Slide 1

DNA BASED CRYPTOGRAPHY AND AUTHENTICATION SYSTEMProject Guide : Mrs.Thasleena V

Presented By :GROUP 1

ABDUL RASHEED (CEALEIT002)

1

INTRODUCTION

Data security and cryptography are important aspects of conventional computing.The aim of our project is to design DNA based cryptography and authentication which is a novel approach to ensure highly secure environment for transmission of data across networks.

2

3Cryptography is the process of scrambling the original text by rearranging and substituting the original text, arranging it in a seemingly unreadable format for others. Two types of cryptography are:Symmetric encryptionSymmetric encryption is a single key encryption and also known as conventional encryption. The symmetric encryption algorithm generally uses the same key for encryption and decryption.Asymmetric encryptionAsymmetric encryption is also known as Public key encryption. In asymmetric encryption, the encryption and decryption will be done by two different keys.

LITERATURE SURVEY

4

DNA cryptography is First introduced by L. Adleman in 1990s in which Plaintext message Encoded into DNA sequences.

DNA sequence : Orderofnucleotidebasesin theDNAmolecule. ATTAGCCTTATGCATGAACC

Gehani et. al., introduced the first trial of DNA based Cryptography in which a substitution method using libraries of distinct one time pads, each of which defines a specific, randomly generated, pair-wise mapping and an XOR scheme utilizing molecular computation and indexed, random key strings are used for encryption .

LITERATURE SURVEY (Cont.)

5

Leier et. al. presented two different cryptographic approaches based on DNA binary strands with the idea that a potential interceptor cannot distinguish between dummies and message strand . The first approach hid information in DNA binary strands and the second designed a molecular checksum.Decryption is done using PCR and subsequent gel electrophoresis.LITERATURE SURVEY (Cont.)

6

SURVEY COMPARISON REPORTS.NoMETHODSADVANTAGEDISADVANTAGE1DNA based implementation of YAEA encryption algorithm[2006]Real message is not transferred over network.Scalable for large digital information products.Size of plain text increases the encryption and decryption time.2DNA encryption based on matrix manipulation.[2008]Always get new cipher data from same plain text.It include only basic operation and security only depends on key.3Encryption scheme using DNA technology.[2008]Prevent attack from a possible word as PCR primers.Cost of encryption is low.Security can depend only on decryption key.

7

Jin-Shiuh Taur Proposed a way referred to as Table Lookup Substitution methodology (TLSM) that might double the capability of message activity. The key plan of the TLSM is to increase the 1-bit complementary rule into a 2-bit rule table so every conversion of letters will represent 2 bits of the secret message.

Cheng Guo, Shiu Proposed the hiding procedure substitutes another letter for an existing letter on a special location set by the algorithm. The embedding algorithm encompasses a conversion operates that converts a given letter with a selected letter outlined by the complementary rule.

EXISTING SYSTEM

8Kritika Gupta and Shailendra Singh Projected a DNA Based Cryptological Techniques for an encryption algorithm based on OTP (one-time-pad) that involve data encryption using traditional mathematical operations and/or data manipulating DNA techniques.

Guangzhao Cui, Limin Qin, Yanfeng Wang, Xuncai Zhang Proposed a secrete writing theme by exploitation the technologies of DNA synthesis, PCR amplification and DNA digital secrete writingEXISTING SYSTEM (Cont.)

PROPOSED SYSTEM9This project aims at providing an efficient solution for secured data transmission both across a local area network and also via internet.The advantages of the proposed system are:Unbreakable security by taking the advantage of DNA based encryption.Double layer of encryption implementing RSA algorithm along with DNA based cryptography.The type of data which we consider includes:Message send across a LANE-mail using Gmail serverAll types of file encryption

10The binary data, text or image, is used under the form of ASCII code . These numbers are then grouped in blocks and encrypted in using a traditional method (eg. DES, will form a 2 level encryption). This encoded message is then changed to binary format. Then these digits are grouped into two and substituted as A for 00, T for 01, G for 10, and C for 11. We then fit the primers on either side of this message. Primers will act as stoppers and detectors for the message. This has to be given to the receiver prior to the communication. This message is followed by our own DNA sequence followed by another stopper/primer. This message is then flanked by many sequences of DNA or by confining it to a microdot in the micro- array. PROPOSED SYSTEM (Cont.)

MODULES IN THE SYSTEM11User registration.It deals with the user interactions. A user has to create his own account to use the software. He is asked to enter certain details that would be stored into a database. When he tries to login, the verification process is done to provide access.Message service.This service is provided to the authenticated user. He can send and receive messages across the connected LAN. Whether to encrypt the text or not must be decided by the user. The input given by the user is just the recipient address, subject and the message text. It will be sent to the corresponding user connected within the LAN.Email service.This module deals with services related to sending and receiving of mails. User has to configure the mail settings by defining the incoming and outgoing mail servers.

MODULES IN THE SYSTEM12EncryptionThe process of DNA encryption is explained here. The plaintext is sent to the encryption process and it is lead through a no: of steps to produce the DNA encrypted form.DecryptionHere the process of encryption is just reversed to retrieve the plain text. The encrypted ambiguity sequence is first encrypted using RSA to retrieve the real key sequence. Then, using this key the amino sequence is decrypted to get the ATGC sequence. This is converted to binary, then corresponding ASCII values are taken and finally, the plaintext is retrieved.

Hardware and Software Requirements13Hardware RequirementsProcessor - Intel Pentium IV or aboveRAM - 512 MB or aboveHard Disk Drive - 40GB or above

Software RequirementsOperating System - Windows XP or aboveIDE Net Beans version 6.9.1 or aboveDatabase - MySQL Database Server 4.0 or aboveProgramming Language Java

DATA FLOW DIAGRAMUser Registration

14

DATA FLOW DIAGRAM(Cont.)Messaging Service

15

DATA FLOW DIAGRAM(Cont.)16Mail Service

DATA FLOW DIAGRAM(Cont.)17File Encryption

DATA FLOW DIAGRAM(Cont.)18File Decryption

SCREENSHOTS19

20

SCREENSHOTS

21

SCREENSHOTS

22

SCREENSHOTS

23

SCREENSHOTS

CONCLUSION24

Message encryption using DNA sequence is a very new technique still evolving and tried out for secure transmission and reception of hidden messages.Provide Authentication property using Digital Signature .Add function that will detect Modification of message.

25

RS Dhawan and Alice(2012). A new DNA Encryption technique for secure data transmission. Research Scholar , Kurukshetera University, Haryana, India.Guangzhao Cui , Cuiling Li , Haobin Li , Xiaoguang Li (2009). DNA computing and its application to information security field. Research ScholarHenan key Lab of information-based Electrical Application , Zhengzhou 450002.Pankaj Rakheja(2012). Integrating DNA computing in international data encryption Algorithm(IDEA). Deep Institute of Engineering and Technology, Haryana, India.Abdullah Al Mueen & Md. Nurul Amin Applications of Graphs in Bioinformatics pp.16-50, 2006

REFERENCES

THANK YOU26