The EMBO Journal vol.9 no. 1 1 pp.3787 - 3794, 1990

Division genes in Escherichia coli are expressedcoordinately to cell septum requirements by gearboxpromoters

Marti Aldea, Teresa Garrido, Jesus Pla andMiguel Vicente

Centro de Investigaciones Biol6gicas, Consejo Superior deInvestigaciones Cientfficas, 28006 Madrid, Spain

Communicated by K.N.Timmis

The cell division ftsQAZ cluster and the ftsZ-dependentbolA morphogene of Escherichia coli are found to bedriven by gearboxes, a distinct class of promoterscharacterized by showing an activity that is inverselydependent on growth rate. These promoters containspecific sequences upstream from the mRNA start point,and their -10 region is essential for the inverse growthrate dependence. Gearbox promoters are essential fordriving ftsQAZ and bolA gene expression so that theencoded products are synthesized at constant amountsper cell independently of cell size. This mode of regulationwould be expected for the expression of proteins thateither play a regulatory role in cell division or form astoichiometric component of the septum, a structure that,independently of cell size and growth rate, is producedonce per cell cycle.Key words: cell division/Escherichia colilftsQAZ cluster/gearbox promoter/inverse growth rate dependence

IntroductionDivision is a cellular process in which very accurate controlsof timing and positioning work together to ensure theappropriate partition of cellular components. The molecularnature of these controls has remained largely unknown. Wefind that at least four genes, involved in cell division andmorphogenesis, are under the control of gearboxes, a namethat we propose to designate promoter sequences that ensurethat the products under their control are produced at fixedamounts per cell independently of the particular growth rateof the cell.The cluster of genes located at the 2.5 min region of the

standard Escherichia coli genetic map has been identifiedby the block in cell division caused by mutations. In thiscluster thefts genes have an essential role in the initial (ftsQandftsZ) and final (ftsA) steps of septation (Donachie et al.,1984). The gene product of ftsA is a structural componentof the septum (Tormo and Vicente, 1984) that interacts withPBP3 (Tormo et al., 1986), the penicillin-binding proteinrequired for septation. FtsA has been proposed as the keyfactor of a termination pathway, the TER pathway of celldivision (Tormo et al., 1985). The ftsZ gene product is thetarget of the inhibitory mechanism in cell division inducedby the SOS response (Lutkenhaus, 1983; Jones and Holland,1984), and overexpression of the ftsZ gene product leads tominicell formation (Ward and Lutkenhaus, 1985). Asidefrom being essential in cell division (Begg et al., 1980), very

little is known about the role played by the product of theftsQ gene. While in normal cells spherical murein is onlyproduced at the septum during cell division, overexpressionof bMlA, a morphogene located at 9.5 min of the E.coli genetic map, produces an ftsZ-dependent sphericalmorphology (Aldea et al., 1988b).The genetic structure of the ftsQAZ region reveals

the existence of overlapping transcriptional units wherepromoters for each gene would be located in thecorresponding upstream gene (Robinson et al., 1984, 1986).Since no transcriptional terminators have been found,expression of the cluster could mainly be driven by additivetranscription. A higher level of expression of the ftsQAZcluster has been observed during cessation of growth andthis fact has been attributed to the presence of promoterssimilar to those first identified in a plasmid-borne gene, mcb(Connell et al., 1987), and in the bolA morphogene (Aldeaet al., 1989).Here we report the identification and characterization of

promoters in the ftsQAZ cluster. One of these promoters,located upstream from the structural gene of the firstfts gene,is growth phase and growth rate dependent and shares somestructural features with the -35 and -10 regions of the bolApromoter, which is also shown to be dependent on growthrate. We find that the -10 region of a gearbox is essentialto maintain the inverse dependence of expression on growthrate.

ResultsTranscription from the ftsQ and bolA promoters isinversely dependent on growth rateWe have recently shown that expression from the ftsQpromoter region is growth phase dependent and haveproposed that this mode of regulation could be due to thepresence of promoters similar to bolAlp (Aldea et al., 1989).Promoter locations in the ftsQAZ cluster were previouslyunknown and had been inferred solely from analysis of theexpression of cloned fragments in promoter-probe vectors(Robinson et al., 1984, 1986; Yi et al., 1985). From thesedata promoter activity has been attributed to a 0.7 kbPstI-EcoRI fragment located upstream from ftsQ, and a1.2 kb PvuII-EcoRl fragment upstream from ftsZ (Figure1). No significant promoter activity has been observed forthe 1.0 kb EcoRP-Pvu II fragment which contains sequencesimmediately upstream fromftsA, suggesting thatftsA wouldmainly be expressed from the ftsQ promoters.To analyze expression levels from the ftsQ and bolA

promoter regions, we have used transcriptional fusions tolacZ in a lambda vector, which are described in Figure 1.Typically, (3-galactosidase activity produced by the promoterregion of ftsQ in XTGV 13 increased 5- to 6-fold in thestationary phase compared to cultures growing exponentially.A transcriptional fusion of the bolAlp promoter to lacZ inXMAV103 that only contains 50 bp upstream from the

3787© Oxford University Press

mRNA start point produced an 18-fold increase in stationaryphase cultures, whereas bolA expression driven by its twopromoters in XMAK400 (Aldea et al., 1989) showed an

intermediate increase of 7- to 9-fold. The increase inexpression levels always started as soon as the growth ratebegan to fall below the maximum growth rate supportedby the medium, suggesting that these promoters could infact be regulated by the growth rate. Accordingly,13-galactosidase activity driven by the bolA promoters inXMAK400 decreased to 35% during a growth rate upshiftfrom 1.1 to 2 doublings per hour (results not shown).

