Upload
others
View
5
Download
0
Embed Size (px)
Citation preview
DNA methylation in colorectal cancer
Sophia Pei Woon Ang
BSc (Hons)
2009
This thesis is presented for the degree of Doctor of Philosophy
in the School of Surgery, University of Western Australia
Abstract
Abstract
De novo methylation of CpG islands in gene promoter regions is an alternative gene
silencing mechanism that contributes to the development and progression of colorectal
cancer (CRC). CRCs that exhibit widespread hypermethylation of gene promoters are
referred to as having the CpG island methylator phenotype (CIMP). To improve our
understanding of the CIMP+ subgroup of CRC, the first aim of this research was to
address one of the technical limitations of methylation analysis by developing a quality
control system for sample DNA (Chapter 3). A ridge-regression approach was then
devised in an attempt to identify CpG loci whose methylation status was predictive of
gene expression (Chapter 4). Comprehensive methylation profiling was used to further
characterise CRC based on unbiased analysis of DNA methylation levels (Chapter 5).
Finally, CIMP+ was evaluated in a large series of young CRC patients with the longer
term aim of identifying possible familial cases of this CRC subtype (Chapter 6).
A growing number of studies have shown that aberrant tumour DNA methylation may
represent a promising molecular diagnostic, prognostic and predictive marker. This has
generated the need for accurate quality control systems for the analysis of DNA
methylation in clinical specimens. An adequate amount of DNA after bisulfite treatment
and the subsequent availability of sufficient target molecules for PCR based methylation
analyses are critical for ensuring accurate quantification. In Chapter 3, experiments that
tested multiple extractions, processing, analytical methods and sample types were
conducted. These demonstrated that cycle threshold (Ct) value was superior to
spectrophotometric analysis for predicting the suitability of DNA for methylation
analyses. The potential benefits of this approach are improvements in the reproducibility
of methylation analysis and in sample management.
Abstract
Since DNA hypermethylation of promoter regions is involved in the transcriptional
regulation of many genes, it is widely used as a surrogate marker for gene expression.
However, most existing DNA methylation assays have not been correlated with
corresponding gene expression. In Chapter 4, a ridge-regression model was developed
with the aim of identifying CpG loci that were predictive of RNA levels for the RUNX3
and DPYD genes in CRC. The model was developed using methylation and RNA
expression data obtained in a panel of CRC cell lines. When tested in primary CRC, the
methylation status of the candidate CpG sites failed to predict RNA expression. These
findings suggest that quantitative and qualitative differences between training and
validation samples should be considered when constructing models for the prediction of
methylation-dependent RNA expression.
The use of an unbiased and comprehensive methylation profiling approach described in
Chapter 5 identified three CIMP subgroups in CRC associated with distinct
clinicopathological and molecular characteristics. BRAF and KRAS mutations were
positively associated with the CIMP-high subgroup, suggesting these genetic and
epigenetic events occur within the same CRC pathway. In addition to aberrant
hypermethylation, CIMP-high tumours also showed demethylation of a small proportion
of CpG sites in comparison to normal tissue. Although these findings require validation in
additional CRC cohorts, it is likely that genome-wide epigenetic and parallel gene
expression studies will help to identify the molecular alterations that underlie the major
CIMP subgroups.
While the majority of CIMP+ tumours arise in elderly patients, the study described in
Chapter 6 found that that 8% of CRC from young patients were also CIMP+. These
Abstract
tumours shared hallmark clinicopathological and molecular characteristics with CIMP+
tumours from elderly patients, including a high frequency of BRAF mutation. The
presentation of CIMP+ CRC in patients aged less than 60 years suggests a hereditary
component for some of these tumours, possibly involving hyperplastic polyposis or
serrated pathway syndromes. This issue requires further prospective studies involving
collection of more detailed information on family history of cancer and pathological
information on the serrated adenoma/hyperplastic morphologies.
Table of contents
Chapter 1. Introduction ............................................................................................ 1
1.1 COLORECTAL CANCER...................................................................................... 1
1.2 MOLECULAR PATHWAYS IN COLORECTAL CANCER ............................... 2
1.2.1 The chromosomal instability pathway................................................................. 3
1.2.2 Microsatellite instability pathway........................................................................ 3
1.2.3 Epigenetic instability in colorectal cancer ........................................................... 4
1.3 THE CpG ISLAND METHYLATOR PHENOTYPE (CIMP) ............................... 5
1.3.1 CIMP as a distinct CRC phenotype ..................................................................... 5
1.3.2 Clinical features of CIMP+ CRC......................................................................... 6
1.3.3 BRAF and KRAS mutations in CIMP+ CRC ....................................................... 7
1.3.4 Non-genetic risk factors for the development of CIMP+ CRC ........................... 8
1.3.5 Genetic risk factors for the development of CIMP+ CRC ................................ 11
1.3.6 The serrated adenoma pathway in the development of CIMP+ CRC ............... 12
1.3.7 Serrated pathway syndrome............................................................................... 13
1.3.8 Molecular mechanisms in the serrated pathway................................................ 14
1.4 HERITABILITY OF DNA METHYLATION...................................................... 15
1.5 DNA HYPOMETHYLATION IN COLORECTAL CANCER............................ 16
1.6 DNA METHYLTRANSFERASES....................................................................... 17
1.7 OTHER COMPONENTS OF THE EPIGENETIC MACHINERY...................... 18
1.8 DNA HYPERMETHYLATION IN CANCER AS A CLINICAL BIOMARKER
AND THERAPEUTIC TARGET.......................................................................... 20
1.9 AIMS OF THIS RESEARCH ............................................................................... 22
Chapter 2. Methods & Materials......................................................................... 25
2.1 CLINICAL SAMPLES AND CRC CELL LINES................................................ 25
2.1.1 Recruitment of Caucasian CRC patients ........................................................... 25
2.1.2 Recruitment of Asian CRC patients .................................................................. 25
2.1.3 Formalin-fixed and paraffin embedded CRC tissues......................................... 25
2.1.4 CRC cell lines .................................................................................................... 26
2.2 DNA EXTRACTION ............................................................................................ 27
2.2.1 DNA extraction from frozen tissues .................................................................. 27
2.2.2 DNA extraction from paraffin-embedded tissues.............................................. 27
2.2.3 DNA extraction from cell lines.......................................................................... 28
2.3 RNA EXTRACTION ............................................................................................ 28
2.3.1 RNA extraction from frozen tissues .................................................................. 28
2.3.2 RNA extraction from cell lines.......................................................................... 29
2.4 QUALITY CONTROL OF NUCLEIC ACIDS .................................................... 29
2.4.1 Quantitation and qualitative assessment of genomic DNA ............................... 29
2.4.2 Quantitative and qualitative assessment of total RNA ...................................... 30
2.5 QUANTITATION OF RNA EXPRESSION LEVELS ........................................ 30
2.6 SCREENING FOR KRAS MUTATION, BRAF MUTATION AND MSI ........... 31
2.6.1 Fluorescent-single strand conformational polymorphism (F-SSCP)................. 31
2.6.2 PCR amplification of KRAS, BRAF and BAT26 ............................................... 32
2.6.3 F-SSCP screening for KRAS mutations, BRAF mutations and MSI.................. 32
2.7 DNA METHYLATION ANALYSIS.................................................................... 33
2.7.1 Sodium bisulfite conversion of genomic DNA ................................................. 33
2.7.1.1 Sodium bisulfite conversion of genomic DNA (in-house protocol).................. 33
2.7.1.2 Sodium bisulfite conversion of genomic DNA (EZ-DNA Methylation kitTM) . 34
2.7.2 CpG Methyltransferase (M.SssI) treatment of DNA......................................... 34
2.7.3 Methylation-specific PCR (MSP)...................................................................... 35
2.7.4 MethyLight ........................................................................................................ 36
2.7.5 Pyrosequencing.................................................................................................. 38
2.7.6 Cloning and sequencing of bisulfite-treated DNA ............................................ 40
2.7.6.1 PCR for bisulfite-cloning and sequencing (bsSEQ) .......................................... 40
2.7.6.2 PCR product purification and ligation............................................................... 41
2.7.6.3 Transformation and selection of clones............................................................. 41
2.7.6.4 Sequencing of plasmid DNA............................................................................. 42
2.7.7 Methylation analysis using Goldengate array.................................................... 43
2.8 STATISTICAL ANALYSIS ................................................................................. 44
Chapter 3. An improved quality control for bisulfite-PCR based DNA
methylation analysis: cycle threshold value ...................................................... 45
3.1 BACKGROUND ......................................................................................................... 45
3.2 METHODS & MATERIALS...................................................................................... 46
3.3 RESULTS.................................................................................................................... 47
3.4 DISCUSSION.............................................................................................................. 51
Chapter 4. Identification of CpG sites in the RUNX3 and DPYD genes
associated with expression level............................................................................. 55
4.1 BACKGROUND ................................................................................................... 55
4.2 METHODS AND MATERIALS .......................................................................... 57
4.2.1 Sample processing and analyses............................................................................... 57
4.2.2 Identifying individual CpG sites correlated with RNA expression.......................... 57
4.2.3 Identifying multiple adjacent CpG sites correlated with RNA expression............... 57
4.2.4 Correlation between methylation at candidate expression-linked CpG sites and
RNA levels in primary tumours......................................................................... 58
4.3 RESULTS.............................................................................................................. 59
4.3.1 Methylation of CpG sites in the RUNX3 and DPYD promoters correlates with
RNA expression in CRC cell lines .................................................................... 59
4.3.2 Methylation at multiple adjacent CpG sites is poorly correlated to RNA levels
in CRC cell lines................................................................................................ 60
4.3.3 Expression-related CpG sites identified in CRC cell lines failed to predict RNA
expression in primary tumours .......................................................................... 60
4.4 DISCUSSION........................................................................................................ 65
Chapter 5. Comprehensive profiling of DNA methylation in colorectal
cancer reveals three subgroups with distinct clinicopathological and
molecular features ...................................................................................................... 68
5.1 BACKGROUND ................................................................................................... 68
5.2 METHODS AND MATERIALS .......................................................................... 70
5.2.1 Tissue samples ................................................................................................... 70
5.2.2 BRAF mutation, KRAS mutation and microsatellite instability......................... 70
5.2.3 MethyLight determination of CIMPW status ..................................................... 71
5.2.4 DNA methylation profiling using Illumina GoldenGate® methylation bead
array ................................................................................................................... 71
5.2.5 Statistical analysis.............................................................................................. 72
5.3 RESULTS.............................................................................................................. 73
5.3.1 DNA methylation patterns in normal and tumour tissue ................................... 73
5.3.2 CRC subgroups show distinctive clinicopathological and molecular features.. 74
5.3.3 Differentially methylated genes in CRC subgroups .......................................... 75
5.4 DISCUSSION........................................................................................................ 78
Chapter 6. BRAF mutation is associated with the CpG island
methylator phenotype in colorectal cancer from young patients .............. 82
6.1 BACKGROUND ................................................................................................... 82
6.2 METHODS AND MATERIALS .......................................................................... 83
6.3 RESULTS.............................................................................................................. 85
6.4 DISCUSSION........................................................................................................ 88
Chapter 7. GENERAL DISCUSSION............................................................... 93
7.1 Contribution of this work to the understanding of DNA methylation in CRC...... 93
7.2 DNA quality and methylation analysis.................................................................. 94
7.3 Identification of CpG loci whose methylation status correlates with gene
expression .............................................................................................................. 95
7.4 Comprehensive DNA methylation profiling to define CIMP ............................... 97
7.5 CIMP+ in early onset CRC.................................................................................. 100
7.6 Major Findings and Conclusions ............................................................................... 102
References.................................................................................................................... 104
Appendices .................................................................................................................. 117
List of abbreviations
ACF Aberrant crypt foci
ACTB beta-actin
ASO Allele-specific oligonucleotide
ATP Adenosyl-triphosphate
bsDNA Bisulfite DNA
bsSEQ Bisulfite-cloning and sequencing
cDNA Complementary DNA
CGIs CpG islands
CIMP CpG Island methylator phenotype
CIMP-H CIMP-high
CIMP-M CIMP-mid
CIMP-L CIMP-low
CIN Chromosomal instability
CRC Colorectal cancer
Ct Cycle threshold
EMVI Extramural invasion
FAP Familial adenomatous polyposis
FDR False discovery rate
FFPE Formalin-fixed and paraffin embedded
F-SSCP Fluorescent-single strand conformational polymorphism
GAPDH Glyceraldehyde-3-phosphate dehydrogenase
gDNA Genomic DNA
GSH Glutathione
HNPCC Hereditary non-polyposis colorectal cancer
HPP Hyperplastic polyposis
KNN K-nearest neighbour
LOH Loss of heterozygosity
LOI Loss of imprinting
LSO Locus-specific oligonucleotide
LVI Lymphovascular invasion
MAP MUTYH associated polyposis
MBD Methyl-domain binding proteins
MINTs Methylated in tumour markers
miRNA MicroRNA
MMR Mismatch repair
MSI Microsatellite instability
MSP Methylation-specific PCR
M.SssI CpG methyltransferase
PCA Principal component analysis
PMR Percentage of methylated reference
PNI Perineural invasion
PPi Inorganic pyrophosphate
PRC2 Polycomb repressive complex 2
PS Predictive score
QPCR Real-time PCR
ROC Receiver operating characteristics
RR Ridge regression
RT-PCR Reverse-transcriptase real-time PCR
SA serrated adenomas
SAM S-adenosylmethionine
SAH S-adenosylhomocysteine
SNP Single nucleotide polymorphisms
SPS Serrated pathway syndromes
THF Tetrahydrofolate
TILS Tumour-infiltrating lymphocytic response
5-FU 5-fluorouracil
� Ridge parameter
Acknowledgements
Sincere thanks are extended to all the many people who make completion of this PhD
thesis possible.
I am most grateful to my principal supervisor Prof. Barry Iacopetta for his invaluable
insights and constructive feedback throughout the candidature. His extensive knowledge
of colorectal cancer and his enthusiasm as an educator have introduced me to the breath
and variety of the field.
I am also grateful to my co-supervisor Assoc. Prof Richie Soong for his technical advice
and constant guidance. It was a great privilege to be given the opportunity to carry out
experimental works in his laboratory.
I would like to thank Dr. Agus Salim, Dr. Arief Gustnanto and Marie Loh for providing
their expertise in statistical analysis.
My sincere gratitudes are extended to Fabienne Grieu for her technical assistance,
continuous support and many good advices.
I thank Dr. Natalia Liem for her technical support and constant encouragement.
Many thanks also go out to the past and present members of Translational Interface,
Cancer Science Institute for their assistance and friendship.
I greatly appreciate the administrative personnels of the School of Surgery for their
assistance in many ways.
A special thanks to my family for their endless support and understanding.
Statement of candidate contribution
This thesis contains published work and/or work prepared for publication, some of which
has been co-authored. The bibliographical details of the work and where it appears in the
thesis are outlined below.
Chapter 3. Ang PW, Toh HB, Iacopetta B, Soong R. An improved quality control for
bisulfite-PCR-based DNA methylation analysis: cycle threshold value. Clin Chem Lab
Med. 2008; 46(8):1117-21.
PWA performed all experimental works using clinical samples, drafted the manuscript,
analysed and interpreted the data.
Chapter 5. Ang PW, Loh M, Liem N, Grieu F, Vaithilingham A, Platell C, Yong WP,
Iacopetta B, Soong R. Comprehensive profiling of DNA methylation in colorectal cancer
reveals three subgroups with distinct clinicopathological and molecular features.
Submitted for publication
PWA extracted DNA, performed molecular analyses, drafted the manuscript, and
interpreted the data.
Chapter 6. Ang PW, Li WQ, Soong R, Iacopetta B. BRAF mutation is associated with
the CpG island methylator phenotype in colorectal cancer from young patients. Cancer
Lett. 2009; 273(2):221-4.
PWA extracted DNA, performed DNA methylation analyses, drafted the manuscript,
analysed and interpreted the data.
__________________(candidate) _________________ (Principal supervisor) Sophia Pei Woon Ang Prof. Barry Iacopetta
Chapter 1 Introduction 1
Chapter 1. Introduction
1.1 COLORECTAL CANCER
Colorectal cancer (CRC) affects more than a million individuals annually and is the fourth
leading cause of cancer mortality worldwide (Jemal et al., 2009; Stewart and Kleihues,
2003). The incidence of CRC is higher in developed nations than in the developing world
(Jemal et al., 2009; Stewart and Kleihues, 2003). Disparities in the incidence and
mortality of CRC in different racial groups and regions are likely to be related to genetic
variability, environmental exposure, access to high-quality regular screening, timely
diagnosis and treatment (Weitz et al., 2005). CRC is largely a disease of old age with
80% of cases diagnosed in those aged 60 years or more. Although the majority of CRC
are sporadic, 5-10% of cases arising in young patients are associated with familial
disorders with an underlying genetic predisposition (Weitz et al., 2005). The three major
forms of hereditary CRC syndromes are familial adenomatous polyposis (FAP),
hereditary non-polyposis colorectal cancer (HNPCC, or Lynch syndrome) and MUTYH
associated polyposis (MAP). Identification of the genes responsible for these familial
syndromes has allowed the implementation of genetic testing in routine clinical practice
to determine predisposition to CRC. Nonetheless, FAP, HNPCC and MAP together
account for less than 5% of all CRC cases (Aaltonen et al., 2007). It is probable that a
significant proportion of sporadic CRC patients have inherited a combination of relatively
common, low-penetrance gene variants that contribute to CRC risk (Tenesa et al., 2008;
Tomlinson et al., 2008), as exemplified by variants on locus 8q24 (Haiman et al., 2007;
Tomlinson et al., 2007; Zanke et al., 2007). CRC is therefore likely to result from a
combination of environmental factors, germline factors, somatic mutations and epigenetic
changes. Unravelling the pathogenic mechanisms involved in CRC should allow the
Chapter 1 Introduction 2
development of a more robust, molecular-based classification of these tumours, as well as
suggesting more effective prevention strategies and treatments.
1.2 MOLECULAR PATHWAYS IN COLORECTAL CANCER
The evolution of normal colonic epithelial cells to adenocarcinoma is driven by the
progressive accumulation of genetic mutations and epigenetic alterations. Two
predominant forms of genomic instability have been elucidated in CRC, representing the
chromosomal instability (CIN) and microsatellite instability (MSI) pathways (Figure 1.1)
(Søreide et al., 2009). In addition to genomic instability, the CpG Island methylator
phenotype (CIMP) pathway has also been identified as a major etiological factor in the
pathogenesis of CRC due to the widespread inactivation of tumour suppressor genes
(Figure 1.1) (Issa, 2004; Søreide et al., 2009). Tumours arising from CIN and CIMP
pathways have varied molecular and clinicopathological features, as discussed below.
Figure 1.1 Molecular pathways in CRC. CIMP, CpG island methylator phenotype
(adapted from Søreide et al., 2009)
Intermediateadenoma
Normalmucosa
Earlyadenoma
Lateadenoma
Carcinoma
Hyperplasticpolyps
Serratedadenoma
Serratedadenoma
with dysplasia
Chromosomal instability pathwayGenetic alterations through chromosomal losses and gains
Deletion 5q
APC
Deletion 8p
KRAS
LOH 18q
DCC, SMAD4
LOH 17p
p53
�-catenin BAX, TCF4 IGFIIR, TGF�RII
Microsatellite instability pathwayGenetic alterations through defective mismatch repair proteins
Hypermethylator phenotype pathwayEpigenetic alterations through aberrant promoter hypermethylation
Inactivation ofMLH1 by mutation or hypermethylation
BRAF, KRASHypomethylation, hypermethylation CIMP hypermethylation
Intermediateadenoma
Normalmucosa
Earlyadenoma
Lateadenoma
Carcinoma
Hyperplasticpolyps
Serratedadenoma
Serratedadenoma
with dysplasia
Chromosomal instability pathwayGenetic alterations through chromosomal losses and gains
Deletion 5q
APC
Deletion 8p
KRAS
LOH 18q
DCC, SMAD4
LOH 17p
p53
�-catenin BAX, TCF4 IGFIIR, TGF�RII
Microsatellite instability pathwayGenetic alterations through defective mismatch repair proteins
Hypermethylator phenotype pathwayEpigenetic alterations through aberrant promoter hypermethylation
Inactivation ofMLH1 by mutation or hypermethylation
BRAF, KRASHypomethylation, hypermethylation CIMP hypermethylation
Chapter 1 Introduction 3
1.2.1 The Chromosomal instability pathway
The progression of aberrant crypt foci (ACF) to frank carcinoma with concurrent
sequential acquisition of molecular changes in FAP forms the paradigm for the CIN
pathway proposed by Fearon and Volgelstein (Fearon and Vogelstein, 1990). Mutations
to APC, TP53 and KRAS, and the loss of heterozygosity (LOH) at 18q and 17p confer
growth advantages to the altered cells (Fearon and Vogelstein, 1990). Following
successive waves of uncontrolled clonal expansion, acquisition of additional genetic
changes leads to the formation of histologically advanced neoplasms (Fearon and
Vogelstein, 1990). Aneuploidy, multiple chromosomal rearrangements and the
accumulation of somatic mutations are hallmarks of CIN tumours (Grady and Carethers,
2008; Søreide et al., 2009). Deregulation of the WNT pathway is responsible for the high
malignant potential of dysplastic ACF harbouring APC mutations (Grady and Carethers,
2008). Although about 85% of CRCs are characterised by the CIN phenotype, only a
small minority (~7%) carry all three KRAS, TP53 and APC mutations (Rodriguez et al.,
2006).
1.2.2 Microsatellite instability pathway
Approximately 15% of sporadic CRC and almost all tumours from individuals with
HNPCC arise through the MSI pathway (Imai and Yamamoto, 2008). Germline mutations
of mismatch repair (MMR) genes (MLH1, MSH2, MSH6 and PMS2) underlie the
development of MSI+ tumours in HNPCC, while methylation-induced silencing of MLH1
occurs in the majority of sporadic MSI+ CRC (Jass, 2007b; Søreide et al., 2009).
Although MSI+ tumours are usually near-diploid, they frequently accumulate small
deletions or insertions in short repetitive sequences contained with the coding region of
genes including TGF�RII (transforming growth factor � receptor II), IGF2R (insulin-like
growth factor 2 receptor) and BAX (BCL2-associated X protein). Repetitive sequences are
Chapter 1 Introduction 4
susceptible to slippage by strand misalignment during replication and thus inactivation of
the MMR system results in the propagation of mutations during subsequent cell division
(Söreide et al., 2006).
In sporadic CRC, the MSI+ phenotype is typically associated with poorly differentiated
tumours, strong peritumoural lymphocytic infiltration, older age, female gender and
proximal location in the colon (Söreide et al., 2006). Despite having aggressive tumour
features including larger (T3) primary tumour, poor differentiation and deep tumour
invasion, MSI+ CRC are thought to have better prognosis than MSI- CRC (Söreide et al.,
2006). The survival benefit gained by MSI+ CRC patients receiving 5-fluorouracil (5-FU)
treatment is equivocal due to inconsistent results reported across different studies
(Carethers et al., 2004; Elsaleh et al., 2001; Hemminki et al., 2000; Jover et al., 2006;
Kim et al., 2007; Popat et al., 2005; Ribic et al., 2003).
