16
1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding Its use on marine plants & marine extracts Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 &

DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

  • Upload
    others

  • View
    5

  • Download
    0

Embed Size (px)

Citation preview

Page 1: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

DNA Barcoding Its use on marine plants & marine extracts

Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

&

Page 2: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

2 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

&

1 > PRESENTATION • BiotechMarine • DNA Gensee & its « DNA barcoding technology & protocol »

2 > DNA BARCODING ON CRITHMUM MARITIMUM

• Presentation of Crithmum Maritimum • DNA results on Crithmum Maritimum • Conclusions

3 > DNA BARCODING ON NATIVE ESSENCETM, AN EXTRACT OF CRITHMUM MARITIMUM

• Presentation of NATIVE ESSENCETM

• DNA results on NATIVE ESSENCETM

4 > CONCLUSIONS & PERSPECTIVES

Agenda

Page 3: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

3 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

Air Liquide World leader in gases, technologies and services for Industry & Health SEPPIC is a designer of specialty ingredients for Health & Beauty care BiotechMarine is one of the world leading specialist in high-tech bioactive natural substances extracted from macroalgae & halophyte plants

BiotechMarine An affiliate of the group SEPPIC (AIR LIQUIDE)

1

Page 4: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

4 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

Our values are focused on innovation, safety,

efficiency, sustainable development &

preservation of Biodiversity

Approximately 40 employees, 25% of whom in R&D

85% of turnover

for export

• A subsidiary of SEPPIC since 1 January 2013, BiotechMarine is specialised in high-tech bioactive natural substances extracted from seaweed & marine plants. • Established since 1988, on the northern coast of Brittany (France), near the Bréhat Archipelago, the company's expertise in cutting edge marine active substances is recognized worldwide. • BiotechMarine offers a range of 80 active substances, extracts, seaweed & plant stem cells, intended for cosmetic & capillary care products.

BiotechMarine Company presentation 1

Page 5: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

5 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

DNA Gensee Company presentation 1

• DNA Gensee is a biotechnological laboratory, providing analytical services for plant and/or algae care products. • DNA Gensee uses an innovative technology based on plant/algae DNA analysis: DNA barcoding. Its patented genetic tools make blind authentification on plants/algae and product possible. Its values are focused on safety & naturalness of natural extracts & products. • Created in 2012 in Savoy (France), its application domains are Cosmetics & Fragrances, Nutraceuticals & Health products.

Each plant has a unique genetic signature

A very high tech equipment

A specific & unique know-how

Page 6: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

6 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

DNA Gensee DNA Barcoding technology 1

ATCGGCTTTTAACGTGAACCTG

Genetic marker = a variable zone

in size & sequence

Species 1: ATTCGGATT Species 2: ATCCGAGGTAA

DNA sequence: a succession of nucleotides

Primers = very conserved

zones

Page 7: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

7 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

1 DNA Gensee Barcoding technology: process

SAMPLE RECEIVING

SEQUENCING

AMPLIFICATION DETECTION

GENETIC MARKER AMPLIFICATION

BIOINFORMATIC ANALYSIS

DNA EXTRACTION

Reagent

DNA DNA

PCR

BOTANICAL IDENTIFICATION

Page 8: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

8 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

&

• Aromatic medicinal plant of the ombellifareae class found in coastal areas. • High resistance to spindrift, extreme salt concentrations, UV exposure, temperature variations & strong winds thanks to its hydrophobic molecules.

8

Crithmum Maritimum, also known as“Sea Fennel”, grows on Brittany seashore

CRITHMUM MARITIMUM Presentation of the plant

2

Page 9: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

9 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

&

• The genetic sequences of the 4 markers are perfectly identical for the 2 batches

• The 4 markers assign both batches to the species Crithmum maritimum

9

DNA BARCODING Results on Crithmum Maritimum

2

Page 10: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

10 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

&

DNA barcoding is powerfull tool to:

• identify the plant of interest & determine its genetic signature

• check the genetic divergence between 2 batches of the same species…

… and then > validate a new supplier of marine plants or algae > determine the geographical origin > make sure the claimed plant or algae is the one that has been delivered

10

CONCLUSIONS ON DNA BARCODING /Crithmum Maritimum

2

Page 11: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

11 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

& PRESENTATION OF NATIVE ESSENCETM

An extract of Crithmum Maritimum

3

• Increases skin oxygen levels • Skin lipids protection &

regulation • Increases cell renewal • Improves skin complexion • Used on normal or sensitive skins

• Global skin care • Anti-aging • Skin lightening • Tired skin • Mature skin • Sensitive skin • Damaged skin

BENEFITS

APPLICATIONS

NATIVE ESSENCETM

A Sea Fennel oil extract, that reinforces the natural

barrier of the skin.

Page 12: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

12 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

& DNA BARCODING RESULTS ON NATIVE ESSENCETM

3

NATIVE ESSENCETM:

• Contains a significant genetic sequence (99.71%)

• This one presents 100% of identity with the sequence of Crithmum maritimum

Thus, Crithmum maritimum was able to be perfectly traced in the analyzed product.