Table I shows the expression levels fromftsQ (XTGV 13),bolA (XMAV103) and lacUV5 (XRS74, Simons et al., 1987)promoters during exponential growth at different growthrates. The lacUV5 promoter has been shown previously tobe growth-rate independent (Wanner et al., 1977; Gourseet al., 1986). ,B-Galactosidase activities produced by theftsQand bolA promoters increase at lower growth rates so thatvalues obtained at 0.25 doublings per hour are almost equalto those corresponding to the stationary phase of growth inthe richest medium. Moreover, the relative increase in

EPs EB PP H E

Idd/ C)I ftsQ | ffsA t [ I IftsZ2pip 4p3p 2p1p

MAI MA2 MA3 MA4 MM ADM AD2 AD3 MA6 MA7

Ps

Ps EPs B

E p

p

B Ss PvS Sm

I D KbolA I2p IVp,B $ pMAK400,XMAK400

S Iv pMAV103, AMAV103

E pTGV14pTGV13. )TGV13M13MAV1pTGV16, M13MAV2

E pTGV17, M13MAV3

200 bp

Fig. 1. Maps of the ftsQAZ cluster and the bolA gene. The topdrawing shows the entire ftsQAZ cluster indicating the position of theopen reading frames for each gene in the cluster. Arrowheads indicatethe promoters identified in the present work. The ftsQlp gearboxpromoter is indicated by a black arrowhead. Small arrows symbolizeprimers used for promoter identification. The drawing at the bottomshows the bolA gene (Aldea et al., 1989), and the position of the twobolA promoters is indicated by arrowheads. The boAlp gearboxpromoter is represented by a black arrowhead. Thin lines indicatefragments carried by plasmid and phage vectors used in this work (seeMaterials and methods for details of construction). Relevant restrictionsites are abbreviated (B, BamHI; E, EcoRI; H, HindIII; Ps, PstI;Pv, PvuI; P, PvuII; S, ScaI; Sm, SnaI; Ss, SspI.

,B-galactosidase activity, plotted versus instantaneous growthrate during a transition to the stationary phase, attain similarvalues to those obtained from exponential cultures growingat different growth rates (Figure 2). Thus, expression fromthese promoters is in fact inversely correlated to growth rate,and the increase observed during the entrance into thestationary phase of growth would be a consequence of thegradual reduction in growth rate that takes place during thisgrowth phase transition.Since cell mass is directly correlated to growth rate in

E. coli (Nanninga and Woldringh, 1985), any gene productmaintained at constant amounts per cell should show an

inverse dependence on growth rate. Results in Figure 2indicate that transcription levels driven by theftsQ promoterregion agree with the curves predicted assuming that theencoded gene products are expressed at constant amountsper cell. Although expression from the bolAlp promoterexhibits a stronger dependence on growth rate, the two bolApromoters contained in XMAK400 when acting togetherproduce a lower increase (7- to 9-fold) resembling thatobtained from the ftsQ promoter region in XTGV13.

FtsZ and FtsA levels follow inverse growth ratedependenceSince no transcriptional terminators have been found withinthe ftsQAZ cluster, transcription from the ftsQ promotersshould also affect expression of the downstream fisA andftsZ genes. Figure 3 shows the results of an experiment inwhich anti-FtsZ antibodies were used to quantify the amountsof FtsZ in total cell extracts obtained from strain W3110growing exponentially at various growth rates and at differentstages during a growth rate transition. Supporting the dataobtained with transcriptional fusions of the ftsQ promotersto lacZ, FtsZ levels increase at lower growth rates followingthe same kind of dependence.The amount of FtsA can only be clearly quantified by

immunological methods in strains carrying the plasmidpZAQ (results not shown), which contains the wholeftsQAZcluster and a ColEl replicon. For this reason we measuredFtsA and FtsZ levels in W3100 (pZAQ) during a growthphase transition obtaining comparable relative increases forboth gene products (Figure 4). Although part of the observedincrease (3- to 5-fold) can be ascribed to the increase in thecopy number of pBR322 derivative plasmids during theentrance into the stationary phase (Lin and Bremer, 1986),it can be observed that FtsA and FtsZ when expressed inthe same construction follow the same growth ratedependence.

Table I. Expression from the ftsQ and bolA promoters is inversely dependent on growth rate

Promoter region Phage ,B-Galactosidase unitsLB Caa Glu Gly Ace LBR = 2.0 R = 1.5 R = 1.1 R = 0.6 R = 0.25 Sta

ftsQ XTGV13 29 56 78 108 137 150bolAlp XMAV103 32 60 330 538 544 581lacUV5 XRS74 958 1053 1201 986 1103 1181

RYC1000 cells lysogenized with phages carrying transcriptional fusions of the promoter regions and promoters indicated to lacZ were assayed for/3-galactosidase activity as described in Materials and methods. Exponential cultures were grown at different growth rates (R in doublings per hour)in LB and various M9-based media supplemented with either casamino acids and glucose (Caa), glucose (Glu), glycerol (Gly) or acetate (Ace) asdescribed in Materials and methods. Stationary cultures (Sta) were obtained in LB. (3-Galactosidase values are the average of five independent assaysand coefficients of variation were always <0.1.

3788

M.Aldea et al.