1.2.3 Epigenetic instability in colorectal cancer
Epigenetic instability represents an alternative mechanism to genomic instability for
driving CRC tumourigenesis. The term “epigenetics” was first coined by Conrad
Waddington to describe heritable phenotypic changes without alterations in the genetic
sequence (reviewed in Probst et al., 2009; Tost, 2009). The epigenetic machinery consists
of chromatin remodelling, histone modification, DNA methylation and non-coding RNA.
Epigenetic modifications superimposed on the genetic sequence dictate the eventual
phenotypic traits of a multicellular organism. DNA methylation modulates normal
development via effects on tissue-specific gene expression, X-chromosome inactivation,
genomic imprinting and suppression of parasitic repetitive elements in the genome.
Abnormal DNA methylation patterns in comparison to normal colonic mucosa are
frequently observed in CRC and form the topic of investigation of this thesis.
Chapter 1 Introduction 5
Methylation of DNA involves addition of a methyl-group from S-adenosylmethionine
(SAM) to the 5’-carbon of the cytosine ring in a CpG dinucleotide. The distribution of
CpGs in the genome is disproportionate, with dense clustering of the CpG sequence in
regions termed CpG islands (CGIs). CGIs are defined as genomic domains of more than
0.5kb in length with a ratio of observed CpG to expected CpG of >0.65 (Grønbaek et al.,
2007; Takai and Jones, 2002). Approximately 60% of all genes in the human genome
contain a CGI in the promoter. The number of methylated CpGs are under-represented in
the genome, accounting for only 1% of total nucleotides as a consequence of spontaneous
deamination of methylated cytosine to thymine during the course of evolution (Grønbaek
et al., 2007). Inactivation of gene transcription by methylation of CGIs with concomitant
histone modification and formation of heterochromatin is a common pathogenic
phenomenon in various malignancies.
1.3 THE CpG ISLAND METHYLATOR PHENOTYPE (CIMP)
1.3.1 CIMP as a distinct CRC phenotype
A subset of CRCs exhibiting simultaneous hypermethylation of multiple gene promoters
has been classified as the CIMP+ CRC. CIMP was first described by Toyota et al in 1999
following the analysis of 50 tumours for methylation in 7 “methylated in tumour” (MINT)
markers (Toyota et al., 1999a). The bimodal distribution pattern for methylation of the 7
MINTs was used to segregate CRC into two groups, with the CIMP+ tumours showing
strong association with MSI+ and female patients (Toyota et al., 1999a). The existence of
CIMP in CRC was subsequently challenged by other groups who proposed that CIMP+
tumours were merely a subset of MSI+ tumours and that methylation levels amongst
CRCs were evenly distributed when a larger number of genes was analysed (Anacleto et
al., 2005; Yamashita et al., 2003).
Chapter 1 Introduction 6
The dispute over CIMP+ CRC as a distinct subtype was resolved when Laird and
coworkers carried out an unbiased, quantitative methylation analysis of 195 genes in 295
CRCs (Weisenberger et al., 2006a). They proposed the use of a 5-marker panel consisting
of RUNX3, IGF2, CACNA1G, NEUROG1 and SOCS1 for the standardized classification
of CIMP+. Using this panel to define CIMP+, a tight association was observed with
BRAF V600E mutation independently of MSI status (Weisenberger et al., 2006a). The
existence of CIMP+ as a distinct CRC subgroup has since been validated by independent
groups working on large population-based series. From these studies, it has emerged that
CIMP+ occurs in ~15% of all CRC and is frequently associated with MSI+, BRAF
mutation, older age, proximal tumour site and female gender (Barault et al., 2008a;
Hawkins et al., 2002a; Ogino et al., 2006a; Ogino et al., 2007a; Samowitz et al., 2005a;
van Rijnsoever et al., 2002; Weisenberger et al., 2006a). CIMP+ CRC also show
distinctive gene expression, as demonstrated in a series of CIMP+ MSI- CRC (Ferracin et
al., 2008b).
1.3.2 Clinical features of CIMP+ CRC
The prognostic significance of CIMP+ may depend on the MSI status. In MSI+ CRC,
CIMP+ has no prognostic value since the longer survival conferred by the MSI+
phenotype appears to predominate over the CIMP status (Ogino et al., 2009; Samowitz et
al., 2005a; Ward et al., 2003). In contrast, MSI- CIMP+ CRC patients have poorer
survival compared to MSI- CIMP- patients (Barault et al., 2008a; Ferracin et al., 2008b;
Hawkins et al., 2002a; Lee et al., 2008; Ogino et al., 2007c; Shen et al., 2007a; Ward et
al., 2003). When BRAF mutation and MSI status are taken into consideration, CIMP+ was
independently associated with lower cancer-specific mortality (Ogino et al., 2009).
CIMP+ has been reported to show predictive value for survival benefit from adjuvant
treatment with 5-FU in stage III CRC patients (Van Rijnsoever et al., 2003). The tight
Chapter 1 Introduction 7
associations of BRAF mutation and MSI+ with CIMP+ highlights the need to take these
factors into account when evaluating the influence of CIMP+ on clinical outcomes
(Iacopetta et al., 2008; Ogino et al., 2009).
1.3.3 BRAF and KRAS mutations in CIMP+ CRC
The RAS/RAF/MEK/ERK pathway is frequently deregulated in CRC through gain-of-
function mutations in KRAS and BRAF (Downward, 2003). The V600E substitution
represents more than 90% of reported mutations in BRAF and shows a 500-fold elevated
kinase activity compared to wild type BRAF (Crook et al., 2009). This mutation is found
in 5-15% of all CRC and up to 70% of CIMP+ CRC (Davies et al., 2002; Li et al., 2006a;
Nosho et al., 2008a; Rajagopalan et al., 2002; Samowitz et al., 2005a; Weisenberger et
al., 2006a; Yuen et al., 2002). BRAF mutant CRC exhibit a distinct gene expression
profile, DNA methylation pattern and specific clinicopathological features (Kim et al.,
2006; Li et al., 2006a; Nagasaka et al., 2008b). The proclivity of BRAF mutation to
cluster with CIMP+ and MSI+ may be linked to the ability of mutated BRAF protein to
induce methylation in MLH1 (Minoo et al., 2007). BRAF mutation has been associated
with poor survival of CIMP+ CRC patients (French et al., 2008; Lee et al., 2008;
Samowitz et al., 2005b) and a more aggressive tumour phenotype compared to BRAF
wildtype tumours (Lee et al., 2008; Minoo et al., 2007; Oliveira et al., 2007).
KRAS mutations occur early in colorectal tumourigenesis (Fearon and Vogelstein, 1990;
Velho et al., 2008). Mutations in codons 12, 13, and less frequently codon 61 result in
constitutive activation of the GTP-bound RAS protein and are found in ~40% of CRC
(Walther et al., 2009). Although KRAS mutations are only weakly prognostic in CRC
(Andreyev et al., 1998; Andreyev et al., 2001), they are highly predictive for response to
anti-EGFR therapies (Normanno et al., 2009). KRAS mutations have been associated with
Chapter 1 Introduction 8
distinct methylation signatures (Horii et al., 2009; Nagasaka et al., 2008a; Nagasaka et
al., 2008b; Ogino et al., 2006b; Shen et al., 2007b; Suehiro et al., 2008) and are almost
always mutually exclusive with BRAF mutation (Oliveira et al., 2007). Although KRAS
and BRAF mutations can induce similar effects via the same signalling pathway, BRAF
mutant cancer cells are preferentially dependent on MEK/ERK signalling whereas KRAS
mutations exert their effect through other effectors including phosphoinositide 3-kinases
(PI3K) and ral guanine nucleotide dissociation stimulator (RALGDS) (Preto et al., 2008).
The differential reliance of KRAS and BRAF mutant cells on activation of the
RAS/RAF/MEK/ERK pathway suggests a synergistic function for each mutation, as
observed in advanced CRC (Oliveira et al., 2007).
1.3.4 Non-genetic risk factors for the development of CIMP+ CRC
Enzymes linked to methionine metabolism and including folate and glutathione (GSH)
reactions are significantly downregulated in CIMP+ tumours (Ferracin et al., 2008b).
Consistent with this finding, CIMP+ CRC have lower gamma-glutamyl hydrolase mRNA
levels (Kawakami et al., 2008), which probably explains the higher levels of folate
intermediates observed in CIMP+ compared to CIMP- CRC (Kawakami et al., 2003).
Increased levels of GSH and GSH-related enzymes in the proximal colon of elderly
females (Hoensch et al., 2006) may signal an inherent predisposition to deregulation of
the GSH pathway and the development of CIMP+ CRC.
Intrinsic differences in methylation levels in the normal colonic mucosa may also underlie
the preponderance of CIMP+ CRC in elderly females. Methylation levels of MLH1 show
a marked decrease from the right to left colon with increasing age in females (Kawakami
et al., 2006; Menigatti et al., 2009). Expression of the DNA methylating enzyme
DNMT3B is also higher in the liver of older females compared to younger males (Xiao et
Chapter 1 Introduction 9
al., 2008). On the other hand, promoter-specific methylation levels in lymphocyte DNA
are higher in Asian males than Asian females (Sarter et al., 2005).
Exogenous factors may also modulate the risk for developing CIMP+ CRC. Samowitz et
al reported a positive association between smoking and CIMP+ CRC in a large
population-based study (Samowitz et al., 2006). The association between smoking and
CIMP+ CRC may be linked to activation of the aryl hydrocarbon receptor by dioxin in
cigarette to induce gene hypermethylation (Ray and Swanson, 2004) and to higher
DNMT1 expression observed in the liver of smokers compared to non-smokers
(Hammons et al., 1999).
Folate, a methyl donor for the remethylation of homocysteine to methionine, is an
essential substrate for DNA methylation. Methionine is converted to SAM, the universal
methyl donor used in all cellular one-carbon transfer reactions (Figure 1.2) (Kim, 2005;
Ulrich et al., 2008). However, studies that have examined the association between folate
intake and DNA methylation levels in animal models and human intervention trials have
produced discordant results (Kim, 2004; Kim, 2005; Ulrich et al., 2008). In a mouse
model, enhanced availability of methyl groups through folate supplementation
significantly increased both global DNA methylation and p16 promoter methylation,
particularly in older animals (Keyes et al., 2007). In contrast, folate depletion in rats was
associated with a 30% increase in genomic DNA methylation (Sohn et al., 2003).
Chapter 1 Introduction 10
Figure 1.2 Cellular methyl group metabolism, DNA synthesis and DNA methylation.
B12, vitamin B-12; DHFR, dihydrofolate reductase; CH3, methyl group; CpG cytosine-
guanine dinucleotide sequence; MTHFR, methylenetetrahydrofolate reductase; SAH, S-
adenosylhomocysteine; SAM, S-adenosylmethionine; THF, tetrahydrofolate (Kim, 2005).
Folate depletion in elderly humans (>60 years) and postmenopausal women led to
reduced global DNA methylation levels in lymphocytes (Jacob et al., 1998; Rampersaud
et al., 2000). Nonetheless, folate deficiency in young males did not affect the in vivo
methylation capacity of lymphocytes (Jacob et al., 1995). Low folate and high alcohol
consumption were associated with a higher frequency of multiple hypermethylated genes
in CRC patients compared to those with high folate and low alcohol intake (van Engeland
et al., 2003). However, no correlation was found between dietary folate levels and the
development of CIMP+ CRC in a large case-control study (Slattery et al., 2007). The
association between folate intake and development of CIMP+ cannot be ruled out as more
quantitative and direct measures of folate level such as plasma folate levels may be
needed as accurate indicators of folate levels in these patients. Further studies using
different CIMP+ markers with longer patient follow-up time may also be more
Chapter 1 Introduction 11
informative to determine the role of dietary folate in the development of CIMP+ CRC.
Other metabolites such as vitamin B12, choline and methionine can interact with folate to
influence the level of DNA methylation (Ulrich et al., 2008). The vitamin B12 level in
serum, but not folate level, was inversely correlated to ER� methylation in normal colonic
mucosa (Al-Ghnaniem et al., 2007). The extent to which folate modulates DNA
methylation is therefore likely to depend on gender, age, duration of folate depletion,
tissue type and other metabolites in the folate cycle.
1.3.5 Genetic risk factors for the development of CIMP+ CRC
Firm evidence for the existence of genetic risk factors for CIMP+ CRC is lacking.
Although Frazier et al reported a 14-fold higher likelihood of positive family history of
cancer in 47 patients with tumours showing frequent methylation (Frazier et al., 2003),
analysis in a larger cohort of 562 unselected CRC found no association between CIMP+
and family history of cancer (Ward et al., 2004). Nonetheless, the lower risk for CIMP+
CRC in Southern Europeans compared to Anglo-celtic Caucasians after adjusting for
other known risk factors suggests a possible genetic predisposition in the pathogenesis of
CIMP+ CRC (English et al., 2008).
Genetic variants in MLH1 (-93G>A; rs1800734) (Samowitz et al., 2008) and MSH6
(116G>A; rs1042821) (Curtin et al., 2009) have been associated with increased risk for
CIMP+ CRC. In conjunction with folate intake, polymorphisms in genes involved in one-
carbon metabolism pathways (Figure 1.2) could influence the level of DNA methylation
in normal colonic mucosa and therefore the risk of developing CIMP+ CRC. Carriers of
the methylene tetrahydrofolate reductase (MTHFR) A1298C variant allele with low folate
and high alcohol intake showed an increased risk for CIMP+ CRC (Curtin et al., 2007).
Although MTHFR 677TT homozygous individuals were most susceptible to reduced
Chapter 1 Introduction 12
DNA methylation under low folate conditions (Axume et al., 2007; Friso et al., 2002),
they did not show a decreased risk for CIMP+ CRC (Curtin et al., 2007). A recent genetic
epidemiology study has shown that the risks for CRC associated with common variants in
MTHFR and DNMT3b are specific for tumours that arise in the proximal colon (Iacopetta
et al., 2009), in keeping with the strong predilection for CIMP+ CRC to occur in this part
of the colon.
1.3.6 The serrated adenoma pathway in the development of CIMP+ CRC
The existence of a CRC pathway distinct from the classic Vogelstein pathway is
suggested by the finding of tumours which have frequent DNA hypermethylation and
BRAF mutations but which lack CIN-type features such as LOH, aneuploidy and TP53
mutation. To this end, Jass has proposed the serrated pathway involving serrated
adenomas (SA) as the precursor lesion for CIMP+ CRC (Jass, 2005; Jass et al., 2002; Jass
et al., 2000). SAs are a heterogeneous group of polyps with a characteristic serrated
histological architecture that distinguishes them from traditional adenomas. SAs
encompass a spectrum of admixed polyps, sessile serrated adenoma, traditional serrated
adenoma and some large hyperplastic polyps (Jass, 2007a; Mäkinen, 2007; Noffsinger,
2009). A signature gene expression profile for SAs supports their existence as a separate
subgroup of polyps (Kim et al., 2008). SAs share several molecular features with CIMP+
CRC including high frequencies of MSI+, BRAF mutation and promoter
hypermethylation that also distinguishes them from conventional adenomas (Carr et al.,
2009; Hawkins and Ward, 2001; Kambara et al., 2004; Konishi et al., 2004; O'Brien et
al., 2006; Spring et al., 2006; Wynter et al., 2004). SAs show a predilection for the
proximal colon and occur more frequently in women (Mäkinen, 2007; Noffsinger, 2009).
They comprise just 9% of all polyps detected in patients undergoing colonoscopy for
Chapter 1 Introduction 13
standard clinical indications and account for 8-22% of all serrated lesions (Goldstein et
al., 2003; Spring et al., 2006).
The juxtaposition of SA with serrated adenocarcinoma (Jass et al., 2000; Mäkinen et al.,
2001) and MSI+ CRC (Hawkins and Ward, 2001) is highly suggestive of the malignant
potential of these lesions. Consistent with these findings, the presence of large SAs was
shown to correlate tightly and independently with synchronous advanced CRC (Li et al.,
2009). Patients with SAs also showed a significant positive family history of CRC
(Spring et al., 2006). Risk factors for the development of SAs appear to differ according
to anatomical site in the colon, with folate supplementation associated with an increased
risk of proximal SA and smoking and obesity associated with increased risk of distal SA
(Wallace et al., 2009).
1.3.7 Serrated pathway syndrome
A familial syndrome for CIMP+ CRC has been proposed based on the hyperplastic
polyposis (HPP) and serrated pathway (SPS) syndromes (Young and Jass, 2006; Young et
al., 2007). SAs that arise in these conditions show frequent BRAF mutation and elevated
DNA methylation. HPP is an extremely rare condition with infrequent familial
segregation that suggests a recessive mode of inheritance (Young and Jass, 2006; Young
et al., 2007). The large, atypical and dysplastic SAs pose the highest risk for malignant
transformation in HPP individuals. Although the increased risk for CRC associated with
selected HPP patients has been described in several case reports (Abeyasundara and
Hampshire, 2001; Jass et al., 2000), the molecular pathway that underlies HPP remains
poorly understood (Carvajal-Carmona et al., 2007; Rashid et al., 2000). BRAF mutations
are frequently observed in the serrated lesions of HPP patients, together with increased
DNA hypermethylation in the normal colonic mucosa compared to patients with sporadic
Chapter 1 Introduction 14
serrated lesions (Chan et al., 2003; Minoo et al., 2006; Wynter et al., 2004). SPS is an
autosomal dominant condition proposed for familial predisposition to serrated neoplasia
(Young and Jass, 2006; Young et al., 2007). SPS was first described in individuals from
families fulfilling the Amsterdam I criteria and showing variable levels of MSI (Young et
al., 2005). SPS shows a predilection for development of advanced serrated polyps in the
proximal colon and predominantly in females (Young and Jass, 2006; Young et al.,
2007). The significant association reported between BRAF mutation and positive family
history of CRC provides circumstantial evidence to support the hypothesis that HPP and
SPS are familial syndromes for CIMP+ CRC (Vandrovcova et al., 2006; Young et al.,
2005).
1.3.8 Molecular mechanisms in the serrated pathway
Key molecular mechanisms in the serrated neoplastic pathway are DNA methylation,
inactivation of the MMR system and mutations in BRAF and KRAS (Jass, 2005; Jass et
al., 2002). Widespread DNA methylation in the normal colonic mucosa is a frequent
event observed in patients with CIMP+ CRC (Kawakami et al., 2006), HPP (Minoo et al.,
2006) and SAs (Kambara et al., 2004; O'Brien et al., 2006; Park et al., 2003; Velho et al.,
2008). Hypermethylation-induced inactivation of MLH1 may trigger the progression of
hyperplasia to dysplasia in MSI+ SAs (Jass, 2005; Jass et al., 2002). Methylation of
HPP1, coding for a transmembrane protein with follistatin and epidermal factor-like
domains, may also initiate the malignant transformation of SAs (Young et al., 2001).
Evidence to support the involvement of defective MMR repair in the evolution of serrated
neoplasia is provided by the segregation of MSI+ SA with MSI+ CRC (Hawkins and
Ward, 2001). Moreover, identical mutations in TGF�RII, BAX and IGF2R have been
identified in the serrated lesions and corresponding tumours from the same patients (Jass
Chapter 1 Introduction 15
et al., 2000). Inactivation of MLH1 and MGMT through hypermethylation is more
commonly observed in serrated lesions than traditional adenomas, indicating the
importance of DNA repair genes in driving tumour progression via the serrated pathway
(Oh et al., 2005).
Mutations in BRAF and KRAS, are over-represented in SAs and occur at a comparable
frequency to MSI+ CRC (Carr et al., 2009; Jass et al., 2000; Kim et al., 2008b;
Rosenberg et al., 2007; Velho et al., 2008). These mutations are thought to result in
failure to initiate shedding of epithelial cell leading to the serrated architecture
characteristic of SA (Jass, 2005; Jass et al., 2002). As mutations in BRAF and KRAS
results in pro-survival and pro-apoptotic responses respectively, aberrant signalling in the
RAS/RAF/MAPK pathway complemented by methylation-inactivation of other genes
such as DNA repair genes, MGMT and anti-adhesion gene HPP1 may together contribute
to the malignant transformation of SA.
1.4 HERITABILITY OF DNA METHYLATION
During normal development of a zygote, epigenetic marks are erased in the primordial
germ cells and then re-established before preimplantation through epigenetic
reprogramming (Cedar and Bergman, 2009; Probst et al., 2009). However,
hypermethylation of normally unmethylated genes, termed constitutional epimutation, has
been reported in the normal somatic cells of a small proportion of cancer patients
(Dobrovic and Kristensen, 2009). This includes hypermethylation of DAPK1 in chronic
lymphocytic leukaemia patients, BRCA1 in breast cancer patients and MLH1 in CRC
patients. Such findings raise the possibility of transgenerational inheritance of DNA
methylation in humans (Dobrovic and Kristensen, 2009). Epimutation has been proposed
Chapter 1 Introduction 16
as an alternative first-hit mechanism in Knudson’s theory of tumourigenesis (Cropley et
al., 2008).
The earliest report of epimutation was in HNPCC-like patients that lacked detectable
germline mutations in MMR genes. Hypermethylation of MLH1 in DNA derived from
peripheral blood cells, buccal mucosa and hair follicles of these patients suggested the
epimutation may be germline (Gazzoli et al., 2002; Suter et al., 2004). However, further
investigation of the heritability of MLH1 epimutation in the parents, offspring and
siblings of affected individuals showed that inheritance of epimutation was probabilistic
and did not conform to Mendelian inheritance (Hitchins et al., 2005; Hitchins et al., 2007;
Morak et al., 2008; Valle et al., 2007). Transgenerational inheritance of epimutation may
be influenced by cis-acting factors, as exemplified by the mosaic pattern of MSH2
epimutation with germline deletion of TACSTD1 (Ligtenberg et al., 2009). Most
epimutation carriers reported to date were diagnosed with CRC at a relatively young age
(Hitchins and Ward, 2009). A recent study suggests that epimutations may contribute as
many as 16% of suspected HNPCC cases (Niessen et al., 2009).
1.5 DNA HYPOMETHYLATION IN COLORECTAL CANCER
Global DNA hypomethylation in CRC occurs concurrently but independently of promoter
hypermethylation (Bariol et al., 2003; Frigola et al., 2005; Iacopetta et al., 2007). Loss of
methylation in repetitive elements is a major source of global hypomethylation
(Hoffmann and Schulz, 2005; Wilson et al., 2007). Chromosomal instability subsequent
to loss of global DNA methylation has been demonstrated in the development of T-cell
lymphoma in a mouse model with defective DNMT1 (Eden et al., 2003; Gaudet et al.,
2003). Loss of imprinting (LOI) at genes expressed in an allele-specific manner has also
been observed to contribute to cancer risk (Hoffmann and Schulz, 2005; Wilson et al.,
Chapter 1 Introduction 17
2007). Increased IGF2 expression due to LOI promotes the development of intestinal
tumours in a mouse model (Sakatani et al., 2005).
