tial contribution of temperate perennial legumes to thesouthern Australian wheatbelt: a review. Aust J Exp Agric43:1–18

Donate-Correa J, León-Barrios M, Hernández M, Pérez-GaldonaR, del Arco-Aguilar M (2007) Different Mesorhizobiumspecies sharing the same symbiotic genes nodulate theshrub legumeAnagyris latifolia. Syst ApplMicrobiol 30:615–623

Doolittle WF, Papke RT (2006) Genomics and the bacterialspecies problem. Genome Biol 7:1–7

Doyle JJ, Luckow MA (2003) The rest of the iceberg. Legumediversity and evolution in a phylogenetic context. PlantPhysiol 131:900–910

Eardly BD, Nour SM, Berkum PV, Selander RK (2005) Rhizo-bial 16S rRNA and dnaK genes: mosaicism and the uncer-tain phylogenetic placement of Rhizobium galegae. ApplEnviron Microbiol 71:1328–1335

Elliott GN, Chen W-M, Bontemps C, Chou J-H, Young JPW,Sprent JI, James EK (2007) Nodulation of Cyclopia spp.(Leguminosae, Papilionoideae) by Burkholderia tuberum.Ann Bot 100:1403–1411

Elliott GN, Chou J-H, Chen W-M, Bloemberg GV, Bontemps C,Martínez-Romero E, Velázquez E, Young JPW, Sprent JI,James EK (2009) Burkholderia spp. are the most compet-itive symbionts of Mimosa, particularly under N-limitedconditions. Environ Microbiol 11:762–778

Gao J, Turner SL, Kan FL, Wang ET, Tan ZY, Qiu YH, Gu J,Terefework Z, Young JPW, Lindström K, Chen WX (2004)Mesorhizobium septentrionale sp. nov. andMesorhizobiumtemperatum sp. nov., isolated from Astragalus adsurgensgrowing in the northern regions of China. Int J Syst EvolMicrobiol 54:2003–2012

Garau G, Yates RJ, Deiana P, Howieson JG (2009) Novel strainsof nodulating Burkholderia have a role in nitrogen fixationwith papilionoid herbaceous legumes adapted to acid, in-fertile soils. Soil Biol Biochem 41:125–134

Gaunt MW, Turner SL, Rigottier-Gois L, Lloyd-Macgilp SA,Young JPW (2001) Phylogenies of atpD and recA supportthe small subunit rRNA-based classification of rhizobia. IntJ Syst Evol Microbiol 51:2037–2048

Han TX, Tian CF, Wang ET, Chen WX (2010) Associationsamong rhizobial chromosomal background, nod genes, and

host plants based on the analysis of symbiosis of indige-nous rhizobia and wild legumes native to Xinjiang. MicrobEcol 59

Hanage WP, Fraser C, Spratt BG (2006) Sequences, sequenceclusters and bacterial species. Phil Trans Roy Soc B 361:1917–1927

Harvey WH (1862) Leguminosae. In: Harvey WH, Sonder OW(eds) Flora capensis: systematic description of the plants ofthe Cape Colony, Caffraria and Port Natal. Vol. 2. Hodges,Smith and Co., Dublin, pp 1–285

Haukka K, Lindström K, Young JPW (1998) Three phylogenet-ic groups of nodA and nifH Genes in Sinorhizobium andMesorhizobium isolates from leguminous trees growing inAfrica and Latin America. Appl Environ Microbiol64:419–426

Hirsch AM, Lum MR, Downie JA (2001) What makes therhizobia-legume symbiosis so special? update on rhizobia-legume symbiosis. Plant Physiol 127:1484–1492

Howieson JG (1995) Characteristics of an ideotype acid tolerantpasture legume symbiosis in Mediterranean agriculture.Plant Soil 171:71–76

Howieson JG, Ewing MA, D'Antuono MF (1988) Selection foracid tolerance in Rhizobium meliloti. Plant Soil 105:179–188

Howieson JG, Loi A, Carr SJ (1995) Biserrula pelecinus L.—alegume pasture species with potential for acid, duplex soilswhich is nodulated by unique root-nodule bacteria. Aust JAgric Res 46:997–1009

Howieson JG, O'Hara GW, Carr SJ (2000) Changing roles forlegumes in Mediterranean agriculture: developments froman Australian perspective. Field Crop Res 65:107–122

Howieson JG, Yates RJ, Foster KJ, Real D, Besier RB (2008)Prospects for the future use of legumes. In: Dilworth MJ,James EK, Sprent JI, Newton WE (eds) Nitrogen-fixingleguminous symbioses. Springer, Dordrecht, pp 363–393