Control of cell division genes by gearboxes

The ftsQAZ cluster is driven by a gearbox promoterWe first attempted to map the mRNA start points in theftsQAZ cluster by using an RNA donor strain W3110transformed with pZAQ, which carries the whole ftsQAZcluster. Despite the theoretical high sensitivity of the methodused to map mRNA start points (see Materials and methods),no significant fragments resistant to SI nuclease wereobserved. In order to avoid possible repression effects dueto a higher gene dosage of the cluster, we decided touse strain RYC1000 transformed with plasmids pTGV13,pTGV16 and pTGV17 (Figure 1) as the RNA donors. Theseplasmids do not generate any of the cluster products and havethe additional advantage of producing hybrid mRNAs wherethe 3' end is provided by the lac genes fused to the clonedfragments, which could increase and standardize mRNAstability. Finally, the vector used to construct these plasmidsincludes four copies of a strong transcription terminatorimmediately upstream from the cloning sites so that read-through transcription from the vector promoters is efficientlyblocked (Simons et al., 1987). Figure 5 shows SI nucleaseprotections obtained withftsQ andftsZ transcripts when usingplasmids pTGV13 and pTGV17 as RNA donors at differentstages of a growth phase transition. Two promoters upstreamfrom ftsQ and four promoters upstream from ftsZ wereidentified, all of them being found within the open readingframes located immediately upstream from these genes.All promoters identified when using pTGV 13 and pTGV 17as RNA donors were also detected when using plasmid

tA

(U)

UL)0-.-(V

1=

2 A 2 B /ocUV5

2~~~~~~~~o ftQ! ,021

1 1 2 0 4

3

2 C bc/Alp 0 f/sQ0

0

0000 -~~~~0 1 2 0 1 2

R (hours71)

Fig. 2. Inverse growth rate dependence of the ftsQ and bolApromoters. Gene expression dependence on growth rate may bedivided into the three main theoretical classes shown in panel (A). (1)Regular promoters produce constant amounts per cell mass independentof growth rate (R). (2) rRNA promoters are more active at highergrowth rates so that rRNA content per mass is proportional to growthrate (Gourse et al., 1986). (3) Since cell mass (M) is an exponentialfunction of growth rate (M = MO x ebR; MO is the cell mass atR = 0; b = 0.85 for the E.coli K-12 strains used), any protein beingsynthesized at constant amounts per cell would show relative contents(P) to cell mass being inversely dependent on growth rate(P = P0 x e-bR; P0 is the relative content at R = 0). Other panelsshow relative ,B-galactosidase activities produced by the lacUVS (panelB) and bolAlp (panel C) promoters and the ftsQ promoter region(panel D) fused to lacZ in phages listed in Table I. Closed circlesindicate values obtained from exponential cultures growing in differentmedia (see Table I and Materials and methods). Open circles representrelative values obtained during a transition to the stationary phase inLB medium, which are plotted versus instantaneous growth rate.,B-Galactosidase activities were made relative by regression to thatcorresponding to R = 1.

pTGV14 (results not shown). It can be seen that transcriptionfrom ftsQ2p and the four ftsZ promoters is almost constantregardless of growth rate. On the other hand, fisQip isclearly induced when growth rate decreases during thegrowth phase transition. This promoter, like bolAlp (Aldeaet al., 1989), shows a clear induction as soon as thegrowth rate drops below the maximum value attained during

AP Gly Glu LB 1 2 3 4 5 6 7 8

FtsZ

1-_ -

0~~~

O I

0 2R fhours-1)

Fig. 3. FtsZ contents are inversely dependent on growth rate. Panel(A) shows a Western type blot in which equal amounts of total cellextracts (corresponding to 0.25 OD16W units) were electrophoresed in a10% SDS-polyacrylamide gel and FtsZ was detected with antiserumMVJ4 by the immunoblotting methods described in Materials andmethods. W31 10 transformed with pZAQ (lane P) was grownexponentially in LB and used to identify FtsZ. W31 10 was grownexponentially in LB (lane LB, R = 2) and minimal mediasupplemented with glucose (lane Glu, R = 1) or glycerol (lane Gly,R = 0.7) as described in Materials and methods. Lane numbers referto W3100 grown in LB during a transition from the exponential to thestationary phase in order to obtain various instantaneous growth rates(1, R = 2.1; 2, R = 2.0; 3, R = 1.7; 4, R = 1.3; 5, R = 1.2;6, R = 1.0; 7, R = 0.7; 8, R = 0.5). Panel (B) shows the relativeFtsZ levels plotted versus growth rate in exponential cultures (closedcircles) and during the growth phase transition (open circles). Bandsfrom panel (A) were quantified by densitometry and the valuesobtained were made relative by regression to that corresponding to R= 1.

R (hours1)

Fig. 4. FtsA and FtsZ levels follow similar inverse growth ratedependence. W31 10 transformed with pZAQ was used to quantifyFtsA (open squares) and FtsZ (open circles) levels during a transitionfrom the exponential to the stationary phase as described in Figure 3.Values obtained from bands corresponding to FtsA and FtsZ weremade relative to the levels found in the exponential phase (R = 1.9).

3789

0

r-4

LL.

di

In

v1.W

rli4LL-

.0C:m:2LL.

M.Aldea et al.