LINE1 hypomethylation occurs early in CRC and is detectable in preneoplastic lesions
(Suter et al., 2004). Demethylation of LINE1 in the normal colonic mucosa of CRC
patients is inversely associated with the presence of MSI+, CIMP+ and promoter
hypermethylation in the tumours (Estecio et al., 2007; Iacopetta et al., 2007; Ogino et al.,
2008). Tumours with LINE1 hypomethylation were associated with poor prognosis
(Frigola et al., 2005; Ogino et al., 2008b), possibly due to cumulative chromosomal
aberrations in the demethylated genome (Rodriguez et al., 2006). Global DNA
methylation levels are lower in the proximal compared to distal normal colonic mucosa
(Figueiredo et al., 2009) and may be modulated by dietary folate intake (Friso et al.,
2002; Mathers, 2005; Pufulete et al., 2005) and polymorphisms in folate metabolism
genes (Kawakami et al., 2006; Stern et al., 2000).
1.6 DNA METHYLTRANSFERASES
Three classes of DNA methyltransferase encoded by DNMT1, DNMT2 and DNMT3 are
found in mammalians, with the latter comprising DNMT3A, DNMT3B and DNMT3L
(Goll and Bestor, 2005). DNMT3L serves as a regulatory factor for DNMT3A and
DNMT3B (Cheng and Blumenthal, 2008; Schaefer et al., 2007) while DNMT2 acts as an
RNA methyltransferase (Goll et al., 2006; Rai et al., 2007; Rottach et al., 2009).
Although DNMT1 and DNMT3 have traditionally been classified as maintenance and de
novo methyltransferases, respectively, synergistic activities of both enzymes are required
for effective DNA hypermethylation (Esteller, 2007). Simultaneous inactivation of
DNMT1 and DNMT3 leads to loss of methylation and restoration of the expression of
Chapter 1 Introduction 18
genes previously silenced by hypermethylation (James et al., 2006; Paz et al., 2003; Rhee
et al., 2002).
Overexpression of DNMT1 in 40-70% of CRC (Kanai et al., 2001; Kang et al., 2007; Zhu
et al., 2007) is associated with elevated RNA levels of SUV39H1 histone
methyltransferase (Kang et al., 2007) and simultaneous hypermethylation of multiple
gene promoters (Kanai et al., 2001). The tumourigenic effect of DNMT1 in neoplastic
cells may not be mediated solely by its methyltransferase activity (Damelin and Bestor,
2007; Robert et al., 2003) as the loss of DNMT1 can induce chromosomal and mitotic
defects (Chen et al., 2007). Elevated levels of DNMT3B have also been reported in CRC
and may contribute to the hypermethylator phenotype (Kanai et al., 2001; Nosho et al.,
2009). DNMT3A expression increases in parallel with the extent of dysplasia from
adenoma to carcinoma (Schmidt et al., 2007). In APCmin/+ mice, DNMT3B promotes
tumourigenesis through targeted de novo methylation of gene promoters (Linhart et al.,
2007), consistent with the non-random and tumour-specific DNA methylation patterns
observed in cancer (Costello et al., 2000). De novo methylation of cancer genes is
orchestrated by the interaction of cis-acting DNA sequence and trans-acting protein
complexes that are able to recruit DNMTs for gene-specific methylation (Keshet et al.,
2006; McCabe et al., 2009).
1.7 OTHER COMPONENTS OF THE EPIGENETIC MACHINERY
Histone modifications and chromatin remodelling add another layer of epigenetic
transcriptional regulation (Figure 1.3). The methyl marks on DNA are recognised by a
group of methyl-domain binding proteins (MBDs) consisting of MeCP2, MBD1, MBD2,
MBD3, MBD4 and Kaiso (McCabe et al., 2009). MBDs bind to methylated DNA to
Chapter 1 Introduction 19
recruit transcriptional repressors including histone deacetylases, polycomb group proteins
and chromatin remodelling factors (Lopez-Serra and Esteller, 2008).
A combination of histone modifications including acetylation, methylation,
phosphorylation, ubiquitination, ADP-ribosylation, citrullination and sumoylation forms
the histone code to provide a dynamic transition platform for transcriptional inhibition
and initiation (Cedar and Bergman, 2009). Generally, histone acetylation is compatible
with active transcription while histone deacetylation leads to gene silencing (Cedar and
Bergman, 2009). Global loss of monoacetylation of histone 4 lysine 16 is a common
phenomenon observed in cancers (Fraga and Esteller, 2005; Iacobuzio-Donahue, 2009).
Truncating mutations in histone deacetylase 2 (HDAC2) have been observed in MSI+
CRC (Hanigan et al., 2008) and result in resistance to HDAC inhibitor (Ropero et al.,
2006). Histone methylation controls transcriptional activity according to the type of
methylation and the amino acid residue on which histone methylation occurs. Elevated
levels of histone methyltransferases are observed in several tumour types (Iacobuzio-
Donahue, 2009).
MicroRNA (miRNA) are a class of non-coding RNA that negatively regulate target gene
expression (He and Hannon, 2004). Complementary base-pairing of miRNA to its target
sequence degrades the target transcript by deadenylation and decapping of the mRNA
(Winter et al., 2009; Yang et al., 2008). Alternatively, competitive binding of the
Argonaute protein in the RNA-induced silencing complex to mRNA inhibits translation
initiation by enhancer (Kiriakidou et al., 2007). In CRC, miR-143 down-regulates
DNMT3A mRNA and protein expression (Ng et al., 2009). Abrogation of miR-122a
tumour suppressive function by deregulation of the APC/�-catenin pathway is critical for
cancer cell proliferation (Wang et al., 2009). The transcriptional regulatory role of
Chapter 1 Introduction 20
miRNA is subjected to stringent genetic and epigenetic regulation and is thus emerging as
a new target in the development of epigenetic therapies for various malignancies (Guil
and Esteller, 2009).
1.8 DNA HYPERMETHYLATION IN CANCER AS A CLINICAL
BIOMARKER AND THERAPEUTIC TARGET
Although DNA methylation is modifiable by environmental factors and is affected by the
aging process, it could potentially be used as a biomarker for early detection,
prognostication and therapeutic target in cancer (Mulero-Navarro and Esteller, 2008). For
example, DAPK and p16 methylation are useful prognostic markers in lung and CRC
patients (Esteller, 2002). MGMT methylation has predictive value for responsiveness to
carmustine or cyclophosphamide in glioma and lymphoma patients (Esteller, 2002).
Figure 1.3 The epigenetic events of DNA methylation, chromatin remodelling and
histone modification are altered in cancer. Unmethylated DNA is associated with open
chromatin conformation and active histone modification such as histone H3 and H4
Chapter 1 Introduction 21
acetylation and methylation of histone 3 lysine 4 (H3K4) to initiate transcription. In
contrast, methylated DNA is associated with closed chromatin conformation and
repressive histone modifications including di- or tri-methylation of H3K9 (H3K9me2/3),
H3K27me3, and/or H4K20me3 to inactivate transcription (McCabe et al., 2009).
GSTP1 methylation, identified in up to 80-90% of prostate cancers, could be a sensitive
and specific marker for the detection of this tumour type (Mulero-Navarro and Esteller,
2008). Methylation across multiple genes such as CIMP-specific genes may potentially be
predictive for response to 5-FU (Iacopetta et al., 2008).
The introduction of DNA methylation markers into clinical practice is logistically feasible
since methylation is a relatively stable covalent modification. Methylation analysis can be
performed on archival materials and surrogate tissues such as bodily fluids obtained
through minimal invasive procedures. The localisation of DNA hypermethylation to CpG
dinucleotides limits the assessment of alterations to CpG-rich regions only, effectively
reducing the size of genomic regions that require screening. Moreover, the analysis of
DNA methylation generates a positive signal that is readily detectable in a background of
normal DNA, as opposed to negative signals such as LOH that can be masked by the
presence of normal cells.
Owing to its high prevalence and reversible nature, DNA methylation is an ideal
therapeutic target. The demethylating agents 5-azacytidine and 5-aza-2’-deoxycytidine
have been approved by the US Food and Drug Administration for haematological
malignancies (Mulero-Navarro and Esteller, 2008). Although the therapeutic mechanism
of these agents has not been fully elucidated, they potentially restore the expression of
genes silenced by DNA methylation, thereby returning cells to their normal state (Cortez
Chapter 1 Introduction 22
and Jones, 2008). Despite concerns over the selective targeting of tumour cells, there have
so far been no reports of long-term deleterious effects in patients receiving these drugs
(Cortez and Jones, 2008). Future generations of demethylating agents such as zebularine
with a longer half-life are under development to overcome the acute haematological
toxicities caused by current methylation inhibitors (Cortez and Jones, 2008).
1.9 AIMS OF THIS RESEARCH
The general aim of this thesis was to address the shortcomings of DNA methylation
analysis by establishing robust and accurate quality controls. These quality controls and
quantitative DNA methylation analysis tools were then used to examine CIMP CRC in
greater detail, with particular emphasis on their etiology in young patients and on their
classification.
AIM 1
Background
Many existing assays for methylation detection are based on the analysis of bisulfite-
treated DNA and subsequent PCR amplification. For accurate characterization of
methylation, the number of available DNA templates following bisulfite reaction and
hence the availability of suitable target molecules for PCR amplification are critical. This
study was therefore undertaken to establish a standardised measure for ensuring
maximum efficiency of DNA recovery after sodium bisulfite conversion through accurate
quantification of genomic DNA.
Aim 1: To demonstrate use of the cycle threshold (Ct) value as a quality control
parameter for bisulfite PCR-based DNA methylation analysis.
Chapter 1 Introduction 23
This aim was addressed in Results Chapter 3. The results have been published in:
Ang PW, Toh HB, Iacopetta B, Soong R. An improved quality control for bisulfite-PCR-
based DNA methylation analysis: cycle threshold value. Clin Chem Lab Med. 2008;
46(8):1117-21.
AIM 2
Background
Current approaches for the quantitative evaluation of gene promoter methylation usually
assess CpG sites that are selected arbitrarily. This may impact upon the potential value of
promoter methylation as a clinically useful biomarker. Identification of CpG sites linked
to transcriptional silencing is therefore essential if methylation is to be used as a surrogate
marker for gene expression.
Aim 2: To develop and validate an approach for identifying individual CpG sites within
specific promoters whose methylation is most tightly linked with gene expression.
This aim was addressed in Results Chapter 4.
AIM 3
Background
CRC is a highly heterogeneous group of tumours displaying different methylation
patterns and clinicopathological characteristics. The lack of a consensus panel of
methylation markers to define the CIMP+ subgroup of tumours has led to inconsistent
results for the reported characteristics of CIMP+ tumours. Accurate classification of
CIMP+ CRC would facilitate further etiological and clinical investigation of this
important CRC subtype.
Chapter 1 Introduction 24
Aim 3: To profile DNA methylation in an unbiased and comprehensive fashion for
characterisation of CIMP subtypes in CRC in a consecutive series of CRC.
This aim was addressed in Results Chapter 5. The work is in preparation for publication:
Pei Woon Ang, Marie Loh, Natalia Liem, Fabienne Grieu, Aparna Vaithilingham,
Cameron Platell, Wei Peng Yong, Barry Iacopetta, Richie Soong. Comprehensive
profiling of DNA methylation in colorectal cancer reveals three subgroups with distinct
clinicopathological and molecular features (submitted for publication).
AIM 4
Background
Sporadic CIMP+ CRC with BRAF V600E mutation occur frequently in elderly CRC
patients but are less frequent in younger patients. Since hereditary factors are sometimes
implicated in young CRC patients, this study was undertaken to evaluate the prevalence
and the molecular and clinicopathological characteristics of CIMP+ in young patients
with a view to identifying possible familial cases.
Aim 4: To evaluate the incidence of CIMP+ and BRAF mutations in CRC from a
population-based study of young patients aged <60 years.
This aim was addressed in Results Chapter 6. The work has been published in:
Ang PW, Li WQ, Soong R, Iacopetta B. BRAF mutation is associated with the CpG island
methylator phenotype in colorectal cancer from young patients. Cancer Lett. 2009;
273(2):221-4.
Chapter 2 Methods and Materials 25
Chapter 2. Methods & Materials
2.1 CLINICAL SAMPLES AND CRC CELL LINES
2.1.1 Recruitment of Caucasian CRC patients
Colorectal tumour and adjacent normal colonic tissue samples were obtained from a
consecutive series of patients undergoing surgery for CRC at the St. John of God Hospital
(Subiaco, WA). This cohort has well-annotated clinicopathological features including
age, gender, tumour site, tumour stage, presence of lymphocytic infiltration and
assessment of perineural and extramural venous invasion. Assessment of genetic
alterations including MSI, BRAF V600E mutation and KRAS mutations in codons 12 and
13 were performed on all cases. All patients provided written, informed consent for
research to be carried out on their tissue samples.
2.1.2 Recruitment of Asian CRC patients
Frozen colorectal tumours were obtained from the National University Hospital Tissue
Repository, Singapore, according to institutionally approved protocols. Methylation
analysis of RUNX3 and DPYD were carried out on this set of primary tumours.
2.1.3 Formalin-fixed and paraffin embedded CRC tissues
Formalin-fixed and paraffin embedded (FFPE) CRC tissues were obtained from the
School of Surgery, University of Western Australia. These samples were from a large,
population-based study on MSI screening of tumours from young CRC patients for the
detection of HNPCC (Schofield et al., 2009). Four µM sections cut from FFPE tumour
blocks were stained with hematoxylin and eosin for tumour cellularity assessment. DNA
extracted from the FFPE tissues was analysed for methylation of the MLH1 promoter.
Chapter 2 Methods and Materials 26
2.1.4 CRC cell lines
All CRC cell lines used in this study were obtained from American Type Culture
Collection (ATCC, Manassas, VA) and maintained under recommended conditions.
Information on the cell lines and culture media used in the study are shown in
Supplementary Table 2.1.
To recover cryopreserved cells from liquid nitrogen stocks, cells were thawed in a 37°C
water bath with continuous agitation and transferred into a sterile centrifuge tube
containing 2 ml of complete medium supplemented with 20% FBS, 2 mM L-glutamine,
100 U/ml penicillin and 100 �g/ml streptomycin sulfate. Cells were then centrifuged at
1,000 rpm for 10 minutes at room temperature. The supernatant was discarded and cells
were resuspended in 1 ml of complete medium. The recovered cells were then reseeded in
10 ml of complete culture medium appropriate for each cell lines in a humidified 5% CO2
atmosphere at 37°C, pH 7.2 in a T25 tissue culture flask (Corning, Lowell, MA) in an
incubator (Forma 310 Series, Thermo Fisher Scientific, Waltham, MA).
Cells were seeded into new plates when they reached 90% confluency and the media was
changed as appropriate to ensure normal cell growth. Used culture media was aspirated
and cells were washed with phosphate-buffered saline (PBS). For monolayer culture,
adherent cells were trypsinised with trypsin/EDTA for 5 minutes. Trypsinization was then
inhibited by adding 2 ml complete medium. The cell suspension was drawn into a pipette
and the cell layer rinsed several times to dissociate cells and dislodge any remaining
adherent cells. Where necessary, cells were counted with a hematocytometer and diluted
to an approximate number for subculture to reach confluence 3 to 5 days after the addition
of fresh medium. All cultures were regularly assessed for evidence of contamination and
aseptic technique was practiced throughout the procedures. Cells were harvested at the
Chapter 2 Methods and Materials 27
fourth passage by transfer to a sterile tube followed by centrifugation at 1,200 rpm for 5
minutes. Cell pellets were stored at -80°C until nucleic acid extraction.
2.2 DNA EXTRACTION
2.2.1 DNA extraction from frozen tissues
DNA was extracted from frozen tissues using the phenol-chloroform method.
Approximately 150-200 mg of frozen tissue was ground with a pre-chilled mortar and
pestle to a fine powder in liquid nitrogen. The powdered tissue was then suspended in 1
ml of extraction buffer consisting of 0.5% SDS, 10 mM Tris-HCl (pH 8), 100 mM EDTA
(pH 8) and 20 �g/ml pancreatic RNase. Samples were thoroughly mixed to produce a
homogeneous solution. Four mg of Proteinase K was added to each sample to inactivate
proteolytic enzymes. Tubes were then incubated with shaking at 53°C for 24 hrs. The
lysed and digested samples were cooled to room temperature before addition of 2 ml of
phenol/chloroform/isoamyl alcohol (25:24:1) followed by mixing on a rotating wheel for
10 minutes. To resolve the aqueous and phenolic phases, samples were centrifuged for 30
minutes at 5,000 rpm at room temperature. Genomic DNA was precipitated from the
aqueous solution by adding half the volume of 7.5M ammonium acetate and 2 volumes
(of the original amount of aqueous layer) of 100% ice-cold ethanol. Tubes were then
inverted multiple times and incubated at -20°C for 15 minutes. The DNA pellet was
thoroughly rinsed with 70% ethanol and subsequently air-dried for 30 minutes at room
temperature. DNA was resuspended at room temperature in TE buffer at ~1 mg/ml until
dissolved and then stored at -20°C until use.
2.2.2 DNA extraction from paraffin-embedded tissues
DNA was extracted from paraffin-embedded tissues using the Proteinase K method
(Soong’97 Mod Path). Briefly, sections of 25 �m thickness cut from paraffin-embedded
Chapter 2 Methods and Materials 28
tissue blocks were added to 300 �l of digestion buffer consisting of 50 mM Tris-HCl, 1
mM EDTA and 0.5% TWEEN20 (pH 8.5) and incubated at 94°C for 10 min to dissolve
the paraffin. The tissues were separated from the paraffin by centrifuging at 13,200 rpm
for 10 min. The tube was then cooled to 4°C to allow the paraffin to solidify, enabling the
underlying tissues to be removed from the solution and transferred to a new 1.5ml
microcentrifuge tube. Fresh digestion buffer (200 �l) and 20 �l of 20mg/ml Proteinase K
(Invitrogen; Carlsbad, California) were added to the tissue and the mixture incubated at
55°C for 48 hrs on a rotator. The Proteinase K was inactivated by heating at 94°C for 10
minutes, following which the solution was centrifuged at 13,200 rpm for 10 minutes. The
supernatant containing the extracted DNA was stored at -20°C until use.
2.2.3 DNA extraction from cell lines
Cell pellets were resuspended in PBS buffer and digested with 20 �l proteinase K before
undergoing DNA extraction using the DNeasy Blood & Tissue Kit (Qiagen, Valencia,
CA) as recommended by the manufacturer. DNA was eluted in 10 mM Tris-HCl, pH 8.0
at a concentration of approximately 1 mg/ml and stored at -20°C until use.
2.3 RNA EXTRACTION
2.3.1 RNA extraction from frozen tissues
Surgical tissue samples were immediately snap-frozen in liquid nitrogen and stored at -
80°C until use. Total RNA was isolated using TRI Reagent® (Molecular Research
Centre, Cincinnati, OH) in conjunction with further purification using the RNeasy® Mini
Kit (Qiagen, Valencia, CA). Approximately 50 mg of tissue was ground to a fine powder
under liquid nitrogen using a mortar and pestle. The suspension of tissue powder in liquid
nitrogen was transferred to a sterile 2 ml microcentrifuge tube. The liquid nitrogen was
allowed to evaporate without thawing of the samples and this was followed by addition of
Chapter 2 Methods and Materials 29
1 ml of TRI Reagent® to lyse the tissues. Homogenisation of the tissue was carried out on
ice by multiple passing of the lysate through a 20-gauge needle until a homogeneous
lysate was produced. This was incubated at room temperature for 5 minutes before
addition of 200 �l chloroform. The resulting mixture was mixed vigorously for 15
seconds before further incubation at room temperature for 15 minutes, followed by
centrifugation at 15,000 rpm for 15 minutes at 4°C to separate the organic and aqueous
phases. RNA isolated from the aqueous phase was transferred to a new 2 ml
microcentrifuge tube and mixed with 500 �l isopropanol. The precipitation was mixed by
inversion and incubated at room temperature for 5 minutes. The mixture was then
transferred to a spin column from the RNeasy® Mini Kit (Qiagen, Valencia, CA) for
further purification. RNA was eluted in 10 mM Tris-HCl, pH 8.0 at a concentration of
approximately 1 mg/ml, dispensed in single use aliquot tubes and stored at -80°C until
use.
2.3.2 RNA extraction from cell lines
To isolate RNA from cell lines, residual culture medium was completely removed from
the cell pellets before proceeding with RNA extraction using the RNeasy® Mini Kit
(Qiagen, Valencia, CA) following the manufacturer’s instructions. RNA was eluted in 10
mM Tris-HCl, pH 8.0 at a concentration of approximately 1 mg/ml and stored at -80°C
until use.
2.4 QUALITY CONTROL OF NUCLEIC ACIDS
2.4.1 Quantitation and qualitative assessment of genomic DNA
The purity of DNA was assessed by the ratio of absorbance readings at 260 nm and 280
nm (A260/A280) and the yield by absorbance at 260 nm (A260). These readings were
performed using a spectrophotometer (Nanodrop ND-1000, Thermo Fisher, Wilmington,
Chapter 2 Methods and Materials 30
DE) and with the DNA dissolved in 10 mM Tris-HCl, pH 7.5 buffer. Samples with ratios
from 1.7 to 1.9 were considered pure and used for subsequent analysis. Real-time
quantification of the housekeeping gene �-actin (ACTB) was performed on all samples to
assess the amount of amplifiable genomic DNA, as described in Chapter 3.
2.4.2 Quantitative and qualitative assessment of total RNA
RNA was assessed for purity and concentration based on the measurement of A260/A280
values as described for DNA. Samples with readings within the optimal range of 1.9 to
2.1 were considered to have passed quality control. The integrity of RNA was also
assessed using agarose gel electrophoresis to examine the intensities of 28S rRNA and
18S rRNA bands. Samples were considered intact when the ribosomal bands appeared
sharp and showed an approximately 2:1 ratio of 28s rRNA to 18S rRNA. The amount of
amplifiable RNA was quantified by reverse-transcriptase real-time PCR (RT-PCR) using
the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping gene.
2.5 QUANTITATION OF RNA EXPRESSION LEVELS
The High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City,
CA) was used to reverse transcribe RNA to complementary DNA (cDNA). The total
reaction volume of 20 µl comprised of 2 µl of 10x RT buffer, 0.8 µl of 25x dNTP mix
(100 mM), 2 µl of 10x RT random primers, 1 µl of MultiScribe™ Reverse Transcriptase,
1 µl of RNase Inhibitor and 1 µg RNA. cDNA was synthesised by preincubation at 25°C
for 10 minutes, then reverse-transcribed for 120 minutes at 37°C, before denaturation at
85°C for 5 minutes.