Jarabo-Lorenzo A, Pérez-Galdona R, Donate-Correa J, Rivas R,Velázquez E, Hernández M, Temprano F, Martínez-MolinaE, Ruiz-Argueso T, León-Barrios M (2003) Genetic diver-sity of bradyrhizobial populations from diverse geographicorigins that nodulate Lupinus spp. and Ornithopus spp.Syst Appl Microbiol 26:611–623

Jarvis BDW, Van Berkum P, Chen WX, Nour SM, FernándezMP, Cleyet-Marel J-C, Gillis M (1997) Transfer of Rhizo-bium loti, Rhizobium huakuii, Rhizobium ciceri, Rhizobiummediterraneum, and Rhizobium tianshanense to Mesorhi-zobium gen. nov. Int J Syst Bacteriol 47:895–898

Jaspers E, Overmann J (2004) Ecological significance of micro-diversity: identical 16S rRNA gene sequences can be foundin bacteria with highly divergent genomes and ecophysiol-ogies. Appl Environ Microbiol 70:4831–4839

Joubert E, Gelderblom WCA, Louw A, de Beer D (2008) SouthAfrican herbal teas: Aspalathus linearis, Cyclopia spp. andAthrixia phylicoides—a review. J Ethnopharmacol 119:376–412

Kalita M, Stępkowski T, Lotocka B, Malek W (2006)Phylogeny of nodulation genes and symbiotic proper-ties of Genista tinctoria bradyrhizobia. Arch Microbiol186:87–97

Kobayashi H, Broughton WJ (2008) Fine-tuning of symbioticgenes in rhizobia: flavonoid signal transduction cascade.In: Dilworth MJ, James EK, Sprent JI, Newton WE (eds)

Plant Soil (2012) 358:385–401 399

Nitrogen-fixing leguminous symbioses. Springer, Dor-drecht, pp 117–152

Konstantinidis KT, Tiedje JM (2005) Towards a genome-basedtaxonomy for prokaryotes. J Bacteriol 187:6258–6264

Kwon S-W, Park J-Y, Kim J-S, Kang J-W, Cho Y-H, Lim C-K,Parker MA, Lee G-B (2005) Phylogenetic analysis of thegenera Bradyrhizobium, Mesorhizobium, Rhizobium andSinorhizobium on the basis of 16S rRNA gene and internallytranscribed spacer region sequences. Int J Syst Evol Microbiol55:263–270

Laguerre G, Van Berkum P, Amarger N, Prévost D (1997) Geneticdiversity of rhizobial symbionts isolated from legume specieswithin the genera Astragalus, Oxytropis, and Onobrychis.Appl Environ Microbiol 63:4748–4758

Laguerre G, Nour SM, Macheret V, Sanjuan J, Drouin P,Amarger N (2001) Classification of rhizobia based onnodC and nifH gene analysis reveals a close phylogeneticrelationship among Phaseolus vulgaris symbionts. Micro-biology 147:981–993

Lecointre G, Le Guyader H (2006) The tree of life: a phyloge-netic classification. The Belknap Press of Harvard Univer-sity Press, Massachusetts

Lindeque MI (2005) Diversity of root nodule bacteria associatedwith Phaseolus coccineus and Phaseolus vulgaris speciesin South Africa. MSc Thesis, University of Pretoria, Pre-toria, South Africa

Lock JM, Schrire BD (2005) Tribe galegae. In: Lewis G, SchrireB, Mackinder B, Lock JM (eds) Legumes of the world.Royal Botanic Gardens, Kew, pp 475–487

Martens M, Delaere M, Coopman R, De Vos P, Gillis M,Willems A (2007) Multilocus sequence analysis of Ensiferand related taxa. Int J Syst Evol Microbiol 57:489–503

Martiny JBH, Bohannan BJM, Brown JH, Colwell RK,Fuhrman JA, Green JL, Horner-Devine MC, Kane M,Krumins JA, Kuske CR, Morin PJ, Naeem S, Ovreas L,Reysenbach A, Smith VH, Staley JT (2006) Microbial bio-geography: putting microorganisms on the map. Nat RevMicrobiol 4:102–112

Maunoury N, Kondorosi A, Kondorosi E, Mergaert P (2008) Cellbiology of nodule infection and development. In: DilworthMJ, James EK, Sprent JI, Newton WE (eds) Nitrogen-fixing leguminous symbioses. Springer, Dordrecht, pp 153–189

McArthur JV (2006) Microbial ecology: an evolutionary approach.Academic, San Diego, p 416