A

'I.,;

.1-

BACGT 1 Z 34__4____ __ __-_

___

_ __

__ _- ^_|y

-

_s_ w*x

= _ z

-_

-,- _

=-

- _

-

C

- &sZ2p

-(ftsZlp

Fig. 5. Promoter mapping in the ftsQAZ cluster. Promoters were mapped as described in Materials and methods. ftsQlp and ftsQ2p (A) wereidentified by using strain RCY1000 (pTGV13) as RNA donor and DNA probes and sequencing ladders were synthesized with M13MAV1 andprimer MA1. All ftsZ promoters were mapped by employing RYC1000 (pTGV 17) as RNA donor. Sequencing ladders and DNA probes wereobtained from M13MAV3 and primer MA6 to map ftsZlp and ftsZ2p (B), and from M13MAV3 and primer AD3 for ftsZ3p and ftsZ4p (C). Lettersrefer to the four dideoxynucleotides used for sequencing the coding strand. Four SI nuclease protections were performed for each set of promoterswith total RNA samples obtained at different instantaneous growth rates during a growth phase transition in LB (1, R = 2; 2, R = 0.8; 3,R = 0.6; 4, R = 0.4). Sequences for the non-coding strand at the mRNA start points of each promoter are indicated. Boxed letters indicate thebases corresponding to the identified mRNA start points taking into account that, under used conditions, S1 removes 2-3 additional bases from theDNA probe in the DNA-RNA hybrid (Aldea et al., 1988a).

exponential growth (Figure 6). A transcriptional efficiencyvalue forftsQ can be defined as the sum of transcriptionalactivities obtained from ftsQlp and ftsQ2p referred to thatfromftsQ2p (the constitutive promoter independent of growthrate), so that the increment expected from increased plasmidcopy number is also corrected. Assuming the absence ofpost-transcriptional regulatory mechanisms, this ratio wouldbe equivalent to the amount of the encoded products relativeto total cell mass. Our results show that the transcriptionalefficiency forftsQ increases as growth rate decreases duringthe growth phase transition, following the theoretical curvederived when assuming that encoded products are expressedat constant amounts per cell (Figure 7).No SI nuclear protected fragments were observed when

analyzing sequences upstream from ftsA using pTGV 14 andpTGV16 as RNA donors (results not shown). As previouslyinferred from the analysis of expression by transcriptionalfusions (Robinson et al., 1984), the ftsA gene does nothave then detectable promoters to direct its independentexpression.

Sequences containing the transcription start pointsidentified in theftsQAZ cluster are shown in Table II. ftsQlp,the inversely growth-rate dependent promoter in theftsQAZcluster (Figure 6), does not contain -35 and -10 regionsresembling the consensus sequences of the regular E. colipromoters (Harley and Reynolds, 1987). Instead, sequencesupstream from ftsQlp show a clear homology to the -10and -35 regions of bolAlp and mcbp. This class ofpromoters, which we propose to name gearbox promoters,are therefore defined by two distinctive characteristics:(i) an inverse dependence on growth rate and (ii) specificsequences at the -10 and -35 regions from theirtranscription start points.

boSA A,, 8 9 10!-r- "T-

o f -

1i.m.0 2 3 4

tirns hoursi

ftsQIp -

B1 2 3 4 5 6 7 8 9 10

I .." .*~

v, _, _- go so_Wf

Fig. 6. ftsQip directs transcription as a gearbox promoter. Total RNAsamples from strain RYC1000 (pTGV13) were obtained at differentstages of a transition to the stationary phase of growth (A), and equalamounts of total RNA were used to determine relative transcriptionlevels (B) from fsQip and ftsQ2p as described in Figure 5.

In addition to the gearbox promoter, the ftsQAZ clustercontains five more promoters that are not growth-ratedependent (Figure 5), which show -10 and -35 regions

3790

Fj

A

.1.

U

(if. i

.1

(i IA

A.1

AI;

Control of cell division genes by gearboxes

CL

0.I,,-

Ce

Li

2

R (hours7l)

Fig. 7. Transcriptional efficiency of the ftsQ promoter region. Thetranscriptional efficiency for the ftsQ promoters is calculated as thesum of transcriptional activities (quantitated by densitometry frombands shown in Figure 6) corresponding to ftsQip and ftsQ2p relativeto that corresponding to ftsQ2p. This transcriptional efficiency isplotted versus instantaneous growth rate during the growth phasetranscription. The line represents the theoretical transcriptionalefficiency that would be obtained assuming that the encoded geneproduct is expressed at constant amounts per cell.

(Table II) with a reasonable degree of homology to theconsensus sequences for the regular E.coli promoters.

The - 10 region of the gearbox promoter is essentialfor inverse growth rate dependenceThe gearbox promoters identified in theftsQ, bolA and mcbgenes share homologous sequences at the -35 and -10

regions. Analysis of the transcriptional fusion contained inXMAV103 (Figure 1) shows that growth rate dependencerequires only 50 bp upstream from the mRNA start pointin bolAlp. We have used the bolAlp in XMAV 103 as a

prototype to obtain two mutated promoters (see Materialsand methods), in which sequences upstream from the mRNAstart sites are changed, for analyzing the role of the -10region. Mutation bolAlpi was devised to check whether or

not the -10 region is required for inverse growth ratedependence, independent of its strength as a promoter. Thismutation contains three base substitutions that create theTATAAT consensus sequence for regular E. coli promotersand modifies two conserved bases of the -10 region in thegearbox. In the other mutation, bolAlp2, the conserved CGGsequence was changed to CCC to evaluate the function ofthis sequence as a possible determinant of promoter strength.Table III shows the analysis of the expression of thesemutated promoters. bolAlpi behaves as a constitutivepromoter with respect to growth rate; moreover, expressionlevels obtained from this promoter are similar to those foundfor the wild-type bolAlp at the end of the growth phasetransition (Figure 8). In contrast, bolAlp2 still shows some

growth rate dependence but absolute expression levels instationary cultures show a 20-fold reduction when comparedwith the wild-type promoters under similar circumstances.Nevertheless, expression kinetics from this mutated promoterare very similar to the wild-type bolAlp, being induced as

soon as growth rate decreases under the maximum valueattained during exponential growth (Figure 8). The twobase substitutions in bolAlp2 produce a -10 regionwhich resembles that found in heat-shock promoters, butno induction was observed when exponentially growing

MC 1061 cells transformed with pMAV 106 were transferredfrom 30°C to 42°C (results not shown).We conclude that in association with other structural

features present in gearboxes (Table II), the -10 region ofthe gearbox bolAlp not only determines its promoterstrength, but also provides specific features that are

responsible for inverse growth rate dependence.