Quantitative RT-PCR was performed using the TaqMan® Gene Expression Assays on the
7900HT Fast Real-Time PCR System (all from Applied Biosystems, Foster City, CA).
Chapter 2 Methods and Materials 31
The inventoried gene expression assay IDs are shown in Supplementary Table 2.7.
Amplification was performed in a total volume of 20 µl containing 1 µl of TaqMan®
Gene Expression Assay (20x), 9 µl of cDNA template and 10 µl of TaqMan® Fast
Universal PCR Master Mix (2x) without AmpErase® UNG underwent the following
cycling conditions: 50°C for 2 minutes, 95°C for 10 minutes, followed by 60 cycles at
95°C for 15 seconds and 60°C for 1 minute. Cell lines expressing the gene of interest
were used as calibrators and GAPDH was used as a reference gene for each assay.
The RNA level was quantified using the comparative Ct method as described by
Schmittgen and Livak (Schmittgen and Livak, 2008). The fold change in expression,
normalised to the endogenous reference (GAPDH) and relative to a calibrator is expressed
as 2–��CT, where ��Ct = (Ctgene of interest – CtGAPDH) sample – (Ct gene of interest – CtGAPDH)
calibrator.
2.6 SCREENING FOR KRAS MUTATION, BRAF MUTATION AND MSI
2.6.1 Fluorescent-single strand conformational polymorphism (F-SSCP)
Single-strand conformational polymorphism (SSCP) is a rapid and efficient method for
the detection of sequence variation and is based on the differential electrophoretic
migration of single stranded DNA. This adopts different secondary structures as
determined by sequence-specific intramolecular base-pairing, thus giving rise to
differences in migration patterns between wildtype and mutant DNA fragments
(Humphries et al., 1997). Under optimized conditions, the detection sensitivity can
approach 100% (Ellison et al., 1993).
F-SSCP involves four major steps: PCR amplification of the target region with
fluorescent-labelled PCR primers typically giving rise to a 100 to 200bp fragment,
Chapter 2 Methods and Materials 32
denaturation of the double-stranded PCR products, self-annealing of single stranded DNA
under low temperature followed by electrophoretic migration under non-denaturing
conditions (Makino et al., 1992).
2.6.2 PCR amplification of KRAS, BRAF and BAT26
Screening for KRAS codon 12 and 13 mutations, BRAF V600E mutations and MSI was
performed as described previously (Iacopetta and Grieu, 2000; Li et al., 2006a; Wang et
al., 2003). MSI was detected as deletions in the BAT26 quasi-monomorphic
mononucleotide repeat. The primer sequences and annealing temperatures used for PCR
are listed in Supplementary Table 2.2. The gel conditions (%Polyacrylamide/ %Glycerol)
used for F-SSCP analysis were for KRAS (12%/2%), BRAF and BAT26 (8%/2%). PCR
was performed in a total reaction volume of 16 �l consisting of 1x polymerization buffer,
1x Q-solution, 200 �M of each dNTP, 3 mM MgCl2, 0.5 �M of each forward and reverse
primer, 0.5U Taq DNA Polymerase (Qiagen, Hilden, Germany) and 1 �l of genomic
DNA. Hot-start PCR reaction was carried out using the following cycling conditions:
94°C for 5 min followed by 35 cycles of three-step cycling consisting of 94°C for 30 sec,
the appropriate annealing temperature for 30 sec, 70°C for 30 sec and a final extension at
70°C for 10 min.
2.6.3 F-SSCP screening for KRAS mutations, BRAF mutations and MSI
Two �l of fluorescent-labelled PCR product was diluted with 9 �l of deionized
formamide loading dye containing 0.05% dextran blue and denatured at 94°C for 5
minutes. One �l of this mixture was loaded onto a non-denaturing polyacrylamide gel (80
�m thickness, 18 cm long) mounted in a real-time DNA fragment analyzer (Gel-Scan
2000, Corbett Research, Sydney) for detection of the HEX fluorochrome incorporated
during PCR. Samples were pulse-loaded for 20 seconds at 1400 V, the wells were then
Chapter 2 Methods and Materials 33
rinsed thoroughly before the gel was run for 2 hours at 1400 V in 0.8x TBE (Tris-borate-
EDTA) buffer at a constant temperature of 25°C as regulated by a built-in cooling unit.
ONE-Dscan 1.3 software (Scanalytics, Billerica, MA, USA) was used to analyse the
eletrophoretogram and samples displaying weak signal intensity were adjusted with the
aid of software to facilitate data interpretation.
2.7 DNA METHYLATION ANALYSIS
2.7.1 Sodium bisulfite conversion of genomic DNA
Sodium bisulfite converts unmethylated cytosine to uracil. Resistance of methylated
cytosine to the conversion results in methylation patterns that are preserved in the form of
genetic polymorphisms after bisulfite treatment that can be examined by various
methodologies. Sodium bisulfite conversion of genomic DNA was performed using the
EZ-DNA Methylation kitTM according to the manufacturer’s instructions (Zymo
Research, Orange, CA) apart from the study described in Chapter 3. The quality control
system established from that study was used for later experiments.
2.7.1.1 Sodium bisulfite conversion of genomic DNA (in-house protocol)
Sodium bisulfite conversion of genomic DNA was performed as described by Frommer et
al with slight modification (Frommer et al., 1992). For each batch of samples undergoing
sodium bisulfite treatment, a negative control (water sample without DNA template) was
included to check for contamination. DNA samples were sheared by passing through a
fine needle, followed by denaturation with 5 �l of 3 M NaOH added to a final
concentration of 0.3M. The DNA was then incubated at 37°C for 10 minutes and kept on
ice thereafter to maintain it in single-stranded form. In a total volume of 500 �l, the
denatured DNA, overlaid with mineral oil, was incubated with freshly prepared 3.1 M
sodium bisulfite, 0.5 mM hydroquinone (pH 5.0) at 50°C for 16 to 18 hours. Desalting
Chapter 2 Methods and Materials 34
was carried out using the Wizard® DNA Clean-Up System (Promega, Madison, WI).
Briefly, the sample mixture was added to 1 ml of resin in a 1.5 ml microcentrifuge tube
and mixed by inversion. The mixture was then passed through a column followed by
washing with 2 ml of 80% isopropanol. To dry the resin, columns were then centrifuged
for 2 minutes at 13,000 rpm. Pre-warmed nuclease-free water (50 �l) was added to the
column and allowed to stand for 1 minute followed by centrifugation at 13,000 rpm for 1 minute
to elute the DNA. NaOH (1.6 �l of 10 M) was added to the eluted DNA to a final
concentration of 0.3 M and incubated at room temperature for 10 minutes. One �l of
glycogen (10 �g/ml) and 90 �l ammonium acetate (10 M, pH 7.0) to a final concentration
of 3 M was added to each tube, together with 200 �l of absolute ethanol. The reaction was
mixed by vortexing and subsequently centrifuged at 13,000 rpm at 4°C for 30 minutes.
The resulting supernatant was removed and the precipitated DNA pellet was washed
twice with 70% ethanol. Samples were air-dried at ambient temperature before being
resuspended in 20 µl of 10 mmol/L Tris-HCl (pH 8). All samples were stored at -20°C
and used within two months.
2.7.1.2 Sodium bisulfite conversion of genomic DNA (EZ-DNA Methylation kitTM)
Using procedures described in Chapter 3, samples were assessed to determine the
appropriate quantity of genomic DNA needed for sodium bisulfite conversion using the
EZ-DNA Methylation kitTM (Zymo Research, Orange, CA). Converted samples were
eluted in 50 µl of 10 mmol/L Tris-HCl (pH 8) and stored at -20°C for up to 2 months.
2.7.2 CpG Methyltransferase (M.SssI) treatment of DNA
Leukocyte DNA was incubated with M.SssI methylase (New England Biolabs, Ipswich,
MA) and SAM as the methyl donor to artificially methylate all CpG dinucleotides. A 20
�l reaction mix consisting of H2O, 1 �g genomic DNA, 0.16 mM SAM, 1x NE buffer 2
Chapter 2 Methods and Materials 35
and 4 U M.SssI enzyme was incubated overnight at 37°C. Additional M.SssI enzyme and
SAM were added after 24 hours before a further 4-hour incubation to ensure complete
methylation of all CpG dinucleotides. The reaction was then heated to 65°C for 20
minutes to inactivate the enzyme. The completely methylated leukocyte DNA were stored
at -20°C and used as the universally methylated reference control in all methylation-
specific PCR (MSP), MethyLight and Pyrosequencing assays.
2.7.3 Methylation-specific PCR (MSP)
MSP is one of the earliest and most widely used bisulfite-dependent techniques for the
qualitative detection of differential DNA methylation in gene promoters (Licchesi and
Herman, 2009). Each assay comprises of “methylated” and “unmethylated” PCR in
separate reactions using primers that overlap multiple CG dinucleotides. Primer design is
critical for achieving maximal discrimination between methylated and unmethylated
sequences in MSP. Several parameters for the correct design of MSP primers are: (i) each
primer should contain at least two pairs of CG-dinucleotides and several cytosines outside
the CG-sequence at the 3’end to avoid false positives; (ii) the annealing temperature for
both sets of primers (methylated [M] and unmethylated [UM]) should be similar and
range between 55-65°C; (iii) the amplicon size should be less than 200 bp.
MSP of MLH1 was performed as described by Herman et al with minor modification
(Herman et al., 1998). PCR reactions were carried out in a total volume of 25 �l
consisting 1x PCR buffer, 200 �M of each dNTP, 1.5 mM MgCl2, 400 �M of each
primer, 0.04 U FastStart Taq polymerase (Roche, Mannheim, Germany) and 2 �l of
bisulfite-converted DNA. PCR conditions were as follows: 96oC for 3 minutes, 35 cycles
of 96oC for 20 seconds, annealing temperature for specific primers set at 45 seconds (M,
59°C; UM, 60°C) and 72oC for 30 seconds, followed by 72oC for 5 minutes. A negative
Chapter 2 Methods and Materials 36
control (no template) and a positive control (fully methylated) were included in each MSP
run. PCR products were visualised on an automated, multicapillary DNA electrophoresis
system (QIAxcel system, Qiagen, Valencia, CA).
2.7.4 MethyLight
MethyLight quantifies DNA methylation events based on real-time fluorescent detection
of methylated sequence following conversion by sodium bisulfite. The flexibility in
design of methylation-specific primers and/or fluorescent probes allows highly sensitive
quantitation of DNA methylation at different resolution and the inclusion of inbuilt
controls (Campan et al., 2009).
To assess the efficiency and reproducibility of bisulfite conversion, three quality control
reactions were set up. Sample quantity and integrity were measured by a methylation-
independent assay that targeted cytosines outside the CG context. To monitor the
recovery efficiency for DNA following bisulfite treatment, probes and primers were
designed for amplification of a cytosine-free region. Completeness of bisulfite conversion
were indicated through amplification of a CG region using a set of common primers
lacking cytosine, in combination with multiple probe sets targeting non-CG cytosines
(Campan et al., 2009).
To measure DNA methylation levels at a specific gene locus using the MethyLight assay,
four PCR reactions were set up using bisulfite-treated DNA of the sample of interest and
a universally methylated reference control. For each sample, two PCR reactions were
performed: one PCR amplified the gene of interest to detect methylation events, while
another control PCR targeted CG-free sequences from a housekeeping gene in order to
account for the amount of input DNA. The level of methylated sequence discrimination
Chapter 2 Methods and Materials 37
can be resolved at the probe hybridization level or amplification level, depending on the
CGs targeted by the primers and/or the probe. The versatility of the assay design thus
renders MethyLight capable of detecting as little as one methylated allele per 10,000
unmethylated alleles with high specificity (Campan et al., 2009; Eads et al., 2000). The
sensitivity can be further increased to a single-molecule level when digital PCR is
employed (Weisenberger et al., 2008).
MethyLight assays in this study were carried out as described by Eads et al with slight
modifications (Eads et al., 2000). Primer sequences for RUNX3, NEUROG1, IGF2,
CACNA1G, SOCS1 and APC used in the study described in Chapter 5 and 6 were
obtained from Weisenberger et al (Weisenberger et al., 2006a). MethyLight probe and
primers for RUNX3 and DPYD described in Chapter 4 were designed as follows:
RUNX3 forward primer 5’– CGTGGGGTTCGGAGGGCGCGTTCG – 3’
RUNX3 reverse primer 5’-ATACGCACGAACTCGCCTACG – 3’
RUNX3 probe 5’FAM – CGTTCGATGGTGGACGTG – 3’TAMRA
DPYD forward primer 5’ – GCGCGGGAGTCGTAGGATCGAGAGCG – 3’
DPYD reverse primer 5’ – ACCGACGACGCGAAAACGAAACGA – 3’
DPYD probe 5’FAM – CGCGAAACGACAACGCCCCCGAAACGA – 3’TAMRA
PCR amplification was carried out in a 20 �l reaction comprising of 10 �l Taqman® Fast
Universal PCR Master Mix (2X), 1 mM MgCl2, 0.25 �M probe and 0.75 M each of the
forward and reverse primers for the specific assay. Real-time PCR was carried out on an
ABI 7900HT (Applied Biosystems, Foster City, CA) using the following cycling
conditions: 95°C for 20 sec, followed by 40 cycles at 95°C for 1 sec and 60°C for 20 sec.
A methylation-independent assay targeting �-actin (ACTB) was used as an internal
control in combination with target-specific assays. DNA methylation values for each
Chapter 2 Methods and Materials 38
locus (GENE) were based on the copy number derived from Ct values and converted to
percentage of methylation reference (PMR) by dividing the GENE/ACTB ratio of each
sample with the GENE/ACTB ratio of the universally methylated reference and
multiplying by 100 (Campan et al., 2009). For all genes the threshold value for
methylation was set at PMR � 4 as described by Weisenberger et al (Weisenberger et al.,
2006a).
2.7.5 Pyrosequencing
Pyrosequencing is a sequencing-by-synthesis method for quantitative measurement of
DNA methylation at a single CpG resolution level (Tost and Gut, 2007). The technology
is based on a four-enzyme cascade where inorganic pyrophosphate (PPi) is released
following nucleotide incorporation by DNA Polymerase I. Subsequently, adenosyl-
triphosphate (ATP) is produced by ATP sulfurylase using PPi as a substrate. The released
ATP then serves as the energy source for luciferase to generate light that is captured by a
charge-coupled device camera. Unincorporated nucleotides and excess ATP are removed
by Apyrase to ensure synchronised DNA synthesis and hence the precise assignment of a
specific nucleotide. Quantitative DNA methylation levels are deduced from the sequence
Pyrogram generated by the Q-CpG software (Dejeux et al., 2009).
Although Pyrosequencing is ideal for DNA methylation analysis that targets specific
sites, the short reading length of approximately 150 bp precludes analysis of a large
number of CpG sites. However, multiple CpGs within a target region of less than 350bp
can be interrogated using serial Pyrosequencing and the successive use of several
sequencing primers on the same template (Tost and Gut, 2007). The labelling of PCR
products by specific biotinylated primers for each assay can be circumvented with the use
Chapter 2 Methods and Materials 39
of a single biotinylated primer that is simultaneously incorporated into a universally-
tagged PCR product during the amplification process (Royo et al., 2007).
Pyrosequencing for methylation analysis was performed in this study using methods
described by Tost et al (Tost and Gut, 2007). Briefly, PCR was carried out in a volume of
25 �l containing 1x PCR buffer, 200 �M of each dNTP, 2.5 mM MgCl2, 0.08 U FastStart
Taq polymerase (Roche, Mannheim, Germany), 400 �M each of PCR forward primer and
a 1:9 mixture of PCR reverse primer and universal biotinylated PCR primer based on a
published sequence (Tan et al., 2008) and 4 �l of bisulfite-converted DNA. PCR cycling
consisted of initial denaturation at 95oC for 7 minutes, 50 cycles of 95oC for 45 seconds,
annealing at the appropriate temperature for 45 seconds and extension at 72oC for 30
seconds, followed by 72oC for 5 minutes. A negative control without DNA template and a
positive methylated control were included in each PCR run. PCR products were verified
using the QIAxcel system (Qiagen, Valencia, CA).
Samples with successful amplification were subsequently analysed for DNA methylation
by Pyrosequencing using the PSQ96MA instrument (Biotage). The reaction mix
comprised of Pyro Gold Reagent kit (Biotage), 1x annealing buffer, binding buffer at pH
7.6 (10 mM Tris-HCl, 2 M NaCl, 1 mM EDTA, 1 ml/L Tween 20), 3 �l of Streptavidin
SepharoseTM High Performance beads (Amersham Biosciences, Uppsala, Sweden) and 15
�M pyrosequencing primer. Primer sequences, PCR annealing temperatures and the
pyrosequencing nucleotide dispensation order are shown in Supplementary Table 2.3.
Negative and positive PCR controls were always included in each run.
Chapter 2 Methods and Materials 40
2.7.6 Cloning and sequencing of bisulfite-treated DNA
The cloning and sequencing of PCR products obtained using methylation-independent
primers from bisulfite-converted DNA template is considered the gold standard for
quantitative DNA methylation analysis. This approach results in methylation maps of
single DNA molecules. In contrast to direct sequencing of the PCR product which yields
average methylation values from a pool of molecules, bisulfite-cloning and sequencing
(bsSEQ) provides information about the methylation status of each CG site in single DNA
fragments of up to 500 bp in length (Zhang et al., 2009).
2.7.6.1 PCR for bisulfite-cloning and sequencing (bsSEQ)
To design primers for bsSEQ, CpG islands contained within the gene of interest were
identified using the MethPrimer software available online at
http://www.urogene.org/methprimer/index1.html (Li and Dahiya, 2002). Primer
sequences and optimal annealing temperatures for RUNX3 and DPYD studied by bsSEQ
in the current study are shown in Supplementary Table 2.4. For each gene, the 5’-end of
successive amplicons was design to overlap with the 3’end of the previous amplicon.
Methylation readings from the overlapping regions were compared and analysis was
performed based on results from the most 3’ end wherever discrepancies were observed.
The targeted region was amplified in a 25 �l PCR volume containing 1x PCR buffer, 200
�M of each dNTP, 2.5 mM MgCl2, 0.08 U FastStart Taq polymerase (Roche, Mannheim,
Germany), 500 nM of each forward and reverse primer and 4 �l of bisulfite-converted
DNA. The reaction was thermally-cycled as follows: 7 min at 95°C followed by 40 cycles
of 95°C for 30 sec, the specific annealing temperature for 45 sec and 72°C for 1 min; hold
at 72°C for 5 min.
Chapter 2 Methods and Materials 41
2.7.6.2 PCR product purification and ligation
PCR products were resolved on 1.7% agarose gels and stained with SYBR® Safe DNA
gel stain (Invitrogen, Carlsbad, CA) diluted at 1:10,000 in 1X TBE buffer. The gel was
run for 20 minutes at 135V in 1X TBE and visualised with a UV transilluminator (Bio-
Rad Gel DocTM 2000 system, Bio-rad, Hercules, CA). Exposure to UV was kept to a
minimum to avoid the formation of pyrimidine dimers. Target bands were excised from
the gel and purified with the QIAquick DNA Purification kit (Qiagen, Valencia, CA) as
recommended by the manufacturer. Eluted DNA was quantified and assessed for purity
by spectrophotometry (Nanodrop ND-1000, Thermo Fisher, Wilmington, DE).
Purified PCR product was subcloned into pGEM®-T Vector using the pGEM®-T Easy
Vector Systems (Promega, Madison, WI) according to the manufacturer’s instructions. A
10 �l ligation reaction was set up for each sample along with a positive control using
control insert DNA provided with the kit and a negative control lacking DNA template.
Each reaction consisted of 5 �l of 2x rapid ligation buffer, 1 �l T4 DNA ligase, 1 �l
pGEM®-T vector (50 ng/ �l) and 150 ng of PCR product incubated overnight at 4°C.
2.7.6.3 Transformation and selection of clones
Transformation was performed using MAX Efficiency® DH5�™ Competent Cells
(Invitrogen, Carlsbad, CA). Competent cells were thawed on ice and a 50 �l suspension
was aliquoted into chilled microcentrifuge tubes containing 2 �l of ligation mixture.
Tubes were mixed by gentle flicking and incubated on ice for 30 minutes before
subjecting the transformation mix to heat shock at 42°C for 45 seconds in a water bath to
allow the uptake of plasmid into competent cells. Tubes were then returned to ice and
incubated for another 2 minutes, followed by the addition of 900 �l pre-warmed (37°C)
SOC medium. The transformed bacterial cells were allowed to recover by incubation at
Chapter 2 Methods and Materials 42
37°C with shaking at 231 rpm for one hour. A volume of 100 µl of each transformation
mix was plated onto duplicate, pre-cast LB agar plates supplemented with 0.05 mg/ml
ampicillin, 0.5 mM IPTG and 80 µg/ml X-Gal. Plates were incubated for 16 hours at
37°C to allow bacterial cell growth.
Recombinant clones were identified by colour screening, with white colour indicating
successful cloning of the insert leading to disruption of the �-galactosidase coding
sequence. To verify the insert was the actual target amplicon, selected white clones were
PCR amplified using the same primers as for the initial PCR. PCR products were resolved
by electrophoresis (QIAxcel system, Qiagen, Valencia, CA) to confirm the presence of
insert with correct amplicon. Positive clones carrying the desired inserts were inoculated
into 4 ml LB broth supplemented with 0.01 mg/ml ampicillin and incubated overnight at
37°C with continuous agitation (231 rpm) for 16 hours. Plasmid DNA was isolated using
the Wizard® Plus SV Miniprep DNA Purification System (Promega, Madison, WI)
according to the manufacturer’s instructions.
2.7.6.4 Sequencing of plasmid DNA
Ten clones of each sample were sequenced using the BigDye Terminator v 3.1 Cycle
Sequencing kit (Applied Biosystems, Foster City, CA) as per the manufacturer’s
instructions. Sequencing reactions contained 2 µl plasmid DNA, 2 µl sequencing buffer, 2
µl RR-100 Sequencing enzyme and 320 nM of M13-reverse primer: 5’ -
CAGGAAACAGCTATGACC – 3’ in a 20 µl total reaction volume. Sequencing
reactions were thermally cycled at 96°C for 1 minute, followed by 27 cycles of 96°C for
20 seconds, 50°C for 10 seconds and 60°C for 4 minutes before a final extension at 72°C
for 7 minutes. The products were then purified and precipitated using the ethanol/sodium
acetate method. Briefly, 4 µl sodium acetate (3M, pH 4.6) and 50 µl 100% EtOH were
Chapter 2 Methods and Materials 43
added to each sample and incubated on ice for 20 minutes to precipitate the extension
products. Tubes were then centrifuged for 20 min at 13,200 rpm and the resulting DNA
pellet was washed with 200 µl of 70% ethanol twice before drying in a vacuum
concentrator (MV-100 Micro Vac, Tomy Tech Inc, CA) for 15 minutes. Purified
sequencing products were analysed on a 3130xl Genetic Analyzer with a 50 cm array and
POP-7 polymer (Applied Biosystems, Foster City, CA). Resulting sequences were
processed for quality clipping using Sequencing Analysis 5.2 with the KB Basecaller
(Applied Biosystems, Foster City, CA) and analysed with Bioedit available at
http://www.mbio.ncsu.edu/BioEdit/bioedit.html (Ibis Bioscience, Carlsbad, CA).