Moschetti G, Peluso A, Protopapa A, Anastasio M, Pepe O,Defez R (2005) Use of nodulation pattern, stress tolerance,nodC gene amplification, RAPD-PCR and RFLP–16SrDNA analysis to discriminate genotypes of Rhizobiumleguminosarum biovar viciae. Syst Appl Microbiol28:619–631

Moulin L, Béna G, Boivin-Masson C, Stępkowski T (2004)Phylogenetic analyses of symbiotic nodulation genes sup-port vertical and lateral gene co-transfer within Bradyrhi-zobium genus. Mol Phylogenet Evol 30:720–732

Muofhe ML, Dakora FD (1999) Nitrogen nutrition in nodulatedfield plants of the shrub tea legume Aspalathus linearisassessed using 15N natural abundance. Plant Soil 209:181–186

Nandasena KG, O'Hara GW, Tiwari RP, Willems A, HowiesonJG (2009) Mesorhizobium australicum sp. nov. and

Mesorhizobium opportunistum sp. nov., isolated fromBiserrula pelecinus L. in Australia. Int J Syst Evol Micro-biol 59:2140–2147

Nkonki T (2003) Lessertia DC. National Botanical Institute(South Africa), Pretoria

Nkonki T (2004) Lessertia DC. National Herbarium, Pretoria.http://www.plantzafrica.com/plantklm/lessertia.htm.Accessed 24 July 2008

Nour SM, Cleyet-Marel J-C, Normand P, Fernández MP (1995)Genomic heterogeneity of strains nodulating chickpeas(Cicer arietinum L.) and description of Rhizobium medi-terraneum sp. nov. Int J Syst Bacteriol 45:640–648

Ochman H, Lawrence JG, Groisman EA (2000) Lateral genetransfer and the nature of bacterial innovation. Nature405:299–304

Olsen GJ, Woese CR, Overbeek R (1994) The winds of (evolu-tionary) change: breathing new life into microbiology. JBacteriol 176:1–6

Ormeño-Orrillo E, Vinuesa P, Zúñiga-Dávila D, Martínez-Romero E (2006) Molecular diversity of native bradyrhi-zobia isolated from Lima bean (Phaseolus lunatus L.) inPeru. Syst Appl Microbiol: 253–262

Parker MA (2004) rRNA and dnaK relationships of Bradyrhi-zobium sp. nodule bacteria from four papilionoid legumetrees in Costa Rica. Syst Appl Microbiol 27:334–342

Parker MA, Kennedy DA (2006) Diversity and relationships ofbradyrhizobia from legumes native to eastern North America.Can J Microbiol 52:1148–1157

Parker MA, Lafay B, Burdon JJ, van Berkum P (2002)Conflicting phylogeographic patterns in rRNA and nifDindicate regionally restricted gene transfer in Bradyrhi-zobium. Microbiology 148:2557–2565

Perret X, Staehelin C, Broughton WJ (2000) Molecular basis ofsymbiotic promiscuity. Microbiol Mol Biol Rev 64:180–201

Reeve WG, Chain P, O'Hara GW, Ardley JK, Nandasena KG,Bräu L, Tiwari RP, Malfatti S, Kiss H, Lapidus A, CopelandA, Nolan M, Land M, Hauser L, Chang Y-J, Ivanova N,Mavromatis K, Markowitz V, Kyrpides N, Gollagher M,Yates RJ, Dilworth MJ, Howieson JG (2010) Complete ge-nome sequencing of the Medicago microsymbiont Ensifer(Sinorhizobium) medicae strain WSM419. Stand GenomicSci 2:77–86

Richardson AE, Viccars LA, Watson JM, Gibson AH (1995)Differentiation of Rhizobium strains using the polymerasechain reaction with random and directed primers. Soil BiolBiochem 27:515–524

Roche P, Maillet F, Plazanet C, Debelle F, Ferro M, Truchet G,Prome J-C, Denarie J (1996) The common nodABC genesof Rhizobium meliloti are host-range determinants. ProcNatl Acad Sci U S A 93:15305–15310

Saitou N, Nei M (1987) The neighbor-joining method: a newmethod for reconstructing phylogenetic trees. Mol BiolEvol 4:406–425

Stępkowski T, Czaplińska M, Miedzinska K, Moulin L (2003a)The variable part of the dnaK gene as an alternative markerfor phylogenetic studies of rhizobia and related alpha pro-teobacteria. Syst Appl Microbiol 26:483–494

Stępkowski T, Świderska A, Miedzinska K, Czaplińska M,Świderski M, Biesiadka J, Legocki AB (2003b) Low se-quence similarity and gene content of symbiotic clusters of