DiscussionIn the present work we have characterized the pattern ofexpression of theftsQAZ cluster and have confirmed previousresults (Aldea et al., 1989) which suggested that this clusterwould be under the control of promoters similar to thosefirst identified in the mcb and bolA genes (Connell et al.,1987; Aldea et al., 1989). Analysis of expression underseveral growth conditions allows us to conclude that the bolAand ftsQ promoter regions are sensitive to growth rate, so

that the expression of these genes increases as the growthrate decreases. By measuring amounts of their gene productsrelative to total protein at different growth rates andduring a growth phase transition, this inverse growth ratedependence has also been shown for the other two genes

of the cluster, ftsA andftsZ. The induction of expression ofthese genes during the entrance to the stationary phase thatwe had previously reported can now be interpreted as a

consequence of the activation of gearboxes caused by thegradual decrease in growth rate that occurs during thisgrowth phase transition. In agreement with this idea, relativelevels of expression plotted versus instantaneous growth rateduring a transition to the stationary phase fit with thoseobtained in cultures growing exponentially at differentgrowth rates.Two promoters were identified upstream fromftsQ, which

are found within the open reading frame for ddl, and fourpromoters upstream from theftsZ, which are also found inthe open reading frame of the immediate upstream gene, fitsA.According to previous results using transcriptional fusions(Robinson et al., 1984), we have found that the ftsA gene

does not have detectable promoters of its own. Although wecannot exclude the presence of very weak promoters withinthe ftsQ open reading frame, our results indicate that theftsA gene should be expressed mainly from the ftsQpromoters since a DNA fragment containing ftsQ and ftsAbut missing theftsQ promoters, when cloned in single copyvectors with proper transcription termination signals, doesnot complement an ftsA chromosomal mutation (to bepublished elsewhere). Moreover, the fact that open readingframes for the ftsQ and ftsA gene products share one basesuggests that expression of these two genes could becoordinated by coupled translation. Since no transcriptionalterminators have been found in this cluster (Robinson et al.,1984, 1986), transcription initiated at the ftsQ promotershould also direct expression of the distal ftsZ gene.

Accordingly, the ftsA and ftsZ gene products show inversegrowth rate dependence as well.The transcription rate from only one of these promoters,

fisQip, is inversely dependent on growth rate, a propertyshared by bolAlp (Aldea et al., 1989). This class ofpromoters, which we name gearbox promoters, presentscommon features both at the -35 and -10 regions, andshows an A/T-rich stretch upstream from the -35 region(Table II). Two sequences resembling the -10 region ofbolAlp had previously been found in ftsQ and ftsA (Aldea

3791

2 0°

0

1 00

0~0

rlI-l

M.Aldea et al.

Table H. Sequences and locations of promoters involved in expression of fts and bolA genes

-35 -10

TGAAGAAATTTTAC CGTCAA TACGTATTTATTTGTTGTTAAG CTGCAA TGGAAACGAGTTCAAATTATCA TTGCAA AATATAG<--A/T rich--> ctgCAA

CAACCGTC CGGAACCT TCTATGATTatgAGGCGAGTAAAAG CGGCTAGT ATTTaaAGGGATGGATGATTAATTA CGGCAAGT AACTagTGTTGGCCAACA

CGGcaagT

16 28615 914 62

Regular promoters

GGAATGTCAAAAGTA GTAGCA GAAAATGCT CTACAAGA TGCATT AAGATTGGCattTCAGCAATACGCAAGTGCGTA TCGGCG CGCCGCTGAACATTACCGG TTTAAC gGAU$ZGQTLA9UGCCCGCAGATCGAAGGTC TTGCAG CCTGTGCTC AGCGCGTG TTTCAT ACgcaAGTGCGTATCGGCTATACCGGTGGGGCA TTGCGC CACACTAAG GTAATTCCT TATGCT GGCAATgtcGTGACCAGTACGTGAACTGGGTGT CTGCGT CGTCGATAT CGGTGGTGG TACAAT GGATATCgccGTTTATAC

TTGaca TAtaaT

17 41319 21517 25718 61318 670

Transcription start points are indicated in lower case letters (see Materials and methods). A tentative consensus sequence for the gearbox promotersand the consensus for regular promoters (Harley and Reynolds, 1987) are included. Underlined sequences indicate a putative DnaA box. Sequencesfor bolAlp (Aldea et al., 1989) and mcbp (Connell et al., 1987) have been described previously.

et al., 1989) but none of them have promoter activity,indicating that some features other than a -10 region mustbe fulfilled for a region to function as a gearbox, e.g. a -35region and, perhaps, an upstream A/T-rich stretch. By sitespecific mutagenesis we have shown that the -10 regionis essential in the bolAlp gearbox promoter for inversegrowth rate dependence. The presence of specific sequencesat the -10 region of the gearbox suggests that regulationof this class of promoters could be due either to a sigmafactor different from sigma 70, or to a modified form ofthe RNA polymerase which, in turn, could be activated bysome signal dependent on growth rate.