2.7.7 Methylation analysis using Goldengate array
The Goldengate Cancer Panel I methylation array from Illumina (Illumina Inc., San
Diego, USA) is a hybridization-based array adapted from the single-nucleotide
polymorphism genotyping platform. It allows the analysis of methylation levels at 1,505
individual CpG sites contained within 808 cancer-related genes selected from published
literature. The array offers 96-sample throughput with 2.5% detection sensitivity and the
ability to distinguish differences of at least 17% in the methylation level (Bibikova and
Fan, 2009).
Each assay scheme uses two pairs of probes consisting of an allele-specific
oligonucleotide (ASO) and a locus-specific oligonucleotide (LSO) for interrogating CpG
dinucleotides in the methylated or unmethylated states. The 3’ end of the ASO binds to
the complementary “C” or “T” allele of the bisulfite-treated DNA (bsDNA) template,
while the 5’ end sequence is complementary to a universal primer sequence P1 or P2.
Complementary binding of the oligonucleotide is then extended and ligated to the LSO,
containing a locus-specific sequence at the 5’end, an address sequence in the middle
Chapter 2 Methods and Materials 44
complementary to a capture sequence on the array, and a 3’ end sequence which serves as
a universal PCR priming site. Extension and ligation of the ASO to the LSO forms the
template for subsequent PCR utilizing the universal primers P1, P2, and P3. Each of the
universal primers P1 and P2 are fluorescently labelled and correspond to the methylated
“C” or unmethylated “T” allele, respectively. The methylation level at each locus is
calculated from the ratio of intensity of the methylated “C” dye to the total intensity of the
locus.
Array-based methylation analysis in the current study was performed using the Sentrix
Array Matrix format (Illumina Inc., San Diego, USA) according to the manufacturer’s
instructions. Briefly, genomic DNA was subjected to sodium bisulfite conversion using
the EZ-DNA Methylation kitTM (Zymo Research, Orange, CA) and biotinylated. The
biotinylated bisulfite-treated DNA (BS-DNA) was then reconstituted in solution after
removal of excess biotin. Query oligonucleotides were annealed to the bsDNA and ligated
and extended to form DNA template for amplification. Amplified products were
hybridised to the array and dried for imaging using the BeadArray Reader (Illumina). The
BeadScan and the BeadStudio software package incorporated in the BeadArray Reader
(Illumina) were used for image processing, intensity data extraction and exporting the
array intensity data for statistical analysis, respectively.
2.8 Statistical analysis
Statistical analysis for each data set and the bioinformatics approaches used in the study
are detailed in the relevant Results chapters as appropriate.
Chapter 3 Quality control for bisulfite-PCR-based methylation analysis 45
Chapter 3. An improved quality control for bisulfite-PCR-based DNA
methylation analysis: cycle threshold value
3.1 BACKGROUND
Methylation of DNA is an epigenetic mechanism of gene regulation involved in both
physiological and pathological cellular processes (Rashid and Issa, 2004). Increasingly,
DNA methylation is being associated with disease risk, prognosis and treatment response,
indicating its detection to have diagnostic potential. This potential has in turn created a
need for accurate quality control systems for methylation analysis.
Of particular value would be a system for estimating the likely analytical reliability of a
sample, and guiding sample loading for efficient sample management. Today, the
majority of methylation analyses are bisulfite PCR-based approaches, such as methylation
specific PCR (MSP) (Herman et al., 1996b) and MethyLight (Eads et al., 2000). In the
absence of a suitable control system, the practice in almost all studies using these methods
has been to load a standard, large quantity (usually 1-2�g) of DNA based on
spectrophotometric measurement.
However, spectrophotometric analysis of DNA is susceptible to variations introduced by
buffer components, pH and UV-absorbing contaminants (Ellison et al., 2006; Haque et
al., 2003). Previously, we tested the hypothesis that cycle threshold (Ct) values in real-
time PCR (QPCR) analyses would be more accurate predictors of PCR reliability than
spectrophotometric concentration, as Ct values should be more direct measures of
amplifiable DNA (Soong and Ladanyi, 2003). Using sets of limiting dilution sample
series, our results showed Ct values indeed have a closer correlation to replicate detection
(qualitative) and Ct value (quantitative) reproducibility (Soong and Ladanyi, 2003).
Chapter 3 Quality control for bisulfite-PCR-based methylation analysis 46
It follows that Ct values could also be improved controls to spectrophotometric
assessment for bisulfite-PCR methylation analysis. However, bisulfite treatment causes
significant degradation of DNA (Munson et al., 2007), and could introduce factors that
affect PCR kinetics. To our knowledge, no systematic, direct evidence to support the use
of Ct values as controls for methylation analysis exists. This study tests whether the
superiority of Ct values to spectophotometry in predicting PCR detection reliability could
be applied to bisulfite PCR-based methylation analysis.
3.2 METHODS & MATERIALS
To generate a series of samples with varying analytical reliability, undiluted and 1:10
diluted DNA samples from 9 colorectal cancer cell lines (ATCC, Manassas, VA), were
prepared using the PureGene kit (Gentra Systems, Minneapolis, MN). One microliter of
each sample was used to determine DNA concentration based on spectrophotometric
absorbance at 260nm and the 260/280 absorbance ratio (Nanodrop ND-1000, Thermo
Fisher, Wilmington, DE). An equivalent 1µl of each sample was then also analyzed to
determine genomic DNA (gDNA) beta-actin (ACTB) Ct values by real-time PCR on the
ABI 7900HT Real Time PCR System (Applied Biosystems, Foster City, CA). PCR
amplification was performed in a 20µl volume comprising 600nmol/L of each primer,
200nmol/L probe and 1x Taqman Fast Universal PCR Master Mix (Applied Biosystems).
The primers and probe sequences were as follows: forward primer: 5’-
TCAGATCATTGCTCCTCCTG-3’, reverse primer: 5’-CTTGCTGATCCACAT-3’,
probe: 5’-FAM-CATCCTGGCCTCGCTGTCCA-TAMRA- 3’.
A further 1µl of each sample then underwent bisulfite treatment as described by Frommer
et al (Frommer et al., 1992). Briefly, 1µl of DNA was added to 3.1mol/L sodium bisulfite
Chapter 3 Quality control for bisulfite-PCR-based methylation analysis 47
and 5mmol/L hydroquinone, pH 5.0 and incubated at 50°C for 16 hours. The DNA was
then purified using the Wizard® DNA Clean-Up System (Promega, Madison, WI) and
resuspended in 20µl of 10mmol/L Tris-HCl (pH 8). Bisulfite DNA (bsDNA) Ct values for
ACTB were then determined in quintuplicate from 1µl aliquots using QPCR according to
MethyLight protocol of Eads et al. (Eads et al., 2000).
3.3 RESULTS
The replicate detection frequencies and standard deviations of bsDNA ACTB Ct values,
and gDNA ACTB Ct and spectrophotometric values are displayed in Table 3.1, and
plotted in Figure 3.1. Optimal thresholds for maximizing the accuracy of predicting
qualitative (detection in 5/5 replicates) and quantitative (Ct value standard deviation of
less than 1.0) reliability by spectrophotometry and Ct values were determined by
observation.
Consistent with our previous findings, gDNA Ct values correlated better with detection
reliability than spectrophotometric measurement. Using a threshold gDNA Ct value of
23.50, samples with consistent and inconsistent detection were correctly identified in 6/7
(86%) and 11/11 (100%) cases respectively (Figure 3.1A). Using an optimal threshold of
350ng/µl from spectrophotometric measurement of gDNA, the corresponding frequencies
were 6/8 (75%) and 10/10 (100%) respectively (Figure 3.1B). A major discrepancy was
the detection of two DNA samples with concentrations of 1271ng/�l and 2445ng/�l in 4/5
(80%) replicates. These samples had Ct values of 36.64 and 34.90 respectively and were
thus correctly identified by Ct values as unreliable (Table 3.1). In terms of quantitative
reliability, all 7/7 (100%) samples with Ct values below 23.50 were reliable, and 4/4
(100%) above 23.50 were unreliable (Figure 3.1C). The corresponding frequencies for
Chapter 3 Quality control for bisulfite-PCR-based methylation analysis 48
spectrophotometry using a threshold of 350ng/µl were lower at 6/8 (75%) and 2/3 (67%)
respectively (Figure 3.1D).
Using a spectrophotometric threshold of 1000ng/ul did not improve reliability prediction
accuracy: only 3/5 (60%) samples above this threshold were detected reliably and these
all had Ct values standard deviation of <1.0 (Table 3.1). Furthermore, the exclusion of
samples with A260/A280 ratios of <1.8 or >2.0 did not improve the reliability predicted
using spectrophotometric assessment.
Table 3.1 Association between detection frequencies, Ct values and their standard
deviations from quintuplicate ACTB analysis and bisulfite-treated DNA (bsDNA) Ct
values, genomic (gDNA) Ct values and spectrophotometric measurement.
ACTB (bsDNA) gDNA Spectrophotometry
Cell Line Dilution Detection aCt bSD Ct ng/ul 260/280 RKO 1:1 5/5 27.55 0.48 18.36 1932.0 1.93 SW620 1:1 5/5 28.39 0.37 20.12 1238.8 2.03 WiDR 1:1 5/5 30.06 0.74 21.01 399.2 1.85 LS174T 1:1 5/5 29.51 0.52 21.14 678.2 1.97 RKO 1:10 5/5 33.25 0.47 21.19 356.1 1.91 DLD1 1:1 5/5 32.38 0.99 23.43 1196.2 2.05 HCT116 1:1 4/5 34.90 1.12 23.65 2445.4 2.13 HT29 1:1 4/5 36.64 1.63 25.76 1271.6 2.07 Colo205 1:1 3/5 34.94 0.28 23.25 203.1 2.04 LS174T 1:10 2/5 36.97 1.99 25.29 61.0 1.87 WiDR 1:10 2/5 34.63 1.81 25.89 36.7 1.72 SW620 1:10 1/5 36.40 ND 23.65 322.5 1.99 HT29 1:10 1/5 38.04 ND 29.26 112.6 2.03 Colo205 1:10 0/5 40.00 ND 27.12 18.9 1.74 HCT116 1:10 0/5 40.00 ND 27.67 233.9 2.13 DLD1 1:10 0/5 40.00 ND 27.71 100.7 2.08 SW480 1:1 0/5 40.00 ND 30.53 0.6 0.32 SW480 1:10 0/5 40.00 ND 34.04 ND 1.27 ND = not determinable a average Ct from 5 replicate analysis b Standard deviation (SD) from detected replicates
Chapter 3 Quality control for bisulfite-PCR-based methylation analysis 49
0.00
0.50
1.00
1.50
2.00
2.50
15 20 25 30 35
genomic DNA Ct
Ct
Sta
nda
rd D
evia
tion
0
1/5
2/5
3/5
4/5
1
1 1/5
15 20 25 30 35
genomic DNA Ct
0
1/5
2/5
3/5
4/5
1
1 1/5
0 1 2 3 4
log A260 concentration (ng/ul)
B
0.00
0.50
1.00
1.50
2.00
2.50
0 1 2 3 4
log A260 concentration (ng/ul)
Ct
Sta
nd
ard
Dev
iati
on
D
A
C
0/5
Det
ectio
n of
AC
TBby
QP
CR
0/5
5/5D
etec
tion
of A
CTB
by Q
PC
R
0/5
5/5
0.00
0.50
1.00
1.50
2.00
2.50
15 20 25 30 35
genomic DNA Ct
Ct
Sta
nda
rd D
evia
tion
0
1/5
2/5
3/5
4/5
1
1 1/5
15 20 25 30 35
genomic DNA Ct
0
1/5
2/5
3/5
4/5
1
1 1/5
0 1 2 3 4
log A260 concentration (ng/ul)
B
0.00
0.50
1.00
1.50
2.00
2.50
0 1 2 3 4
log A260 concentration (ng/ul)
Ct
Sta
nd
ard
Dev
iati
on
D
A
C
0/5
Det
ectio
n of
AC
TBby
QP
CR
0/5
5/5D
etec
tion
of A
CTB
by Q
PC
R
0/5
5/5
Figure 3.1 Association between genomic DNA Ct values (A, C) and spectrophotometric
concentration (B, D) and detection of bsDNA ACTB by QPCR (A, B) and Ct value
standard deviation (C, D). Samples for which reliability is wrongly predicted by the
respective methods are circled with dashed lines.
To further test the validity of Ct values as a quality control, DNA was extracted from 40
formalin fixed and paraffin-embedded tissue (FFPET) samples of colorectal tumours as
described previously (Soong and Iacopetta, 1997). As before, 1�l of FFPET DNA was
quantified by spectrophotometry and 1�l by QPCR for ACTB gDNA. Another 1�l
underwent bisulfite treatment using the EZ DNA Methylation kit according to the
Chapter 3 Quality control for bisulfite-PCR-based methylation analysis 50
manufacturer’s instructions (Zymo Research, Orange, CA) and was eluted in 20�l
10mmol/L Tris-HCl (pH 8) and used immediately. Two microliters of the resulting
bsDNA was then analyzed in quintuplicate for MLH1 methylation by MSP with primers
as described previously (Herman et al., 1996):
methylated-sense, 5'-ACGTAGACGTTTTATTAGGGTCGC-3'
methylated-antisense, 5'-CCTCATCGTAACTACCCGCG-3'
unmethylated-sense, 5'-TTTTGATGTAGATGTTTTATTAGGGTTGT-3'
unmethylated antisense, 5'-ACCACCTCATCATAACTACCCACA-3')
FFPET DNA samples were deemed reliable if consistent results (detected in 5/5, or not
detected in 5/5) were observed using methylated (“M”) and unmethylated (“U”) primer
sets. Using this criteria, 29 of the 40 samples were reliable and 11 unreliable for MSP
analysis.
Table 3.2 displays the quintuplicate MSP results, spectrophotometric concentrations and
gDNA Ct values of respective samples. Optimal thresholds for maximally distinguishing
reliable from unreliable samples were determined by sorting for reliability status, Ct
values and spectrophotometric concentration. Corroborating the findings with cell line
DNA, gDNA Ct values were better indicators of sample reliability than
spectrophotometric concentration. All samples with gDNA Ct values below a threshold of
26.00 were reliably detected (25/25, 100%) and 11/15 (73%) above this threshold were
unreliably detected. Using spectrophotometry and a threshold of 350ng/µl, the
corresponding frequencies were 11/14 (79%) and 8/26 (31%). Even with the use of other
thresholds (1000, 400, 300, 200, 100ng/µl), the prediction accuracy did not attain the
level achieved by Ct values (results not shown).
Chapter 3 Quality control for bisulfite-PCR-based methylation analysis 51
Table 3.2 Analytical reliability of bisulfite-DNA as defined by MSP analysis of
MLH1 and its concordance with assessment by genomic DNA Ct values of ACTB and
spectrophotometry concentrations.
Case U1 U2 U3 U4 U5 M1 M2 M3 M4 M5 bStatus
cObserved Reliability Ct Value
Predicted Reliability ng/ul
Predicted Reliability
3 + + + + + + + + + + P R 22.46 R 360.09 R6 + + + + + + + + + + P R 23.14 R 372.69 R221 + + + + + + + + + + P R 24.72 R 394.30 R17 + + + + + + + + + + P R 25.78 R 509.60 R285 + + + + + + + + + + P R 25.32 R 584.12 R201 + + + + + + + + + + P R 24.99 R 655.99 R5 + + + + + - - - - - U R 24.06 R 414.39 R13 + + + + + - - - - - U R 21.97 R 544.89 R11 + + + + + - - - - - U R 23.37 R 647.30 R9 + + + + + - - - - - U R 22.64 R 1037.59 R16 + + + + + + + + + + P R 25.38 R 70.72 U14 + + + + + + + + + + P R 24.62 R 74.82 U19 + + + + + + + + + + P R 24.45 R 84.30 U57 + + + + + + + + + + P R 25.14 R 127.24 U8 + + + + + + + + + + P R 23.05 R 344.99 U30 + + + + + - - - - - U R 25.65 R 61.55 U31 + + + + + - - - - - U R 25.67 R 92.95 U7 + + + + + - - - - - U R 23.38 R 117.93 U18 + + + + + - - - - - U R 24.29 R 139.52 U4 + + + + + - - - - - U R 25.23 R 187.95 U1 + + + + + - - - - - U R 24.81 R 227.59 U12 + + + + + - - - - - U R 25.47 R 236.02 U15 + + + + + - - - - - U R 22.47 R 246.64 U10 + + + + + - - - - - U R 23.66 R 273.01 U2 + + + + + - - - - - U R 24.68 R 295.62 U273 + + + + + + + + + + P R 27.37 U 599.23 R64 + + + + + - - - - - U R 26.95 U 50.56 U58 + + + + + - - - - - U R 27.51 U 42.24 U111 + + + + + - - - - - U R 27.72 U 269.97 U
67 + + + + + - + + + + - U 26.34 U 131.02 U43 + + + + + + - + + + - U 26.39 U 104.20 U65 + + + + + - - + - - - U 26.70 U 113.46 U66 + + + + + + - - + + - U 27.38 U 87.56 U68 + + + - - + + + + + - U 29.01 U 48.30 U45 + - + - - - - - - - - U 26.28 U 59.96 U55 + - + + - - - - - - - U 26.31 U 41.60 U59 - + - + - + + - + + - U 26.43 U 128.28 U268 + + + + + - + + + - - U 26.80 U 399.91 R110 + + + + + + - + + + - U 31.38 U 618.49 R99 + + + + + + + - + + - U 40.00 U 878.41 Ra Results of 5 PCRs with primers specific to unmethylated (U) and methylated (M) DNA, - = negative, + = positiveb Unmethylated (U), Partially methylated (P), Methylated (M)c Reliable (R), Unreliable in replicate analyses (U)
QPCR of gDNA ACTB SpectrophotometryaMethylation Specific PCR of MLH1
3.4 DISCUSSION
Taken together, the above results indicate that Ct values could be useful indicators for
predicting the reliability of a sample for bisulfite-PCR based methylation analysis. In both
cell lines (Figure 3.1) and FFPET samples (Table 3.1), Ct values had a closer correlation
to the qualitative and quantitative reliability of samples than spectrophotometric
assessment. These correlations were observed using multiple methods of DNA extraction,
bisulfite treatment and methylation analysis, highlighting their robustness.
Chapter 3 Quality control for bisulfite-PCR-based methylation analysis 52
A key finding was that 18/26 (69%) of samples identified to be unreliable by
spectrophotometry were reliable in MSP analysis, compared to 4/15 (27%) using Ct
values (P<0.05). FFPET samples are a significant resource for methylation analysis
because of their central involvement in diagnostic workflows and the large repositories of
archival tissues. Formalin fixation leads to considerable fragmentation of DNA (Gilbert et
al., 2007); however its effect on methylation analytical processes has not been tested.
Since most standard bisulfite treatment protocols use 1-2µg of DNA measured
spectrophotometrically as starting material (Clark et al., 2006), the current results infer
that a large number of FFPET samples are being unnecessarily disqualified from analysis
or used in excess based on spectrophotometric analysis. This provides a strong case for
the use of Ct values.
Ct values were tested against spectrophotometric concentrations in this study, as they are
the most commonly used measure for controlling sample reliability in current methylation
analyses. Nevertheless, a Ct value system is also likely to have advantages over other
potential control systems. Its measure of PCR-amplifiable DNA should make it more
accurate than measures from fluorescent double-stranded DNA binding dyes, such as
PicoGreen, which are less sensitive to factors such as PCR inhibitors. Recently, Ehrich et
al. (Ehrich et al., 2007) proposed a system based on measuring the amplification success
of replicates of bsDNA PCR amplicons of decreasing length on mass spectrometers. In
comparison, the Ct value system stands to be simpler and faster as it involves a single
gDNA Ct measurement in a 1-2 hour QPCR run. Moreoever, QPCR instrumentation is
common in many laboratories today, making the system more amenable to
standardization. Critically, the Ct value system is based on gDNA compared to bsDNA,
for which a measurement would be too late to enable sample adjustment or sample
exclusion and reagent conservation.
Chapter 3 Quality control for bisulfite-PCR-based methylation analysis 53
An alternative approach to this study would have been to ascertain reliability thresholds
for both Ct and spectrophotometric approaches, adjust sample loading to these thresholds,
and then evaluate the qualitative and quantitative reliability of the samples. However, this
design was found to be impractical, given the low concentrations and volumes of many of
the samples in the study (Table 3.1, Table 3.2). Moreover, by loading 1 µl for each
control system, the current study design avoids the bias that would likely be introduced by
the irregular sample loading adjustments required.
The experiments in this small study were simply designed to test whether Ct or
spectrophotometric values would be better indicators of reliability for methylation
analysis. In this respect, they have made an important step in providing evidence showing
Ct values to have a better correlation with bisulfite-PCR reliability. The application of the
Ct value system is likely to be amplicon and assay specific. The optimal Ct value
thresholds for reliability differed for the measurement of ACTB by MethyLight (23.50)
and MLH1 bsDNA by MSP (26.00), likely reflecting the differing detection limits and
amplification efficiencies of the respective assays and PCR amplicons. Previously, we
found that Ct value thresholds for PCR reliability could be determined from the values at
which analytical unreliability occurred in replicate limiting dilution series (Soong and
Ladanyi, 2003). The evidence suggested that the thresholds were independent of the
sample used. This suggests a standard procedure for implementing a Ct value control
system could be to ascertain reliability thresholds for a given assay through limiting
dilutions of an abundant sample (eg. cell line DNA), followed by single analyses of test
samples. Based on PCR doubling kinetics and Ct values, the suitability of samples for
analysis could then be quantitatively assessed, and the suitable samples loaded to
maximize sample utility and reliability. The value of a Ct value control system will be
demonstrated by its use in future studies.
Chapter 4 RUNX3 and DPYD methylation 55
Chapter 4. Identification of CpG sites in the RUNX3 and DPYD genes
associated with expression level
4.1 BACKGROUND
DNA methylation of CGIs in gene promoters is an important gene regulatory mechanism
for tissue-specific gene expression during normal development. It is an alternative
mechanism for the disruption of many cellular pathways in complex diseases including
cancers. Most studies that have investigated possible mechanistic links between DNA
methylation and gene expression are limited by the non-quantitative assessment of
methylation at arbitrarily chosen CpG sites. Consequently, real associations between
DNA methylation and the end-point of interest could be masked by the lack of correlation
between gene expression and methylation at the probed CpG sites.