Diagram of relative abundance of DNA of the botanical species contained in the extract Native Essence

Page 13: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

13 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

&

DNA barcoding on final a extract, therefore a transformed product , is a unique & powerfull tool to:

• demonstrate that a cosmetic extract has been made using the claimed plant (Crithmum maritimum in our case),

• identify possible contaminants,

• guarantee our customers & the final users that the product in the market effectively contains the claimed plant (giving confidence to the final user which is very important when we sell “premium products” like in our case).

4 CONCLUSIONS & PERSPECTIVES

Page 14: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

14 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

& 4 CONCLUSIONS & PERSPECTIVES

BiotechMarine applies now systematically a DNA barcoding test for any new raw material (algae or marine plants) supplier approval. We also run random testing on some regular suppliers.

We know that some cosmetics companies are now also using this Hi-tech technology to determine in their finished products (cream...) the presence of a plant or algae extract validation of their marketing claims.

It also demonstrates ethical values of the company & strongly helps to bring confidence to our customers.

When we start a R&D project we define the DNA “identity card” of the raw material to make sure we will be using systematically the same raw material.

Page 15: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

Thank you for your attention

& G. LE CALVEZ BiotechMarine Z.I. - B.P. 72 22260 Pontrieux (FR) Tel : +33 (0)2 96 95 31 32

N. GIRAUD DNA Gensee 17 rue du Lac St André, 73370 Le Bourget du Lac (FR) Tel : +33 (0)4 79 84 72 16

Page 16: DNA Barcoding - Station Marine de Concarneau...1 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016 DNA Barcoding . Its use on marine plants & marine extracts . Les rendez-vous

16 Les rendez-vous de Concarneau – G. Le Calvez – 30 09 2016

Contacts

Nota The analytical specifications warranted are only those mentioned on the certificate of analysis supplied with each delivery of the product. Except as set forth above, SEPPIC* makes no warranties, whether express, implied or statutory, as to the product which is the subject of this document. Without limiting the generality of the foregoing, SEPPIC* makes no warranty of merchantability of the product or of the fitness of the product for any particular purpose. Buyer assumes all risk and liability resulting from the use or sale of the product, whether singly or in combination with other goods. The information set forth herein is furnished free of charge and is based on technical data that SEPPIC* believes to be reliable. It is intended for use by persons having technical skill and at their own discretion and risk. Since conditions of use are outside SEPPIC*'s control, SEPPIC* makes no warranties, express or implied, and assumes no liability in connection with any use of this information. Nothing herein is to be taken as a license to operate under or a recommendation to infringe any patents.

* SEPPIC being:

SEPPIC S.A. 22 Terrasse Bellini 92806 Puteaux FRANCE Tel. : +33 (0)1 42 91 40 00 [email protected]

SEPPIC Castres 27, chemin de la poudrerie – BP 90128 81105 CASTRES CEDEX FRANCE Tél. +33 (0)5 63 72 69 69 Fax. +33 (0)5 63 72 69 70

BiotechMarine Zone Industrielle B.P. 72 22260 Pontrieux FRANCE Tel : +33 (0)2 96 95 31 32 [email protected]

Head Office 75, quai d'Orsay 75007 Paris FRANCE

USA - SEPPIC Inc. 30, Two Bridges Road, suite 210 Fairfield, New Jersey 07004-1530 USA Tel. : +1 973 882 5597 [email protected]

SINGAPORE - SEPPIC Asia Singapore 3 HarbourFront Place # 09 – 04 HarbourFront Tower Two Singapore 099254 P.O. Box 54638 SINGAPORE Tel : +65 6278 6711 [email protected]

JAPAN - SEPPIC Japan Office Air Liquide Japan's office Granpark Tower 3-4-1 Shibaura Minato-ku, Tokyo 108-8509 JAPAN Tel : +81 3 6414 6725 [email protected]

CHINA - SEPPIC China Room 2909 Nan Zheng Building 580 West Nan Jing Road Shanghai 200041 CHINA Tel : +86 (21) 64 66 01 49 [email protected]

POLAND - SEPPIC Poland Office CCIF Ul. Widok 8 00-023 Varsovie POLAND Tel : +48 22 690 68 73 [email protected]

DUBAI - SEPPIC Dubai East Wing 5, Block-A, 3rd Floor Dubai Airport Free Zone UNITED ARAB EMIRATES Tel : +971 (0) 4 205 5443 [email protected]

Air Liquide India Holding Pvt Ltd O2 Commercial Twin Tower B/1304, Asha Nagar Road Mulund (W) Mumbai 400080 INDIA Tel : + 91 22 61046464 [email protected]

BRASIL - SEPPIC Brasil Alameda Santos 745/ cj 72 / 7ºfloor Cerqueira Cesar 01419-001 São Paulo – SP BRAZIL Tel : +55 11 3242 3911 [email protected]

GERMANY - SEPPIC Gmbh Martinstrasse 16-20 50667 Köln GERMANY Tel : +49 (0)221-888824-0 [email protected]

ITALIA - SEPPIC Italia Srl Via Quarenghi 27 20151 Milano ITALY Tel : +39 02 38009110 [email protected]

COLOMBIA - SEPPIC Colombia SAS Calle 71 n°10-40 Edificio Orbe 71 of 401 Bogota COLOMBIA Tel : +571 702 44 48 [email protected]