Expression levels driven by the 1.8 kb EcoRI-HindIllfragment, which lacks the ftsQlp gearbox promoter andcontains only part of theftsZ promoter region, have also beenshown to be inversely dependent on growth rate (Dewar etal., 1989), although to a much lesser extent than that obtainedfrom ftsQJ. Unfortunately, their study made use of a

transcriptional fusion to lacZ in a lambda vector (XJFL100)that even lacks suitable transcription terminators immediatelyupstream from the cloned fragment being analyzed fortranscriptional activity, which is not the case in the presentresults (Simons et al., 1987). Nonetheless, we have observedthat expression levels driven by the whole ftsZ promoterregion are induced as well during a growth phase transition(Aldea et al., 1989). On the other hand, expression drivenby the ftsZ promoter region has been found to be partiallyrepressed by DnaA (Masters et al., 1989) and, as DnaAconcentration increases at higher growth rates (Chiaremelloand Zyskind, 1989), the inverse growth rate dependenceattributed to the ftsZ promoter region (such as in XTGV3,Aldea et al., 1989) could be due to a superimposedmechanism depending on DnaA. Moreover, promoterftsZlp(Table II) contains a sequence similar to the consensus DnaAbox (Fuller et al., 1984) and shows a very high homologyparticularly to the DnaA box responsible for autoregulationin the dnaA promoter region (Braun et al., 1985). Thissequence is located in the non-coding strand and overlapswith the mRNA start point offtsZlp. As the DnaA proteinis able to cause transcription termination when the DnaAbox is in the non-coding strand (Messer et al., 1988), DnaAassociated with the putative DnaA box in ftsZlp couldblock transcription initiation from this promoter and cause

3792

Table m. Expression levels from bolA mutated promoters

Promoter -10 region Phage Exp Sta E, S, SEr

bolAlp CGGCTAGTA XMAV103 35 596 1.0 1.0 17.1bolAlpl CGTATAATA XMAV104 457 530 13.1 0.9 1.2bolAlp2 CCCCTAGTA XMAV106 10 31 0.3 0.05 3.1

Exponential (Exp) and stationary (Sta) cultures of RYCIO00lysogenized with phages carrying transcriptional fusions of listedpromoters to lacZ were grown in LB and assayed for f-galactosidaseactivity as described in Materials and methods. Substituted bases inmutated promoters are underlined. Values given are the average offour independent assays and coefficients of variation were always<0.1. Ratios for exponential (Er) and stationary (Sr) levels are inreference to the wild-type bolAlp promoter. Ratios (SEr) of stationarylevels to exponential levels are given for each promoter.

termination of transcription originated at the other promoterslocated further upstream. The fact that we do not detect anyclear growth rate dependence in any of the ftsZ promotersby SI nuclease analysis may be due to the required use ofhigh copy number plasmids as RNA sources, where controlby DnaA could be not as effective as in single copy vectors.The DnaA protein has been shown to be the main factorcontributing to the so-called initiation mass parameter ofE.coli (Lobner-Olesen et al., 1989), so that replicationinitiation depends on DnaA concentration. If DnaA were ableto fine-tune expression in the ftsQAZ cluster as well,chromosome replication and cell division could share acommon regulatory mechanism.

Transcription levels driven by theftsQ and bolA promoterregions closely follow what would be expected for geneproducts that are expressed at a constant amount per cellwhen considering that cell size relates exponentially togrowth rate increases. How a more or less strong dependenceon growth rate is attained could be due to intrinsic propertiesof each gearbox promoter and, more likely, to distinctcombinations of gearbox and growth rate independentpromoters in a transcriptional unit, as exemplified by thecombination of these two classes of promoters in the ftsQand bolA promoter regions.TheftsQAZ gene products are essential at different stages

of cell division (Donachie et al., 1984). A 4-fold increasein FtsZ causes a 2-fold increase in division frequency, which

Promoter

Gearbox promoters

ftsQlpbolAlpmcbpConsensus

Spacing Distanceto ORF

ftsQ2pftsZlpftsZ2pftsZ3pftsZ4pConsensus

Control of cell division genes by gearboxes

.' zoo-

%A 100-tc0 / bo/Alp

0 50o s

c= 20 -

100 1 2 3 4 5

time (hours)

Fig. 8. The -10 region of the gearbox bolAlp is essential for inversegrowth rate dependence. RYC1000 lysogenized with phages carryingtranscriptional fusions to lacZ listed in Table III was grown in LB andcultures were allowed to reach the stationary phase of growth (panelA). Panel (B) shows transcription levels produced by the wild-typepromoter bolAlp (open squares), and mutated promoters bolAlpi(open circles) and bolAlp2 (open triangles) analyzed by measuring,B-galactosidase activity as described in Materials and methods.

leads to minicell production (Ward and Lutkenhaus, 1985),and is able to suppress lethal effects of overexpression ofthe minCD gene products (Lutkenhaus, 1990), the celldivision inhibitors (de Boer et al., 1989). Spherical mureinin normal cells is only produced at the septum during celldivision and, on the other hand, overexpression of bolAproduces anftsZ-dependent spherical morphology (Aldea etal., 1988b), perhaps by promoting a delocalization of theplaces active in transversal growth; in accordance with thisinterpretation, bolA, ftsQ, A and Z when overexpressedtogether, can produce an excess of septation sites that arenot limited to the cell poles (this laboratory, unpublishedresults). If regulated expression of the ftsQAZ cluster andthe bolA gene is to play a role in cell division regulation,synthesis of the encoded gene products should comply withseptal requirements relative to all other components of thecell. Our results indicate that gearbox promoters play a rolein this regulation by keeping the ftsQAZ and bolA geneproducts at stoichiometric levels with respect to the cellseptum.