Methylation analysis at non-informative CpG sites can have significant implications, as
exemplified by studies on MLH1 and MGMT methylation in cancer. Hypermethylation-
induced silencing of MLH1 expression occurs when the proximal, but not distal, region of
the MLH1 promoter is methylated, resulting in the MSI+ phenotype in a subset of
sporadic CRC (Capel et al., 2007; Deng et al., 1999). Similarly, the selection of different
promoter regions for analysis of methylation may contribute to the discordant correlation
between MGMT hypermethylation and MGMT RNA expression observed in gliomas
(Brell et al., 2005; Everhard et al., 2009) and CRC (Nagasaka et al., 2008a; Shen et al.,
2005).
An approach is required to identify CpG sites whose methylation is most closely
associated with gene silencing. Validation of this approach would be of great benefit for
Chapter 4 RUNX3 and DPYD methylation 56
the design of methylation assays that assess possible functional effects of this epigenetic
alteration in tumour cells.
Hypermethylation of RUNX3 and DPYD have been implicated in the response and
toxicity to 5-fluorouracil (5-FU) (Ezzeldin et al., 2005; Schwab et al., 2008; Yu et al.,
2006) and in the pathogenesis of CRC (Goel et al., 2004; Ku et al., 2004), respectively.
Discrepant reports for the correlation between DPYD methylation and toxicity to 5-FU
(Schwab et al., 2008; Yu et al., 2006) or DPD defienciency (Ezzeldin et al., 2005) may be
due to the lack of consensus CpG methylation sites that are linked to RNA expression.
Methylation-induced transcriptional silencing and hence inactivation of RUNX3 is a
common phenomenon in CRC cell lines (Goel et al., 2004; Ku et al., 2004). RUNX3
methylation has been identified as one of the most sensitive and specific markers for the
CIMP+ subgroup of CRC (Ogino et al., 2007a; Weisenberger et al., 2006a) and has also
been proposed as an important tumour suppressor gene in gastrointestinal cancers (Ito et
al., 2008). Therefore, identification of the CpG sites within the RUNX3 promoter whose
methylation is most tightly linked to RNA expression would help to determine the
functional significance of RUNX3 methylation in CIMP+ tumours.
The current study used a bioinformatics approach to identify CpG sites in the RUNX3 and
DPYD promoters whose methylation regulates RNA expression in CRC cell lines. The
putative CpG sites whose methylation was linked to the expression of these genes in vitro
were then assessed in primary tumours for a similar link with RNA expression.
Chapter 4 RUNX3 and DPYD methylation 57
4.2 METHODS AND MATERIALS
4.2.1 Sample processing and analyses
CRC cell lines and clinical samples used for the study were obtained and processed as
described in Chapter 2. RNA quantification and DNA methylation analysis using bisulfite
clonal sequencing (bsSEQ), Pyrosequencing and MethyLight were carried out following
the protocols described in Chapter 2. Lengths of sequence 5000bp upstream and 5000bp
downstream of the transcription start site were evaluated for the presence of CGI as
described in Chapter 2. Identified CGIs were then analysed for methylation at individual
CpG sites using bsSEQ in 10 CRC cell lines. Single and multiple CpG loci whose
methylation was associated with RNA level in CRC cell lines were identified and further
evaluated in primary CRC.
4.2.2 Identifying individual CpG sites correlated with RNA expression
To identify individual CpG sites whose methylation regulates RNA expression, bsSEQ
methylation data derived from 10 CRC cell lines was evaluated by ridge regression (RR)
analysis as described by Myers (Myers, 1992). Subsets of candidate CpGs linked to
expression were selected based on ridge parameter, �, or Mallow’s Cp criterion where
appropriate (Whittaker et al., 2000) using bootstrap resampling. The performance of
candidate CpGs was then examined based on the goodness-of-fit of the predicted RNA
expression to the observed RNA expression. Methylation of candidate CpG sites in
RUNX3 and DPYD was assessed in primary CRC using Pyrosequencing assays.
4.2.3 Identifying multiple adjacent CpG sites correlated with RNA expression
The correlation between concurrent methylation at multiple adjacent CpG sites and RNA
level was evaluated using bsSEQ methylation data from 10 CRC cell lines. Simulated
MethyLight assays for multiple adjacent CpG sites were developed using optimal
Chapter 4 RUNX3 and DPYD methylation 58
specifications for each oligonucleotide (Weisenberger et al., 2006a) (Supplementary
Table 4.1). Lengths of the forward primer (F), probe (P) and reverse primer (R) were set
at 21 bp, 24 bp and 21 bp respectively. P was placed 7 bp from the end of F, while R was
positioned 13 bp after the end of P. For each amplicon, the first configuration was placed
at the first available CpG, corresponding to the start of the forward primer. Each assay
targeted a minimum of 5 CpGs in the whole amplicon. Successive configuration was then
started with the next adjacent CpG. Using the bsSEQ methylation data from cell lines, a
clone was classified as being methylated only when all targeted CpGs were methylated
for each of the simulated MethyLight assays. The methylation score for each cell line was
thus the proportion of clones methylated for the particular cell line. Leave-one-out cross
validation was performed on the simulated MethyLight methylation data to identify the
cluster of neighbouring CpG sites most strongly linked to RNA expression.
4.2.4 Correlation between methylation at candidate expression-linked CpG sites
and RNA levels in primary tumors
Pyrosequencing was used to measure the methylation of individual candidate CpG sites,
thus allowing correlation with RNA expression levels in tumours. Only samples with at
least two CpG sites successfully analysed were included in subsequent analysis. CpG sites
that gave readings of 0% in all samples were also excluded from subsequent analysis.
Independent t-test of RNA expression was performed to examine for potential systemic
bias in samples that had non-detectable levels of methylation at candidate CpG sites.
Missing methylation values were imputed using the K-nearest neighbour (KNN) method
as described by Hastie et al (http://cran.r-project.org/) (Hastie et al., 1999). Euclidean
distance was used as the metrics for identification of K closest. Bayesian analysis was
conducted to predict RNA expression based on methylation levels at individual CpG sites
measured using Pyrosequencing in the tumours. Bayesian analysis was carried out using
Chapter 4 RUNX3 and DPYD methylation 59
WinBUGS (Lunn et al., 2000). A predictive score derived from the Bayesian analysis was
then used to classify samples as having above- or below-median RNA expression based
on an optimal threshold, c, determined by a receiver operating characteristics (ROC)
curve.
4.3 RESULTS
4.3.1 Methylation of CpG sites in the RUNX3 and DPYD promoters correlates with
RNA expression in CRC cell lines
Ridge regression (RR) modelling as described in 4.2.2 demonstrated that the level of
overall methylation at all CpG sites was able to predict RNA expression. The RNA levels
predicted from overall methylation correlated very closely with the observed RNA levels
(RUNX3, r2=0.9928; DPYD, r2=0.9999; Figure 4.1).
To identify the combination of individual CpG sites whose methylation was most closely
associated with RNA expression, optimum ridge parameter (�) was determined from RR
analysis. This factor indicates the minimum number of CpG sites needed to predict RNA
expression based on their methylation level. � was determined to be e-2 and e-8 for RUNX3
and DPYD respectively (Figure 4.2), corresponding to methylation at 8 CpG sites for
RUNX3 and 9 CpG sites for DPYD. At these optimal � values, the predicted RNA
expression showed high correlation to the observed RNA expression (RUNX3, r2=0.859;
DPYD, r2=1.000; Figure 4.3). The 8 CpG sites for RUNX3 relative to the transcriptional
start site and ranked according to their contribution to the prediction of RNA expression
were +279, -789, -10, +180, -515, -719, -1035, -826. For DPYD the 9 CpG sites were
+152, -72, -86, +235, +196, -78, -31, +249, -20.
Chapter 4 RUNX3 and DPYD methylation 60
4.3.2 Methylation at multiple adjacent CpG sites is poorly correlated to RNA levels
in CRC cell lines
MSP and MethyLight are based upon the analysis of multiple adjacent CpG sites for
methylation status. Using methods described in 4.2.3, we evaluated methylation levels at
multiple adjacent CpG sites, or clusters, for correlation with RNA expression. The top
ranking cluster of CpG sites for RUNX3 (+132, +141, +148, +150, +154, +166, +170,
+180, +195, +201, +207, +211) was poorly predictive of RNA expression (r2=0.082,
Figure 4.4). The top ranking CpG cluster for DPYD (+10, +12, +17, +56, +84) was more
predictive but still relatively low (r2=0.444, Figure 4.4).
4.3.3 Expression-related CpG sites identified in CRC cell lines failed to predict
RNA expression in primary tumors
Of the 8 and 9 CpG sites identified in CRC cell lines as being linked to RNA expression
of RUNX3 and DPYD, respectively, one CpG site in each gene was excluded from
analysis in the primary tumours due to absence of methylation in all samples. The
methylation status of the remaining 7 and 8 CpG sites was used to predict RNA
expression using Bayesian analysis as described in 4.2.4. Independent t-test of RNA
expression found there was no systemic bias in samples with non-detectable methylation
at these CpG sites. A predictive score (PS) was formulated for each of RUNX3 and DPYD
to calculate RNA expression based on methylation levels at the expression-linked CpG
sites. Using the optimal threshold determined from the ROC, RNA levels in the primary
tumours were predicted with the following accuracy: RUNX3, sensitivity = 57.5%,
specificity = 47.8%; DPYD, sensitivity = 58.3%; specificity = 66.7% (Figure 4.5).
Comparison between methylation levels at CpG sites measured in both the cell lines and
tumours showed generally lower methylation levels of RUNX3 and DPYD in the tumours
than in the cell lines with less variation (Figure 4.6).
Chapter 4 RUNX3 and DPYD methylation 61
-14 -12 -10 -8 -6
3.70
3.75
3.80
3.85
Mallows
Cp
log �
RUNX3 DPYD
Ridge parameter estimated with Mallow’s Cp
Ridge parameter predicted with cross-validation
Mal
low
’s C
p
E(R
SS) v
alid
atio
n
log �-14 -12 -10 -8 -6
3.70
3.75
3.80
3.85
Mallows
Cp
log �
RUNX3 DPYD
Ridge parameter estimated with Mallow’s Cp
Ridge parameter predicted with cross-validation
Mal
low
’s C
p
E(R
SS) v
alid
atio
n
log �
Figure 4.1 Correlation between RNA levels predicted by ridge regression modelling of
methylation data at individual CpG sites and observed RNA expression in 10 CRC cell
lines for RUNX3 and DPYD. RNA levels are presented on a log scale.
Figure 4.2 Optimum ridge parameter, �, for RUNX3 was �=e-2 and DPYD, �=e-2 where
the residual sum of squared errors are at their lowest.
-6 -4 -2 0
-6-4
-20
RUNX3 DPYD
log
RN
A le
vel (
pred
icte
d)
log
RN
A le
vel (
pred
icte
d)
log RNA level (observed) log RNA level (observed)
r2=0.9928 r2=0.9999
-6 -4 -2 0
-6-4
-20
RUNX3 DPYD
log
RN
A le
vel (
pred
icte
d)
log
RN
A le
vel (
pred
icte
d)
log RNA level (observed) log RNA level (observed)
r2=0.9928 r2=0.9999
Chapter 4 RUNX3 and DPYD methylation 62
log RNA level (observed) log RNA level (observed)
log
RN
A le
vel (
pred
icte
d)
log
RN
A le
vel (
pred
icte
d)
DPYDRUNX3
r2=0.444r2=0.082
log RNA level (observed) log RNA level (observed)
log
RN
A le
vel (
pred
icte
d)
log
RN
A le
vel (
pred
icte
d)
DPYDRUNX3
r2=0.444r2=0.082
Model fitted with 8 CpG sites Model fitted with 9 CpG sites
-6 -4 -2 0
-7-6
-5-4
-3-2
-10
log
RN
A le
vel (
pred
icte
d)
log RNA level (observed)
log
RN
A le
vel (
pred
icte
d)
log RNA level (observed)
RUNX3 DPYD
r2=0.859 r2=1.000
Model fitted with 8 CpG sites Model fitted with 9 CpG sites
-6 -4 -2 0
-7-6
-5-4
-3-2
-10
log
RN
A le
vel (
pred
icte
d)
log RNA level (observed)
log
RN
A le
vel (
pred
icte
d)
log RNA level (observed)
RUNX3 DPYD
r2=0.859 r2=1.000
Figure 4.3 Methylation of candidate CpGs sites identified by ridge-regression predicted
RNA levels that showed perfect correlation with observed RNA expression for RUNX3
and DPYD (r2=1.000).
Figure 4.4 Correlation between the observed RNA expression and RNA levels predicted
by methylation levels at multiple adjacent CpG sites for RUNX3 and DPYD in CRC cell
lines.
Chapter 4 RUNX3 and DPYD methylation 63
Area under ROC curve = 0.5056 Area under ROC curve = 0.6489
0.00
0.25
0.50
0.75
1.00
Sen
sitiv
ity
0.00 0.25 0.50 0.75 1.001 - Specificity
0.00
0.25
0.50
0.75
1.00
Sen
sitiv
ity
0.00 0.25 0.50 0.75 1.001 - Specificity
RUNX3 DPYD
Area under ROC curve = 0.5056 Area under ROC curve = 0.6489
0.00
0.25
0.50
0.75
1.00
Sen
sitiv
ity
0.00 0.25 0.50 0.75 1.001 - Specificity
0.00
0.25
0.50
0.75
1.00
Sen
sitiv
ity
0.00 0.25 0.50 0.75 1.001 - Specificity
RUNX3 DPYD
Figure 4.5 Receiver operating characteristic (ROC) curve showing sensitivity and
specificity of predicted RNA expression calculated using methylation predictive score for
RUNX3 and DPYD.
Chapter 4 RUNX3 and DPYD methylation 64
0
20
40
60
80
100
Perc
enta
ge o
f met
hyla
tion
(Pyr
oseq
uenc
ing)
-1035
T CL
-826
T CL
-789
T CL
-719
T CL
-515
T CL
-10
T CL
180
T CL
279
T CL
RUNX3 CpG sites
0
20
40
60
80
100
Perc
enta
ge o
f met
hyla
tion
(Pyr
oseq
uenc
ing)
-1035
T CL
-826
T CL
-789
T CL
-719
T CL
-515
T CL
-10
T CL
180
T CL
279
T CL
RUNX3 CpG sites
0
20
40
60
80
100
Perc
enta
ge o
f met
hyla
tion
(Pyr
oseq
uenc
ing)
-86
T CL
-78
T CL
-72
T CL
-31
T CL
-20
T CL
+152
T CL
+196
T CL
+235
T CL
+249
T CL
DPYD CpG sites
0
20
40
60
80
100
Perc
enta
ge o
f met
hyla
tion
(Pyr
oseq
uenc
ing)
-86
T CL
-78
T CL
-72
T CL
-31
T CL
-20
T CL
+152
T CL
+196
T CL
+235
T CL
+249
T CL
DPYD CpG sites
Figure 4.6 Distribution of methylation levels in cell lines and primary CRC for RUNX3
and DPYD at individual CpG sites. T, primary tumour; CL, CRC cell lines. Line bar
indicates median methylation value.
Chapter 4 RUNX3 and DPYD methylation 65
4.4 DISCUSSION
The present study identified CpG sites in the RUNX3 and DPYD promoters whose
methylation in CRC cell lines correlates with RNA expression. In silico modelling of
DNA methylation was used to identify CpG sites whose methylation was linked to RNA
expression. Although these candidate CpG sites were able to predict RNA expression
with high accuracy in CRC cell lines (Figure 4.3), they failed to predict RNA expression
in primary CRC (Figure 4.5). This may be due to fundamental differences in methylation
patterns between CRC cell lines and primary tumours (Paz et al., 2003; Suter et al.,
2003).
Methylation levels of RUNX3 and DPYD were generally lower in primary tumours
compared to CRC cell lines, particularly for DPYD (Table 4.1). This agrees with previous
reports in CRC cell lines for a number of CpG islands including hMLH1, p16, various
MINT’s and MGMT (Paz et al., 2003; Suter et al., 2003). Paz et al suggested the higher
methylation levels in cell lines may be due to the very high folate concentrations present
in culture media. Cultured cells are most susceptible to DNA methylation changes during
early population doublings (Allegrucci et al., 2007). In the present study, standardised
culture conditions and cell passages were used to try and minimize variation in
methylation. Another possible explanation for the lower overall methylation level of
primary tumours is because of their contamination with non-tumoural stromal cells and
lymphocytes having low methylation. As discussed further below, the poor correlation in
methylation levels obtained using the different techniques for methylation analysis
(bsSEQ and pyrosequencing) could also contribute to the differences observed between
cell lines and primary tumours.
Chapter 4 RUNX3 and DPYD methylation 66
In addition to lower overall methylation levels, primary CRC also showed less variation
in the methylation of individual CpG sites compared to cell lines (Table 4.1,
Supplementary Figure 4.1). This parallels the dichotomous methylation status (all or none
of the adjacent CpG sites methylated) reported previously in primary CRC for DPYD (Yu
et al., 2008). It also agrees with the previously reported interdependence in methylation of
adjacent CpG sites in tumours (Lacey and Ehrlich, 2009). The in silico model developed
in the present study was based on cell lines that exhibited highly variable levels of
methylation across different CpG sites. The limited variation in methylation level of
primary tumours may therefore explain the inability of the candidate panel of individual
CpG sites to predict RNA expression.
One of the limitations of this study was the detection sensitivity of Pyrosequencing for
methylation, estimated at approximately 10% (Reed et al., 2009; Tost et al., 2003). This
may have reduced the sensitivity for detection of low levels of RUNX3 and DPYD
methylation in primary tumours. It is unlikely that imputation of methylation data for
samples that failed to give a result in the Pyrosequencing assay could explain the lack of
correlation between observed and predicted RNA expression in primary tumours. KNN
imputation for 20% of missing data is associated with a 10% reduction in accuracy
(Troyanskaya et al., 2001). The KNN approach is better than other commonly used
methods for the imputation of missing data such as “row average method” or “filling
missing values with zeroes” (Scheel et al., 2005).
In conclusion, the overall methylation level at a panel of individual candidate CpG sites
could accurately predict RNA expression for RUNX3 and DPYD in CRC cell lines. This
study provides a theoretical basis for the objective selection of CpG sites whose
methylation is linked to RNA expression in cancer cell lines. Methylation levels across
Chapter 4 RUNX3 and DPYD methylation 67
multiple adjacent CpG loci failed to correlate with RNA expression in cell lines.
Moreover, the model built upon observations made in CRC cell lines was unable to
predict RNA expression in primary CRC. The discordance between cell lines and primary
tumours is likely to relate to the substantial qualitative and quantitative differences in
methylation patterns between these samples.
Table 4.1 Mean methylation levels of RUNX3 and DPYD at individual candidate CpG sites in cell
lines and primary CRC.
RUNX3 n1 Cell line Mean ± SD CRC mean ± SD P-value2
-1035 82 79.2 ± 32.5 38.0± 14.4 0.002
-826 61 45.8 ± 41.0 55.8 ± 35.6 0.650
-789 77 58.3 ± 33.5 36.4 ± 32.1 0.871
-719 77 72.0 ± 26.7 32.1 ± 31.6 0.479
-515 65 73.0 ± 30.4 5.3 ± 14.2 0.008
-10 84 55.8 ± 23.4 37.6 ± 19.6 0.267
180 75 72.0 ± 39.5 6.5 ± 15.5 0.000
279 72 88.2 ± 31.2 11.5 ± 23.1 0.751
DPYD
-86 70 53.3 ± 28.8 0.6 ± 4.8 0.000
-78 70 26.3 ± 20.2 0.6 ± 4.7 0.000
-72 69 97.0 ± 5.8 0.0 ± 0.0 0.000
-31 79 17.7 ± 24.4 1.3 ± 6.4 0.000
-20 79 12.0 ± 22.0 2.7 ± 12.5 0.013
152 95 5.3 ± 9.9 9.0 ± 12.4 0.259
196 93 59.1 ± 19.1 5.8 ± 8.5 0.000
235 85 13.8 ± 21.2 7.9 ± 12.5 0.057
249 76 9.6 ± 17.6 5.9 ± 8.9 0.045 1Total number of tumours successfully analysed using Pyrosequencing at each CpG site. A total
of 10 CRC cell lines was analysed at all CpG sites using bsSEQ.
2P-value derived from Levene’s test for equality of variances.
Chapter 5 Characterization of methylated subgroups in CRC 68
Chapter 5. Comprehensive profiling of DNA methylation in colorectal
cancer reveals three subgroups with distinct clinicopathological and
molecular features
5.1 BACKGROUND
DNA hypermethylation-induced gene silencing is a common event in many malignancies
and serves as an alternative mechanism to genetic mutation for the loss of tumour
suppressor functions (Esteller, 2008; Issa, 2004). Although the mechanisms that underlie
aberrant DNA methylation in cancer cells remain to be elucidated, current evidence
suggests that it may be an early and possibly even an initiating event in the development
of CRC.
A subset of CRC has been shown to exhibit frequent and concurrent hypermethylation at
specific gene promoters and is referred to as the CpG island methylator phenotype
(CIMP+) (Toyota et al., 1999b). CIMP+ CRC is associated with distinct
clinicopathological and molecular features including proximal tumour location,
preponderance in elderly females, poorly differentiated and mucinous tumour histology,
MSI and frequent BRAF V600E mutation (Barault et al., 2008b; Hawkins et al., 2002;
Ogino et al., 2006b; Ogino et al., 2007b; Samowitz et al., 2005c; Toyota et al., 1999b;
van Rijnsoever et al., 2002; Weisenberger et al., 2006b). CIMP+ CRC often lack the
hallmark genetic alterations in APC, p53 and 18q that characterize the classic adenoma-
carcinoma sequence. Instead, CIMP+ tumours are thought to develop along an alternate
serrated adenoma pathway in which hypermethylation rather than mutation is used to
inactivate tumour suppressor genes (Jass, 2007c).
Chapter 5 Characterization of methylated subgroups in CRC 69
In an effort to establish CIMP+ CRC as a distinct subgroup of CRC, Laird and colleagues
analysed the methylation of 195 individual gene promoter regions in 295 CRC using the
quantitative MethyLight assay (Weisenberger et al., 2006b). From their results, they
proposed a panel of 5 CpG island methylation markers to standardize the classification of
CIMP+ CRC. However, different groups have continued to use a variety of methylation
markers to define CIMP+ CRC (Ferracin et al., 2008a; Nagasaka et al., 2008b; Ogino et
al., 2007b; Shen et al., 2007b). The lack of consensus markers has led to reports of
several CIMP subgroups according to the frequency of CpG island methylation
(Kawasaki et al., 2008; Nagasaka et al., 2008b; Shen et al., 2007b). The investigators
who originally proposed CIMP recently described two subgroups of CIMP+, termed
CIMP-1 and CIMP-2, that displayed increased frequencies of BRAF and KRAS mutations,
respectively (Shen et al., 2007b). Similarly, Nagasaka et al described two distinct patterns
of gene methylation in CRC that also segregated with BRAF and KRAS mutations
(Nagasaka et al., 2008b; Nagasaka et al., 2004). Using a panel of 8 methylation markers,
Ogino et al identified a CRC subgroup which they termed CIMP-low that was associated
with frequent KRAS mutation, MGMT methylation and occurrence in males (Ogino et al.,
2006c).
