Upload
martin-charles
View
214
Download
0
Tags:
Embed Size (px)
Citation preview
DNA Fingerprinting
Class 832
LEGO Model of DNA•DNA is a molecule in your body.
•It is a code, which stores instructions for building the “machines” in your body.
•It is a double helix.
•It is a millionth of a millimeter wide.
•In humans, a molecule of DNA is 200,000,000 bases long.
DNA is a Code
GGAAAACTAACCCTTTTGATTG
•The genetic code is written in A’s, T’s, C’s and G’s.
•The sequence of A’s, T’s, C’s and G’s uniquely identifies a person, unless they are a twin.
•That’s why it’s called DNA fingerprinting.
Restriction Enzymes are Molecules that Cut DNA at
Particular “Words”
Restriction Enzyme Cuts Yield Different Sized DNA Fragments
GGATGGCCTAA/TTCCGGTTAA/TTGGTACCGGATT/AAGGCCAATT/AA
11 10 2
Gel Electrophoresis is Used to Separate the Fragments Based on Size
Example DNA Fingerprint
•Column in Gel corresponds to a person’s DNA.
•It is called a person’s DNA fingerprint.
•Row corresponds to DNA fragment size.
Different People Have Different Restriction Enzyme Cut Sites
Resulting in different band patterns on a gel.
1 2
Resulting in different sized DNA fragments.
Who did it?
Solving a Murder Mystery Using
DNA Fingerprinting
Given crime scene DNA and suspect DNA you will construct a gel.
You will then analyze the gel to find a match between the crime scene DNA and a suspect’s DNA.
You will use this information to make inferences about the murders.
Solving Our Murder Mystery Using DNA
Fingerprinting