Materials and methods

Bacterial strains, growth media and enzyme assaysAll strains used were E.coli K- 12. Strains MC 1061 [araD139, A(ara-leu)7697, A(lac) X74, galU, galK, straA; R.L.Gourse] and RYC1000 [araD139,

A(lac) U169, rpsL, relA, thiaA, recA56; F.Moreno] were used to test(-galactosidase activities produced by transcriptional fusions to lacZ inplasmid and lambda vectors. JM103 [supE, thi, sbcB15, rpsL, endrA,A(lac-proAB), F' (traD36, proAB +, lacPqZAM15); Messing et al., 1977]was employed for growth of M13 derivatives. W3110 and W3110transformed with pZAQ (a pBR322 derivative plasmid that contains the wholeftsQAZ cluster; Ward and Lutkenhaus, 1985) were used to quantify FtsAand FtsZ by immunological methods. Luria broth and Luria agar weresupplemented with antibiotics when required (50 tg/ml ampicdilin, 50 Agg/mlkanamycin, 20 1g/ml tetracycline, 20 &g/ml chloramphenicol). The M9medium (Miller, 1972) was supplemented with various carbon sources (0.4%glucose plus 1% casamino acids, 0.4% glucose, 0.4% glycerol or 0.4%sodium acetate), the required amino acids (50 ug/ml) and vitamins (2 )Xg/ml)to obtain different growth rates. ,B-Galactosidase activity was measured bythe method of Miller (1972) with modifications described by Masters etal. (1989). All ,B-galactosidase activities are referred to cell density andexpressed as Miller units.

DNA isolation and cloning techniquesRestriction endonucleases, calf intestine alkaline phosphatase, RNase-freeDNase, T4 DNA ligase, S1 nuclease and the Klenow fragment of DNApolymerase I (PolIK) were purchased from Boehringer Mannheim and usedaccording to the manufacturers' instructions. RNase A and lysozyme werepurchased from Sigma Chemical Co. Agarose (Pronarose Type D-2) wasa gift from Hispanagar S.A. Mutagenic and primer oligonucleotides weresynthesized in a Gene Assembler Plus (Pharmacia). Plasmid DNA isolations,cloning techniques and transformation procedures were done as describedby Maniatis et al. (1982).

Construction of transcriptional fusionsTranscriptional fusions to lacZ were constructed by using the high copynumber (pRS550) and single copy (XRS45) vectors developed by Simonset al. (1987), which contain four copies of a strong growth transcriptionalterminator upstream from the cloning sites. Plasmid pMAV 103 containsthe bolAlp promoter in a 225 bp SspI-PvuI fragment cloned into the EcoRIsite of pRS550. Plasmid pTGV13 contains the ftsQ promoter region in a0.7 kb PstI-EcoRI fragment cloned into pRS550 digested with BamHI andEcoRI. In both cases protruding ends were made blunt with PolIK priorto ligation. These transcriptional fusions were subsequently transferred tothe single copy vector XRS45 by a double recombination event and theresulting recombinants, XMAV103 and XTGV13 (Figure 1), werelysogenized into RYC1000. Testing for monolysogens was done asrecommended by Simons et al. (1987). The transcriptional fusion of thetwo bolA promoters to lacZ carried by pMAK400 and XMAK400 has alreadybeen described (Aldea et al., 1989).

DNA sequencing, oligonucleotide-directed mutagenesis andpromoter mappingDNA sequencing was done by using the Sequenase v 2.0 kit from UnitedStates Biochemcal Co. following the instructions supplied by themanufacturer. [35S]dATP (> 1000 Ci/mmol) was purchased fromAmersham. Point mutations in the bolAlp promoter were obtained byoligonucleotide-directed mutagenesis as described by Kunkel (1985) usingM13MAV4 as template. M13MAV4 was constructed by cloning the 230 bpBamHI-EcoRI fragment from pMAV103 containing the bolAlp promoterinto M13mpl9 digested with BamHI and EcoIR. The mutated promotersobtained were cloned back into the transcriptional fusion vector pRS550and transferred7to XRS45 as described above. Total RNA was isolated aspreviously described (Aldea et al., 1989) from strain MC1061 transformedwith plasmids pTGV13 (see above), pTGV14, pTGV16 or pTGV17 (Figure1). Plasmid pTGV14 contains the whole ftsQ and ftsA genes in a 3.0 kbPstI-EcoRI cloned into pRS550 digested with BamHI and EcoRI. PlasmidpTGV16 contains the putative regulatory regions immediately upstream fromftsA in a 1.0 kb EcoRI-PvuI fragment cloned into the EcoRI site ofpRS55O.Plasmid pTGV17 contains the promoter region of ftsZ in a 1.2 kbPvuII-EcoRI fragment cloned into the EcoRI site of pRS550. Protrudingends were made blunt with PolIK prior to ligation and orientations werechosen so that transcriptional fusions of the ftsQAZ genes to lacZ wereobtained. The promoter mapping method has already been described (Aldeaet al., 1988a). Sodium trichloroacetate was purchased from Merck. Primersand M13 derivatives used for synthesizing the DNA probes and sequencingladders are indicated in Figure 1. M13MAV1 carries a 0.8 kb PstI-BamHIfragment cloned into M13mpl9 digested with PstI and BamHI. M13MAV2contains a 1.0 kb EcoRl-PvuII fragment cloned into the EcoRI and HincHsites of M13mpl8. M13MAV3 contains a 1.2 kb Pvull-EcoRI fragmentcloned into the HincII and EcoRI sites of Ml3mpl9. Transcription start

3793

M.Aldea et al.

points were corrected taking into account that SI removes 2-3 additional Towbin,H., Staehelin,T. and Gordon,J. (1979) Proc. Natl. Acad. Sci. USA,bases from the DNA probe in the DNA-RNA hybrid (Aldea et al., 1988a). 76, 4350-4354.