Most previous studies of CIMP+ CRC have investigated a relatively small number of
CpG island markers for methylation. The GoldenGate Methylation BeadArray (Illumina,
Inc.) technology provides the opportunity for high-throughput methylation analysis of a
large number of CpG sites. In the present study the GoldenGate Methylation Cancer
Panel I containing 1,505 CpG loci within 807 cancer-related genes was used to study
methylation patterns in 91 unselected CRC. These genes were selected based on their
involvement in cell growth control, differentiation, migration, apoptosis, DNA damage
repair and oxidative metabolism. The GoldenGate technology allowed us to identify three
Chapter 5 Characterization of methylated subgroups in CRC 70
distinct CRC subgroups according to their methylation pattern which showed distinctive
clinicopathological and molecular characteristics and differed in their frequencies of
BRAF and KRAS mutation.
5.2 METHODS AND MATERIALS
5.2.1 Tissue samples
Unselected cases of CRC and adjacent normal colonic mucosa were obtained from 91
patients undergoing surgical resection at St John of God Hospital, Subiaco, Western
Australia. All samples were snap-frozen in liquid nitrogen at the time of surgery and
stored at -80oC until use. This set of tumours contains well-annotated clinicopathological
information including age, gender, tumour location, staging, presence of lymphocytic
infiltration and careful pathological assessment of perineural (PNI), lymphovascular
(LVI) and extramural invasion (EMVI). Informed consent was obtained from all patients
and the project was approved by the Human Research Ethics Committee of St John of
God Hospital.
5.2.2 BRAF mutation, KRAS mutation and microsatellite instability
DNA was extracted from approximately 25mg of tissue using standard phenol-chloroform
extraction. Hotspot mutations in BRAF (V600E) and KRAS (codons 12 and 13) were
identified using fluorescent single strand conformation polymorphism (F-SSCP) as
described previously (Li et al., 2006b; Wang et al., 2003). Deletions in the BAT-26
mononucleotide repeat were detected using F-SSCP and this was used to establish MSI+
status (Iacopetta and Grieu, 2000).
Chapter 5 Characterization of methylated subgroups in CRC 71
5.2.3 MethyLight determination of CIMPW status
Sodium bisulfite modification was performed using the EZ DNA methylation kit
according to the manufacturer’s instructions (Zymo Research, Orange, CA) and eluted
into 20 �l of 10 mmol/L Tris-HCl (pH 8). The required amount of genomic DNA to
ensure reliable evaluation of DNA methylation following bisulfite modification was
determined as described previously (Ang et al., 2008). DNA methylation levels for the
panel of markers (RUNX3, CACNA1G, IGF2, NEUROG1, SOCS1) described by
Weisenberger et al (Weisenberger et al., 2006b) were measured using MethyLight as
described by the authors. The percentage of methylated reference (PMR) was calculated
and normalised against �-actin to account for variability in the amount of input bisulfite-
treated DNA. SssI methylase-treated DNA was used as the methylated standard. A
threshold PMR value of >4 was used to classify loci as methylated or non-methylated. In
the present study, CIMPW refers to the classification of CIMP using the panel of markers
described by Weisenberger et al., whereby CIMPW-high is defined as 3 or more
methylated loci, CIMPW-low as 1 or 2 methylated loci and CIMPW-negative as no
methylated loci.
5.2.4 DNA methylation profiling using Illumina GoldenGate® methylation bead
array
Comprehensive DNA methylation profiling using the Illumina Goldengate Methylation
Arrays® (Illumina, San Diego, CA) was carried out as described by Bibikova et al
(Bibikova and Fan, 2009) on 91 CRC and 28 randomly selected, matched normal colonic
mucosa samples. Briefly, DNA was quantified by real-time PCR and treated with bisulfite
as for the MethyLight assay. Human sperm DNA and Universal methylated DNA
(Chemicon, Temcula, CA) were included in each run as unmethylated and methylated
controls, respectively. The bisulfite-converted DNA was probed at 1,505 individual CpG
Chapter 5 Characterization of methylated subgroups in CRC 72
loci contained within 807 genes in the GoldenGate Methylation Cancer Panel I according
to the manufacturer’s instructions (Illumina). Hybridised arrays were scanned using the
BeadArray Reader (Illumina). Extraction and normalization of intensity data was
performed using the Beadscan software. To ensure adequate sample quality, only samples
having >75% loci with a detection P-value of <0.05 were included for analysis.
5.2.5 Statistical analysis
The methylation level at each CpG site, or �-value, was defined as the ratio of methylated
allele to the sum of methylated and unmethylated allele and ranged from 0 (completely
unmethylated) to 1 (completely methylated). All statistical analyses were carried out
using �-value as a continuous variable unless specified otherwise. To compare the number
of methylated genes between different tumour subgroups, �-values were binarized using a
cut-off value of 0.297. This threshold was set based on a 5% false discovery rate (FDR)
for the methylated control. A total of 84 CpG sites contained within 39 X-chromosome
genes were excluded from the analysis in order to eliminate gender-specific bias.
Unsupervised and supervised hierarchical clustering analyses were performed with the
heatmap.2 function in the gplots library. The robustness of clustering was assessed using
non-parametric bootstrap resampling analysis. Additional evidence to support the
delineation of clusters was obtained through unsupervised principal component analysis
(PCA). The frequency and level of CpG methylation across different clusters was
compared using a two-sample proportion test based on both binarised and continuous �-
values. The association of clinicopathological and molecular variables with each cluster
was analysed using continuous �-values and the two-sample proportion t-test. All
statistical analyses were performed in R version 2.7.1 (The R Foundation for Statistical
Chapter 5 Characterization of methylated subgroups in CRC 73
Computing) at 5% significance level unless otherwise stated. Where applicable,
Bonferroni correction was applied to adjust for multiple testing.
5.3 RESULTS
5.3.1 DNA methylation patterns in normal and tumour tissue
Unsupervised hierarchical clustering of DNA methylation data from 1,505 CpG sites in
28 samples of normal colonic mucosa revealed no distinct clusters [Supplementary Figure
5.1]. As expected, the methylation status of 84 CpG sites in 39 genes located in the X-
chromosome was perfectly correlated with gender [Supplementary Figure 5.1]. These
genes were excluded from subsequent analyses. For the 91 tumour samples, three distinct
clusters were observed when methylation data from all 1,505 loci were included in the
analysis [Supplementary Figure 5.2]. The frequencies of CIMPW, KRAS and BRAF
mutations of the corresponding tumours from these 28 patients were 18%, 36% and 18%
respectively. These frequencies were within the ranges of previously reported
frequencies. Although the frequency of MSI+ (25%) in these patients was higher than that
present in 15% of population-based series of CRC, overrepresentation of MSI+ was
unlikely to have altered the identification of CpGs differentially methylated between
normal colonic mucosa and tumours.
A total of 202 CpG sites, corresponding to 132 genes (90 hypermethylated and 42
hypomethylated), were differentially methylated between tumour and normal colonic
mucosa (P<0.001, FDR 5%) [Supplementary Table 5.1]. Unsupervised hierarchical
clustering of methylation data from these 202 tumour-specific markers identified three
major tumour groups (Figure 5.1), referred to here as highly methylated CRC (HM-CRC;
59/91, 65%), moderately methylated CRC (MM-CRC; 13/91, 14%) and lightly
methylated CRC (LM-CRC; 19/91, 21%). The mean methylation level (�-value) of the
Chapter 5 Characterization of methylated subgroups in CRC 74
202 CpG sites for these groups was 0.617, 0.506 and 0.370, respectively (P<0.001).
Binarization of the methylation readings using a �-value cut-off of 0.297 revealed a
decreasing number of methylated CpG sites for the three groups (167, 136 and 105
respectively; P<0.001).
Although branching of the dendogram suggested the existence of two subgroups within
HM-CRC (Figure 5.1), the mean methylation level and the frequency of methylation
between these groups were not significantly different (P=0.37 and P=0.90 respectively).
Additional evidence for the validity of tumour segregation was obtained through
unsupervised PCA. HM-CRC could be clearly segregated from LM-CRC. HM-CRC and
MM-CRC could also be discriminated from each other, although less distinctly. This is
presumably because of a greater similarity between these two groups [Supplementary
Figure 5.3].
5.3.2 CRC subgroups show distinctive clinicopathological and molecular features
The distribution of clinicopathological and molecular features for 91 CRC in relation to
the methylation pattern obtained from analysis of all 202 differentially methylated CpG
sites is shown in Figure 5.1. The frequencies of KRAS (32%) and BRAF (16%) mutations
and MSI+ (16%) cases in the total cohort are comparable to those previously reported in
large population based studies (Ogino et al.,2009; Samowitz et al., 2005c). Calculation of
associations between these features and the three CRC subgroups are shown in Table 5.1.
Similar to previous reports on CIMP+, the HM-CRCs in this study were significantly
associated with older age, proximal tumour location and BRAF mutation relative to MM-
CRCs and LM-CRCs. HM-CRC was also significantly associated with MSI+ when
compared to MM-CRC, but not LM-CRCs. Two of the 15 MSI+ tumours were observed
in the LM-CRC group and 13 in the HM-CRC group. Interestingly, the two patients with
Chapter 5 Characterization of methylated subgroups in CRC 75
LM-CRC MSI+ tumours were aged 44 and 60 years, suggesting the underlying cause of
the MSI+ phenotype was germline or somatic mutation of the mismatch repair genes
rather than hMLH1 methylation.
All 16 tumours classified as CIMPW-high using the panel of markers proposed by
Weisenberger et al (>3/5 sites methylated) were contained within the HM-CRC group,
while all 18 tumours classified as CIMPW-low (1/5 or 2/5 sites methylated) segregated
into the HM-CRC or MM-CRC groups. All 15 tumours with BRAF mutation were HM-
CRC. A significantly higher frequency of KRAS mutation was observed in HM-CRC
compared to LM-CRC or MM-CRC. None of the 13 MM-CRCs contained a KRAS
mutation. The presence of extramural vascular invasion (EMVI) was more frequent in
MM-CRC compared to HM-CRC or LM-CRC. The presence of a tumour-infiltrating
lymphocytic response (TILS) was not associated with any of the methylated CRC
subgroups.
5.3.3 Differentially methylated genes in CRC subgroups
Five clusters of CpG loci, termed A to E, were apparent following unsupervised
hierarchical clustering of methylation data for the 202 CpG loci that showed tumour-
specific methylation (Figure 5.1). CpG sites in clusters A and C were more highly
methylated in MM-CRC and HM-CRC compared to LM-CRC, while the converse was
true for the CpG sites in cluster D. CpG sites in cluster B and cluster E showed uniformly
high and low methylation, respectively, in each of the 3 CRC subgroups.
Using published data from studies on human stem cells (Lee et al., 2006), 50% (39/98) of
the genes within clusters A and C were found to be targets for binding by Polycomb
repressive complex 2 (PRC2) components and/or H3K27 trimethylation. In contrast, only
Chapter 5 Characterization of methylated subgroups in CRC 76
GenderAgeLocationStageLVIEMVIPNITILSCIMPW
MSI
L M H
E
D
C
B
A
CRC subgroups
CpG
clus
ters
BRAFKRAS
E
D
C
B
A
GenderAgeLocationStageLVIEMVIPNITILSCIMPW
MSI
L M H
E
D
C
B
A
CRC subgroups
CpG
clus
ters
BRAFKRAS
E
D
C
B
A
12% (5/41) of the genes within clusters B, D and E were targets (P<0.001). These
observations support previous reports that hypermethylated genes in cancer are frequent
targets of PRC2-mediated H3K27 trimethylation (Widschwendter et al., 2007).
Figure 5.1 Unsupervised hierarchical clustering of 202 tumour-specific probes (rows) in 91 CRC
(columns). The 3 tumour clusters generated by this analysis were termed highly methylated CRC
(HM-CRC), moderately methylated CRC (MM-CRC) and lightly methylated CRC (LM-CRC).
Clinicopathological and molecular features are shown above the heatmap. White rectangles are
cases with missing data. Gender: female (red), male (blue); Age: �67 years (red), <67 (blue);
Tumour location: proximal (red), distal (blue); Tumour stage (ACPS): A or B (blue), C or D (red);
Lymphovascular invasion (LVI): present (red), absent (blue); Extramural vascular invasion
(EMVI): present (red), absent (blue); Perineural invasion (PNI): present (red), absent (blue);
Tumour infiltrating lymphocytes (TILS): present (red), absent (blue); CIMPW: CIMPW-high (red),
CIMPW-low (yellow), CIMPW-negative (blue); BRAF: mutant (red), wildtype (blue); KRAS:
mutant (red), wildtype (blue); Microsatellite instability (MSI): positive (red), negative (blue). Five
CpG clusters (A-E) were apparent from the analysis and showed differential methylation amongst
the 3 CRC subgroups.
Chapter 5 Characterization of methylated subgroups in CRC 77
Table 5.1 Clinicopathological and molecular characteristics of CRC subgroups
CRC subgroup (n ,%) P
L M H L vs M M vs H L vs H 19 (21) 13 (14) 59 (65) Female 6 (32) 4 (31) 30 (51) Male 13 (68) 9 (69) 29 (49) 0.952 0.211 0.175 Age � 67 years 6 (32) 5 (38) 37 (63) Age < 67 years 13 (68) 8 (62) 22 (37) 0.570 0.003 0.012 Proximal tumour site1 5 (26) 1 (8) 29 (49) Distal tumour site 14 (74) 12 (92) 29 (49) 0.152 <0.001 0.001 ACPS Stage A or B 8 (42) 4 (31) 36 (61) ACPS Stage C or D 11 (58) 9 (69) 23 (39) 0.520 0.025 0.105 LVI Negative 15 (79) 6 (46) 39 (66) LVI Positive 4 (21) 7 (54) 20 (34) 0.049 0.188 0.126 EMVI Negative 19 (100) 8 (62) 52 (88) EMVI Positive 0 (0) 5 (38) 7 (12) 0.005 0.031 0.024 PNI Negative 17 (89) 11 (85) 52 (88) PNI Positive 2 (11) 2 (15) 7 (12) 0.744 0.506 0.708 TILS Negative2 9 (47) 5 (38) 26 (44) TILS Positive 7 (37) 8 (62) 33 (56) 0.326 0.547 0.521 CIMPW – negative3 19 (100) 10 (77) 28 (47) CIMPW – low 0 (0) 3 (23) 15 (25) CIMPW – high 0 (0) 0 (0) 16 (27) 1.000 <0.001 <0.001 MSI+ 2 (11) 0 (0) 13 (18) MSI- 17 (89) 13 (100) 46 (78) 0.125 <0.001 0.221 BRAF mutant 0 (0) 0 (0) 15 (25) BRAF wildtype 19 (100) 13 (100) 44 (75) 1.000 <0.001 <0.001 KRAS mutant 3 (16) 0 (0) 26 (44) KRAS wildtype 16 (84) 13 (100) 33 (56) 0.057 <0.001 0.014 L, LM-CRC; M, MM-CRC; H, HM-CRC; LVI, lymphovascular invasion; EMVI,
extramural vascular invasion; PNI, perineural invasion; TILS, tumour infiltrating
lymphocytes; CIMPW, classification of CIMP using the Weisenberger et al panel,
whereby CIMPW-high is defined as 3 or more methylated loci, CIMPW-low as 1 or 2
methylated loci and CIMPW-negative as no methylated loci. MSI, microsatellite
instability; 1Tumour location was unknown for 1 patient in HM-CRC, 2TILS data
unknown for 3 patients in LM-CRC, 3P value for CIMPW was generated from comparison
between CIMPW-high and CIMPW-low or CIMPW-negative.
Chapter 5 Characterization of methylated subgroups in CRC 78
5.4 DISCUSSION
The current study is the first to use array-based technology to enable comprehensive
methylation profiling of CRC. A total of 1,505 CpG sites contained within 807 genes
were assessed in 91 consecutive cases of CRC. The GoldenGate® arrays employed here
were recently used to profile methylation in head and neck cancer (Marsit et al., 2009),
renal cancer (McRonald et al., 2009), glioblastoma (Martinez et al., 2009) and
hematological neoplasms (Martin-Subero et al., 2009; O'Riain et al., 2009). The validity
of these arrays for the quantitative assessment of methylation was shown in several
previous studies by comparison with other quantitative methods (Bibikova et al., 2006;
Christensen et al., 2009; Ladd-Acosta et al., 2007). The finding that methylation of CpG
sites in X-linked genes correlated with gender provided further validation [Supplementary
Figure 5.1]. Many of the genes found to be hypermethylated in this study were previously
reported to be methylated in CRC [Supplementary Table 5.2]. Finally, in agreement with
earlier work on cancer (Widschwendter et al., 2007), many of the genes showing de novo
hypermethylation in this study of CRC (cluster A and C genes, Figure 5.1) are known
targets for PRC2 (Lee et al., 2006).
Similar to earlier studies in CRC that evaluated a limited number of methylation markers
(Barault et al., 2008b; Hawkins et al., 2002; Ogino et al., 2006b; Ogino et al., 2007b;
Samowitz et al., 2005c; Toyota et al., 1999b; van Rijnsoever et al., 2002; Weisenberger
et al., 2006b), comprehensive methylation profiling in the present study revealed the
existence of distinct tumour subgroups (Figure. 5.1). The three major subgroups identified
by unsupervised hierarchical clustering were classified as HM-CRC, MM-CRC and LM-
CRC according to the level and frequency of methylation. In agreement with previous
studies, HM-CRCs were associated with older patient age, proximal site and BRAF
mutation (Table 5.1). All 16 tumours identified as CIMPW-high using a proposed
Chapter 5 Characterization of methylated subgroups in CRC 79
consensus panel of 5 markers were contained within the HM-CRC group, as well as all 15
tumours containing a BRAF mutation. Using small numbers of methylation markers in
unselected CRC, the original studies by Toyota et al reported CIMP+ frequencies of 62%
(Toyota et al., 1999b) and 51% (Toyota et al., 2000) whereas subsequent studies reported
lower frequencies of 15-32% (Hawkins et al., 2002; Ogino et al., 2007b; Samowitz et al.,
2005c; Shen et al., 2007b; van Rijnsoever et al., 2002; Weisenberger et al., 2006b). In
contrast, by investigating a large number of methylation sites and using unsupervised
hierarchical clustering to analyze the results, we observed a relatively high proportion
(65%) of HM-CRCs in the present study. The lack of association of HM-CRC with other
clinicopathological features such as TILS typically associated with CIMPW was unlikely
to be due to inaccuracies in TILS assessment as TILS was significantly associated with
MSI+ (P<0.05), consistent with previous report (Ogino et al., 2006d).
Previous studies have reported inconsistent results for the association between CpG island
methylation and KRAS mutation (Nagasaka et al., 2008b; Nosho et al., 2008; Ogino et al.,
2006c; Samowitz et al., 2005c; Toyota et al., 2000), probably because of the different
methylation markers used in each study. Analysis of a large number of CpG sites in the
present study revealed that HM-CRCs showed a significantly higher KRAS mutation
frequency compared to both MM-CRCs and LM-CRCs (Table 5.1). This result agrees
with some studies (Barault et al., 2008b; Hawkins et al., 2002; Samowitz et al., 2005c;
Toyota et al., 2000) but not others that found an inverse association between KRAS
mutation and CIMP+ (Ogino et al., 2007b; van Rijnsoever et al., 2002; Weisenberger et
al., 2006b).
The absence of MSI and KRAS and BRAF mutations in the 13 MM-CRCs suggests this
subgroup may have a distinctive molecular and clinical phenotype. In support of this,
Chapter 5 Characterization of methylated subgroups in CRC 80
MM-CRCs showed a significantly higher frequency of EMVI compared to both LM-
CRCs and HM-CRCs and a significantly higher stage compared to HM-CRC (Table 5.1).
Moreover, almost all MM-CRCs were located in the distal colon or rectum (12/13, 92%).
The existence of a distinctive MM-CRC subgroup will however require confirmation in
independent tumour series.
After adjustment for multiple testing, 170 CpG sites were hypermethylated in HM-CRC
compared to LM-CRC. The 112 genes containing these CpG sites are ranked according to
significance in Supplementary Table 5.2. Of these, 54 were previously reported as
methylated in cancer, 38 as methylated in gastrointestinal cancers and 30 in CRC
[Supplementary Table 5.2]. Of the top 10 genes that were hypermethylated in HM-CRC
compared to LM-CRCs, 5 have previously been implicated in the pathogenesis of
gastrointestinal tumours (NTRK3, HS3ST2, TWIST1, CD40 and EYA4). Somatic mutation
of NTRK3 has been reported in human colon cancer (Wood et al., 2006), while
methylation of EYA4 has been documented previously in ulcerative colitis-associated
dysplasia (Osborn et al., 2006) and CRC (Schatz et al., 2006).
MM-CRCs were found to have a relatively high incidence of EMVI (38%) compared to
HM-CRCs and LM-CRCs (Table 5.1). Supervised analysis revealed that HS3ST2, also
known as 3-OST-2, was the only gene to be differentially methylated between tumours
showing presence or absence of EMVI. Methylation-associated silencing of HS3ST2
expression has been demonstrated in breast, lung, pancreatic and colon cancers
(Miyamoto et al., 2003). This gene encodes an enzyme that modifies heparin sulfate
proteoglycans (Shworak et al., 1999) involved in cell adhesion and migration (Perrimon
and Bernfield, 2000), thus suggesting a possible mechanistic link between HS3ST2
methylation and EMVI.
Chapter 5 Characterization of methylated subgroups in CRC 81
The use of Illumina GoldenGate® Beadarray technology in this study allowed a large
number of CpG sites to be evaluated for methylation in an unbiased fashion. However,
there are several limitations with this approach for the characterization of methylated
subgroups in CRC. Firstly, only a small fraction of all genes were investigated for
methylation and in 70% of these just one CpG sites per gene was evaluated. Secondly, it
is unclear whether the methylation level at these sites relates to expression of the genes.
Thirdly, some of the probes used in this assay contain single nucleotide polymorphisms
(SNPs) or repetitive elements that could influence methylation analysis (Byun et al.,
2009).
Methylation profiling of 807 cancer-related genes revealed the presence of three CRC
subgroups with distinct clinicopathological and molecular features. Similar to earlier
studies that investigated fewer methylation markers, HM-CRCs were associated with
older patient age, proximal location and mutations in BRAF and KRAS.