400 Plant Soil (2012) 358:385–401

Bradyrhizobium sp. WM9 (Lupinus) indicate early diver-gence of “lupin” lineage in the genus Bradyrhizobium.Antonie Leeuwenhoek 84:115–124

Stępkowski T, Moulin L, Krzyżańska A, McInnes A, Law IJ,Howieson J (2005) European origin of Bradyrhizobiumpopulations infecting lupins and serradella in soils of West-ern Australia and South Africa. Appl Environ Microbiol71:7041–7052

Stępkowski T, Hughes CE, Law IJ, Markiewicz L, Gurda D,Chlebicka A, Moulin L (2007) Diversification of lupineBradyrhizobium strains: evidence from nodulation genetrees. Appl Environ Microbiol 73:3254–3264

Sullivan JT, Patrick HN, Lowther WL, Scott DB, Ronson CW(1995) Nodulating strains of Rhizobium loti arise throughchromosomal symbiotic gene transfer in the environment.Proc Natl Acad Sci U S A 92:8985–8989

Suominen L, Roos C, Lortet G, Paulin L, Lindström K (2001)Identification and structure of the Rhizobium galegae com-mon nodulation genes: evidence for horizontal gene trans-fer. Mol Biol Evol 18:907–916

Tamura K, Nei M, Kumar S (2004) Prospects for inferring verylarge phylogenies by using the neighbor-joining method.PNAS 101:11030–11035

Tamura K, Dudley J, Nei M, Kumar S (2007) Molecular Evo-lutionary Genetics Analysis (MEGA) software version 4.0.Mol Biol Evol. doi:10.1093/molbev/msm092

van BerkumP, Terefework Z, Paulin L, Suomalainen S, LindströmK, Eardly BD (2003) Discordant phylogenies within the rrnloci of rhizobia. J Bacteriol 185:2988–2998

Vinuesa P, León-Barrios M, Silva C, Willems A, Jarabo-LorenzoA, Pérez-Galdona R, Werner D, Martínez-Romero E (2005a)Bradyrhizobium canariense sp. nov., an acid tolerant endo-symbiont that nodulates endemic genistoid legumes (Papil-ionoideae: Genisteae) from the Canary Islands, along withBradyrhizobium japonicum bv. genistearum, Bradyrhi-zobium genospecies alpha and Bradyrhizobium genospeciesbeta. Int J Syst Evol Microbiol 55:569–575

Vinuesa P, Silva C, Werner D, Martínez-Romero E (2005b) Pop-ulation genetics and phylogenetic inference in bacterial mo-lecular systematics: the roles of migration and recombinationin Bradyrhizobium species cohesion and delineation. MolPhylogenet Evol 34:29–54

Wei GH, Chen WM, Young JPW, Bontemps C (2009) A newclade of Mesorhizobium nodulating Alhagi sparsifolia sys-tem. Appl Microbiol 32:8–16

Wernegreen JJ, Riley MA (1999) Comparison of the evolution-ary dynamics of symbiotic and housekeeping loci: a casefor the genetic coherence of rhizobial lineages. Mol BiolEvol 16:98–113

Wernegreen JJ, Harding EE, Riley MA (1997) Rhizobium gonenative: unexpected plasmid stability of indigenous Rhizobiumleguminosarum. Proc Natl Acad Sci U S A 94:5483–5488

Willems A (2006) The taxonomy of rhizobia: an overview. PlantSoil 287:3–14

Yan XR, Chen WF, Fu JF, Lu YL, Xue CY, Sui XH, Li Y,Wang ET, Chen WX (2007) Mesorhizobium spp. are themain microsymbionts of Caragana spp. grown in Liaon-ing Province of China. FEMS Microbiol Lett 271:265–273

Yanagi M, Yamasato K (1993) Phylogenetic analysis of thefamily Rhizobiaceae and related bacteria by sequencingof 16S rRNA gene using PCR and DNA sequencer. FEMSMicrobiol Lett 107:115–120

Yates RJ (2008) Symbiotic interactions of geographically di-verse annual and perennial Trifolium spp. with Rhizobiumleguminosarum bv. trifolii. PhD thesis, Murdoch University,Perth, Australia

Zeigler DR (2003) Gene sequences useful for predicting relat-edness of whole genomes in bacteria. Int J Syst Evol Micro-biol 53:1893–1900

Zhang XX, Kosier B, Priefer UB (2001) Genetic diversity ofindigenous Rhizobium leguminosarum bv. viciae isolatesnodulating two different host plants during soil restorationwith alfalfa. Mol Ecol 10:2297–2305

Plant Soil (2012) 358:385–401 401