Wanner,B.L., Kodaira,R. and Neidhardt,F.C. (1977) J. Bacteriol., 130,Immunoblotting procedures 212 -222.Total proteins electrophoresed on a 10% SDS-polyacrylamide gel were Ward,J.E. and Lutkenhaus,J.F. (1985) Cell, 42, 941-949.electrophoretically transferred to Immobilon membranes (Millipore) as Yi,Q.-M., Rockenbach,S., Ward,J.E. and Lutkenhaus,J.F. (1985) J. Mol.described (Towbin et al., 1979). FtsZ and FtsA were detected by indirect Biol., 184, 399-412.immunostaining using rabbit polyclonal antisera against FtsZ or FtsA, MVJ4and MVJ1 respectively, using protein A-horseradish peroxidase conjugate Received on July 2, 1990; revised on August 10, 1990and 4-chloro-1-naphthol as substrate. Quantification of bands was done bydensitometry on positive films. Purification of FtsZ and FtsA and isolationof antisera will be described elsewhere.

AcknowledgementsWe thank Pilar Palacios and Pilar Zaragoza for technical assistance. Wealso thank Antonio Tormo and Felipe Moreno for helpful discussions, andMiguel Angel Penalva for critical comments on the manuscript. This workwas supported by grant B1088-0251-C03-02 from Comisi6n Interministerialde Ciencia y Tecnologia to M.V. M.A., J.P. and T.G. acknowledgefellowships from the Spanish Government, C.S.I.C. and CommunidadAut6noma de Madrid respectively.

ReferencesAldea,M., Claverie-Martin,F., Diaz-Torres,M. and Kushner,S.R. (1988a)

Gene, 65, 100-110.Aldea,M., Hernindez-Chico,C., de la Campa,A.G., Kushner,S.R., and

Vicente,M. (1988b) J. Bacteriol., 170, 5169-5176.Aldea,M., Garrido,T., Hernandez-Chico,C., Vicente,M. and Kushner,S.R.

(1989) EMBO J., 8, 3923-3931.Begg,K.J., Hatfull,G.F. and Donachie,W.D. (1980) J. Bacteriol., 144,435-437.

Braun.R.E., O'Day,K. and Wright,A. (1985) Cell, 40, 159-169.Chiaramello,A.E. and Zyskind,J.W. (1989) J. Bacteriol., 171, 4272-4280.Connell,N., Han,Z., Moreno,F. and Kolter,R. (1987) Mol. Microbiol., 1,

195-210.de Boer,P.A.J., Crossely,R.E. and Rothfield,R.I. (1989) Cell, 56, 641-649.Dewar,S.J., Kagan-Zur,V., Begg,K.J. and Donachie,W.D. (1989) Mol.

Microbiol., 3, 1371-1377.Donachie,W.D., Begg,K.J. and Sullivan,N.F. (1984) In Losick,J. and

Shapiro,L. (eds), Microbial Development. Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, NY, pp. 27-62.

Fuller,R.S., Funnell,B.E. and Kornberg,A. (1984) Cell, 38, 889-900.Gourse,R.L., de Boer,H.A. and Nomura,M. (1986) Cell, 44, 197-205.Harley,C.B. and Reynolds,R.P. (1987) Nucleic Acids Res., 15, 2343-2361.Jones,C.A. and Holland,I.B. (1984) EMBO J., 3, 1181-1186.Kunkel,T.A. (1985) Proc. Natl. Acad. Sci. USA, 82, 488-492.Lin,C.S. and Bremer,H. (1986) Mol. Gen. Genet., 203, 143-149.Lobner-Olesen,A., Skarstad,K., Hansen,F.G., von Meyenburg,K. and

Boye,E. (1989) Cell, 57, 881-889.Lutkenhaus,J.F. (1983) J. Bacteriol., 154, 1339-1346.Lutkenhaus,J.F. (1990) Trends Genet., 6, 22-25.Maniatis,T., Fritsch,E.F. and Sambrook,J. (1992) Molecular Cloning: A

Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY.

Masters,M., Paterson,T., Popplewell,A.G., Owen-Hughes,T., Pringle,J.H.and Begg,K.J. (1989) Mol. Gen. Genet., 216, 475-483.

Messer,W.. Seufert,W., Schaefer,C., Gielow,A., Hartmann,H. andWende,M. (1988) Biochim. Biophys. Acta, 951, 351-358.

Messing,J., Gronenborn,B., Muller-Hill,B. and Hofschneider,P.H. (1977)Proc. Natl. Acad. Sci. USA, 74, 3642-3646.

Miller,J.H. (1972) Experiments in Molecular Genetics. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

Nanninga,A. and Woldringh,C.L. (1985) In Nanninga,N. (ed.), MolecularCytology of Escherichia coli. Academic Press, London, pp. 259-3 18.

Robinson,A,C., Kenan,D.J., Hatfull,G.F., Sullivan,N.F., Spiegelberg,R.and Donachie,W.D. (1984) J. Bacteriol., 160, 546-555.

Robinson,A.C., Kenan,D.J., Sweeney,J. and Donachie,W.D. (1986) J.Bacteriol., 167, 809-817.

Simons,R.W., Houman,F. and Kleckner,N. (1987) Gene, 53, 85-96.Tormo,A. and Vicente,M. (1984) J. Bacteriol., 157, 779-784.Tormo,A., Dopazo,A., de la Campa,A.G., Aldea,M. and Vicente,M. (1985)

J. Bacteriol., 164, 950-953.Tormo,A., Ayala,J.A., de Pedro,M.A., Aldea,M. and Vicente,M. (1986)

J. Bacteriol., 166, 985-992.

3794