Chapter 6 BRAF mutation in young CRC 82
Chapter 6. BRAF mutation is associated with the CpG island
methylator phenotype in colorectal cancer from young patients
6.1 BACKGROUND
The CpG island methylator phenotype (CIMP+) in colorectal cancer (CRC) is
characterised by high levels of CpG methylation in multiple gene promoter regions.
Distinctive clinicopathological features of CIMP+ CRC include origin in the proximal
colon, more advanced age, female gender, mucinous histology and poor differentiation
(Hawkins et al., 2002a; Jass, 2007a; Samowitz et al., 2005a; Teodoridis et al., 2008; van
Rijnsoever et al., 2002). A panel of 5 markers was recently proposed to allow
standardized assessment of CIMP+ (Weisenberger et al., 2006a). This consists of CpG-
rich regions within 5 genes: RUNX3, CACNA1G, IGF2, NEUROG1 and SOCS1. Using
these markers, the frequency of CIMP+ in unselected series of CRC was estimated at
approximately 15-18% (Kambara et al., 2004; Ogino et al., 2006a; Ogino et al., 2007a;
Weisenberger et al., 2006a). Quantitative evaluation of methylation has also been
recommended for the study of CIMP+ (Ogino et al., 2006a), with MethyLight being the
most commonly used method. One of the distinguishing molecular features of CIMP+
tumours was a high incidence of mutation in the BRAF oncogene, particularly the V600E
hotspot mutation (Kambara et al., 2004; Ogino et al., 2006a; Ogino et al., 2007a;
Samowitz et al., 2005a; Weisenberger et al., 2006a). Another feature recently reported for
CIMP+ was an inverse correlation with APC methylation in an unselected CRC cohort
(Iacopetta et al., 2006).
Although CIMP+ CRCs share many clinicopathological features with the microsatellite
instability phenotype (MSI+), recent work has confirmed they comprise a distinct
Chapter 6 BRAF mutation in young CRC 83
subgroup independently of MSI status (Ogino et al., 2006a; Ogino et al., 2007a;
Samowitz et al., 2005a; Weisenberger et al., 2006a). Approximately half of all CIMP+
tumours are also MSI+ due to methylation-induced transcriptional silencing of the
hMLH1 mismatch repair gene (Ogino et al., 2006a; Ogino et al., 2007a; Weisenberger et
al., 2006a). Compared to CIMP+/MSI+ tumours, CIMP+/MSI- tumours display higher
stage at presentation, absence of lymphocytic infiltration and poor prognosis (Jass,
2007a). Recent reports also suggest the BRAF V600E mutation is associated with poor
prognosis in CIMP+/MSI- tumours (Ferracin et al., 2008b; Lee et al., 2008; Samowitz et
al., 2005b). These studies were carried out on CIMP+/MSI- tumours originating
predominantly in older patients and little is known of the frequency or the
clinicopathological and molecular characteristics of such tumours in younger patients.
The aim of the present study was therefore to investigate BRAF mutation and CIMP+ in
MSI- tumours from an exclusively younger cohort of sporadic CRC patients aged <60
yrs.
6.2 METHODS AND MATERIALS
The 735 CRC samples investigated here were derived from a population-based screening
study of hereditary non-polyposis colorectal cancer (HNPCC) in patients aged <60 yrs at
diagnosis (Watson et al., 2007). Only tumours judged to be MSI- following analysis of
the BAT-26 mononucleotide repeat were included in this study, thereby excluding
HNPCC cases. Information on patient age and gender and on tumour characteristics
including stage, site and grade were obtained from pathology reports. BRAF V600E
mutations were identified by fluorescent-single strand conformation polymorphism as
described previously (Li et al., 2006a).
Chapter 6 BRAF mutation in young CRC 84
A randomly selected subset of 32 tumours with BRAF mutation was matched for patient
age and tumour site with 57 tumours having BRAF wildtype status. DNA was extracted
from formalin-fixed, paraffin embedded tissues as described previously (Soong and
Iacopetta, 1997). The minimum starting amount of genomic DNA to ensure reliable
evaluation of DNA methylation following bisulfite modification was estimated by real-
time quantification of amplifiable genomic DNA (Ang et al., 2008). Sodium bisulfite
modification was performed using the EZ DNA methylation kit (Zymo Research, Orange,
CA) and eluted into 20�l of 10mmol/L Tris-HCl (pH 8). DNA methylation levels for
RUNX3, CACNA1G, IGF2, NEUROG1, SOCS1 and APC were quantified using
MethyLight as described previously (Iacopetta et al., 2006; Weisenberger et al., 2006a).
The level of DNA methylation was calculated as a percentage of methylated reference
(PMR) using �-actin to normalize for the amount of input bisulfite-treated DNA and SssI
methylase-treated DNA as the methylated standard. A threshold PMR value of 4 was used
to classify methylated loci (Iacopetta et al., 2006; Ogino et al., 2007a; Weisenberger et
al., 2006a). Positive CIMP status (CIMP+) was defined as �3 of the RUNX3, CACNA1G,
IGF2, NEUROG1 and SOCS1 markers being methylated.
The �2 test was used to assess univariate relationships between the BRAF V600E
mutation and categorical variables including clinicopathological characteristics and
methylation at each locus. Fisher’s exact test was used when the sample size was less than
5. All P values were two-sided and the level of statistical significance was <0.05.
Student’s t-test was used for comparisons of the mean number of methylated loci between
the BRAF wildtype and BRAF mutant tumours.
Chapter 6 BRAF mutation in young CRC 85
6.3 RESULTS
The frequency of BRAF V600E mutation in 735 microsatellite stable (MSI-) CRCs from
patients aged <60 yrs was 7% (Table 6.1). The presence of BRAF mutation was strongly
associated with advanced stage, location in the proximal colon and high histological
grade. A trend was also apparent for higher BRAF mutation frequency in tumours from
very young patients (<40 yrs). Similar result was also observed when BRAF mutation
frequency was analysed using age as a continuous variable (P=0.0017).
The frequencies of gene hypermethylation and CIMP+ were investigated in 32 BRAF
mutant and 57 BRAF wildtype tumours that were matched for patient age and tumour site.
The median age of these patient groups was 52.0 and 51.5 years, respectively. A
significantly higher frequency of methylation in each of the markers comprising the
CIMP panel was observed in BRAF mutant compared to BRAF wildtype tumours (Table
6.2). Approximately half of the BRAF mutant tumours identified in this young cohort of
MSI- CRC were CIMP+, compared to just 4% for the BRAF wildtype tumours. Figure 6.1
shows the distribution of the number of methylated CIMP markers for BRAF wildtype
and BRAF mutant tumours. The mean number of methylated loci was higher in BRAF
mutant (2.4 ± 1.54) compared to BRAF wildtype (0.3 ± 0.79) tumours (P<0.0001, Student
t-test).
In contrast to the CIMP markers, a significant inverse correlation was observed between
the presence of APC methylation and BRAF mutation (Table 6.2). All 8 tumours with
APC hypermethylation were wildtype for BRAF and were amongst the 45 tumours that
showed no methylation of any of the CIMP markers (Figure 6.1).
Chapter 6 BRAF mutation in young CRC 86
Table 6.1 Associations between BRAF V600E mutation and clinicopathological features of
microsatellite stable CRC from patients aged <60 years.
Feature (n) a BRAF wildtype (%)
BRAF mutant (%)
P
Total (735) 685 50 Age (yrs) <30 (13) 10 (1) 3 (6) 30-39 (42) 38 (6) 4 (8) 40-49 (168) 159 (23) 9 (18) 50-59 (512) 478 (70) 34 (68) 0.07 b Sex Female (295) 272 (40) 23 (46) Male (440) 413 (60) 27 (54) 0.38 Stage (AJCC) In situ (38) 36 (6) 2 (5) I (116) 113 (20) 3 (8) II (115) 151 (27) 4 (11) III (223) 205 (37) 18 (49) IV (60) 50 (9) 10 (27) 0.0004 c Site Proximal (192) 163 (24) 29 (59) Distal (531) 511 (76) 20 (41) <0.0001 Grade Low (561) 536 (88) 25 (58) High (89) 71 (12) 18 (42) <0.0001 Mucinous histology Absent (599) 564 (82) 35 (70) Present (136) 121 (18) 15 (30) 0.03
a Data for stage, site, grade was not available for 183, 30 and 103 cases, respectively.
b Age <40 yrs vs 40-59 yrs.
c Stages III/IV vs in situ/I/II.
Chapter 6 BRAF mutation in young CRC 87
Table 6.2 Associations between gene hypermethylation and BRAF V600E mutation in
microsatellite stable CRC from patients aged <60 yrs.
Gene methylation (n) a
BRAF wildtype (%)
BRAF mutant (%)
P
Total 57 32 RUNX3 Yes (22) 2 (4) 20 (62) No (67) 55 (96) 12 (38) <0.0001 CACNA1G Yes (14) 3 (5) 11 (34) No (75) 54 (95) 21 (66) 0.0005 IGF2 Yes (23) 3 (5) 20 (61) No (66) 54 (95) 13 (39) <0.0001 NEU Yes (29) 9 (16) 20 (62) No (60) 48 (84) 12 (38) <0.0001 SOCS Yes (7) 1 (2) 6 (19) No (82) 56 (98) 26 (81) 0.007 CIMP b Positive (19) 2 (4) 17 (53) Negative (70) 55 (96) 15 (47) <0.0001 APC Yes (8) 8 (14) 0 (0) No (81) 49 (86) 32 (100) 0.02
a Yes, PMR �4; No, PMR <4
b CIMP+ was defined as 3 or more of RUNX3, CACNA1G, IGF2, NEU and SOCS
showing methylation.
Chapter 6 BRAF mutation in young CRC 88
Figure 6.1. Distribution of number of methylated CIMP markers for BRAF wildtype and
BRAF mutant tumours.
6.4 DISCUSSION
Approximately 20-25% of CRC cases diagnosed in Western countries occur in patients
aged <60 yrs (Morris et al., 2007). The pathways by which these tumours develop are of
special interest because the large majority of HNPCC cases arise in young patients. The
MSI+ phenotype occurs in about 8% of CRC from patients aged <60 yrs (Watson et al.,
2007) and many of these cases are associated with HNPCC. To investigate the pathways
by which sporadic CRCs develop in younger patients, the present study investigated only
MSI- tumours from a large and consecutive series of patients aged <60 yrs. We were
specifically interested in the associations between BRAF mutation, CIMP+ and APC
methylation in these tumours.
0
10
20
30
40
50
60
70
80
90
100
0 1 2 3 4 5
No. of methylated CIMP+ markers
Per
cent
age
of tu
mor
s
BRAF mutant
BRAF wildtype
No. of methylated CIMP+ markersNo. of methylated CIMP+ markers
Per
cent
age
of tu
mor
s
0
10
20
30
40
50
60
70
80
90
100
0 1 2 3 4 5
No. of methylated CIMP+ markers
Per
cent
age
of tu
mor
s
BRAF mutant
BRAF wildtype
0
10
20
30
40
50
60
70
80
90
100
0 1 2 3 4 5
No. of methylated CIMP+ markers
Per
cent
age
of tu
mor
s
BRAF mutant
BRAF wildtype
No. of methylated CIMP+ markersNo. of methylated CIMP+ markers
Per
cent
age
of tu
mor
s
Chapter 6 BRAF mutation in young CRC 89
The frequency of BRAF mutation in this young patient cohort (7%) was within the range
of previous reports of 3-9% in other population-based studies of unselected cases
(Ferracin et al., 2008b; Lee et al., 2008; Li et al., 2006a; Oliveira et al., 2007; Samowitz
et al., 2005b). BRAF mutation was approximately 4�fold more frequent in tumours from
the proximal colon (29/192, 15%) compared to distal colon and rectal tumours (20/531,
4%; P<0.0001). In agreement with other studies, BRAF mutation was strongly associated
with the poor prognosis features of advanced stage and high grade (Ferracin et al., 2008b;
Lee et al., 2008; Oliveira et al., 2007; Samowitz et al., 2005b). Of the 37 BRAF mutant
tumours in which stage could be ascertained from the pathology report, 28 (76%) were
either stage III or IV. It is presently unclear why mutation of this oncogene is associated
with such an aggressive tumour phenotype. The proportion of proximal BRAF mutant
tumours with advanced stage was similar to that of distal BRAF mutant tumours, although
this analysis was limited by the relatively small sample size. Similar to the findings in
MSI- tumours by Samowitz et al (Samowitz et al., 2005b), no association was observed
between gender and CIMP+ in this cohort.
Previous workers have demonstrated a strong association between BRAF mutation and
CIMP+ (Nagasaka et al., 2004; Ogino et al., 2006a; Ogino et al., 2007a; Tanaka et al.,
2006; Weisenberger et al., 2006a) and indeed the former was used to help select markers
to standardize the classification of CIMP+ (Weisenberger et al., 2006a). The earlier
studies linking BRAF mutation to promoter methylation of multiple cancer-related genes
were carried out mostly on older subjects. The present study is the first to specifically
investigate a younger patient cohort and in the absence of possible confounding effects
from the MSI+ phenotype. A subset of 32 BRAF mutant and 57 BRAF wildtype tumours
matched for patient age and anatomical site were selected for the study of CIMP+ using
the quantitative MethyLight assay and a standardized panel of markers. All markers with
Chapter 6 BRAF mutation in young CRC 90
the exception of NEU showed a low frequency of methylation (5%) in BRAF wildtype
tumours, but significantly higher frequencies in BRAF mutant tumours (Table 6.2). Using
the criterion of �3 methylated markers to define CIMP+, just over half (53%) of the
BRAF mutant tumours were classified as CIMP+ compared to only 4% of the BRAF
wildtype tumours. These results provide strong support for the notion that BRAF mutation
and CIMP+ occur in the same pathway of CRC development, arising predominantly in
the proximal colon. Although the proportion of stage III and IV tumours was higher in
BRAF mutant (85%) compared to wildtype (58%) tumours, it is unlikely to account for
the large difference observed in CIMP+ frequency between the two groups (Table 6.2).
This is because previous studies have demonstrated only a weak association between
methylation and tumour stage (Hawkins et al., 2002a; Samowitz et al., 2005a; van
Rijnsoever et al., 2002).
The overall frequency of CIMP+ tumours in young CRC patients (<60 years) was
estimated for the first time in this study to be approximately 8%. This value comprises of
4% derived from patients with wildtype BRAF who were CIMP+, plus an additional 4%
derived from patients with BRAF mutation (7% frequency) who were also CIMP+ (53%).
This estimate is about half the frequency reported for CIMP+ in unselected CRC series
(Iacopetta et al., 2007; Ogino et al., 2007a; Weisenberger et al., 2006a). The occurrence
of CIMP+ CRC in young patients highlights the need to identify dietary and genetic risk
factors that are specific for this tumour subgroup, thus allowing targeted screening.
It was not possible to determine from the current results whether BRAF mutation precedes
CIMP+ or vice versa. Co-segregation of BRAF mutations with extensive DNA
methylation has been reported in serrated adenomas found mostly in the proximal colon
and which have been proposed as precursor lesions for CIMP+ tumours (Kambara et al.,
Chapter 6 BRAF mutation in young CRC 91
2004; Spring et al., 2006; Yang et al., 2004). The presence of BRAF mutation in serrated
adenomas and CRC has been associated with a positive family history of this disease
(Samowitz et al., 2005b; Spring et al., 2006). By extension, this may also imply genetic
predisposition to the development of CIMP+, possibly via the level of DNA methylation
in normal colonic mucosa (Kawakami et al., 2006).
In striking contrast to CIMP+ determined by the new panel of markers, methylation of
APC was inversely correlated with BRAF mutation (Table 6.2). This confirms a previous
observation in an unselected CRC series (Iacopetta et al., 2006). Moreover, Samowitz et
al have reported that mutations in APC are inversely correlated with the presence of
BRAF mutation and CIMP+ in CRC (Samowitz et al., 2007). Together, these results
suggest that inactivation of the APC gene, either by methylation-induced silencing or by
mutation, occur in a different pathway of CRC development to that which involves BRAF
mutation and CIMP+ as defined by the new markers. The mechanism underlying the
differential methylation of genes between these two tumour subtypes is unknown. Folate
depletion has been shown to alter the level of APC expression in a normal human colon
cell line (Crott et al., 2008), although it is unclear whether this is due to changes in the
methylation status of APC. Hypermethylation of APC may be inversely associated with
cellular folate status in comparison to methylation of the CIMP+ group of genes.
In conclusion, the present results demonstrate that BRAF mutation is rare in MSI- CRC
from young patients, however when present it is associated with an aggressive tumour
phenotype. Approximately half of all tumours with BRAF mutation are also CIMP+,
compared to only a very low frequency of CIMP+ in tumours with wildtype BRAF. The
inverse correlation observed here between APC methylation and BRAF mutation or
CIMP+ provides further support for the existence of alternate pathways of CRC
Chapter 6 BRAF mutation in young CRC 92
development. These findings demonstrate that the younger CRC population (<60 yrs) is
also susceptible to the CIMP+ pathway of colorectal tumourigenesis, albeit at
approximately half the frequency observed in older patients.
Chapter 7 General discussion 93
Chapter 7. GENERAL DISCUSSION
7.1 Contribution of this work to the understanding of DNA methylation in CRC
Most investigations of DNA methylation are based on bisulfite-PCR based methods.
However quality control of DNA methylation analysis is lacking. Using cycle threshold
(Ct) values, this study has demonstrated that Ct values derived from real-time PCR
analysis are better than conventional spectrophotometric analysis for determining the
reliability of DNA samples for methylation analysis (Chapter 3; Ang et al., 2008).
Although CpG island methylation is often evaluated as a surrogate marker for gene
silencing, simultaneous assessment of RNA or protein expression level is rarely
performed. In the current work, a ridge-regression based algorithm was developed to
predict RNA expression levels based on DNA methylation at individual CpG sites
(Chapter 4). This model showed that methylation of individual CpG sites identified from
the algorithm correlated with RNA expression in CRC cell lines but not in primary
tumours. Widespread and intense gene promoter methylation is the hallmark
characteristic of CIMP+ CRC. Using unbiased and comprehensive DNA methylation
profiling, the current study identified three CIMP subgroups (CIMP-L, CIMP-M and
CIMP-H) with distinctive clinicopathological and molecular features in CRC (Chapter 5;
Ang et al., submitted). CIMP-H CRCs were associated with KRAS and BRAF mutations
and with older patient age. Although the large majority of CIMP-H (CIMP+) CRCs occur
in older patients, approximately 8% of CRC from younger patients (<60 years) were also
observed to be CIMP+ in this study (Chapter 6; (Ang et al., 2009). Almost all CIMP+
tumours in young patients harbored a BRAF mutation (89%), suggesting these two
important molecular alterations are involved in the development of a minority of early
onset CRC.
Chapter 7 General discussion 94
7.2 DNA quality and methylation analysis
The availability of molecular techniques to evaluate DNA methylation in cancer-related
genes has prompted the development of potential clinical testing of CpG methylation for
cancer detection, prognosis and monitoring using cell-free biological samples (Kristensen
and Hansen, 2009; Sepulveda et al., 2009). The growing importance of methylation-based
clinical tests highlights the need for robust quality controls and for assay validation, as
dealt with in Chapters 3 and 4 respectively.
Most assays for methylation analysis are based on sodium bisulfite treatment followed by
PCR (Esteller, 2007a; Kristensen and Hansen, 2009). The bisulfite-conversion reaction is
the major source of variability in DNA methylation analysis (Genereux et al., 2008).
Optimal conditions for the bisulfite reaction achieve the complete conversion of
unmethylated cytosine to uracil while minimizing DNA degradation. Excessive DNA
degradation reduces the number of DNA molecules available for PCR amplification, thus
potentially giving rise to PCR amplification bias. Less aggressive methods risk
incomplete conversion of unmethylated cytosine, therefore leading to overestimation of
the methylation levels. To overcome these problems, measurement of genomic DNA to
give the Ct value can be used to gauge sample suitability for methylation analysis
(Chapter 3; (Ang et al., 2008). The Ct value establishes the appropriate amount of initial
genomic DNA required for bisulfite conversion to ensure reproducible methylation
analysis. The Ct method is particularly useful for analytical methods such as MSP that
lack built-in controls.
The Ct quality control system is amenable to various downstream methylation analysis
techniques and is ideally suited to applications involving poor quality or low amounts of
DNA. As shown by the results in Figure 3.1, the use of spectrophotometry to determine
Chapter 7 General discussion 95
the amount of DNA required for bisulfite conversion can result in the excessive use of
what is often a precious resource, particularly for clinical samples. Spectrophotometry can
also result in the exclusion of samples that may otherwise be found suitable for
methylation analysis by the use of Ct values. The Ct quality control assay therefore
facilitates the optimal use of various DNA methylation assays, such as those used in
Chapter 4 (pyrosequencing, bsSEQ), Chapter 5 (GoldenGate methylation array) and
Chapter 6 (MethyLight). It allows for failure to detect methylation because of inadequate
sample quality to be distinguished from the apparent absence of methylation.
7.3 Identification of CpG loci whose methylation status correlates with gene
expression
The choice of method for DNA methylation analysis is dependent on the goals of testing
and the required assay performance (Esteller, 2007a; Kristensen and Hansen, 2009). This
may be influenced by several factors including the number of individual CpG sites or
CpG islands to be analysed for each sample, the anticipated amount of target DNA within
samples and the quality of DNA. In order to develop DNA methylation assays as
surrogate markers for gene transcript levels, the assays must evaluate CpG sites that have
been shown to correlate with gene expression. The assay should be validated by
correlating methylation data with protein or RNA expression levels. Most assays reported
in the literature were designed to assess methylation at CpG sites that were originally
selected on the basis of optimal primer design. In many cases the functional significance
of methylation at these CpG loci remains to be determined.
In this study, the modeling of DNA methylation status at individual CpG sites allowed the
identification of panels of CpG loci whose methylation correlated with RNA expression
in CRC cell lines (Chapter 4). However, methylation of these CpG panels failed to predict
Chapter 7 General discussion 96
RNA expression for RUNX3 and DPYD in primary CRC. The inability to use methylation
status at these loci to predict RNA expression may be attributed to differences in the
underlying causal mechanisms and patterns of methylation between cancer cell lines and
primary tumours. In accordance with previous reports (Paz et al., 2003; Suter et al.,
2003), promoter methylation levels in CRC cell lines were generally higher than in
primary CRC (Table 4.1). This could be due to the abundance of folate in culture media
giving rise to a higher concentration of the methyl donor SAM (Figure 1.2). The
acquisition during cell culture of new mutations in genes involved in methyl group
metabolism could also account for differences in methylation between cell lines and
primary tumours.
Technical issues associated with the methylation assays employed in Chapter 4 may also
account for the inability to use methylation status at defined CpG panels to predict RNA
expression in primary tumours. For example, discordance in methylation results obtained
with bsSEQ and Pyrosequencing has been reported (Reed et al., 2009). Although both
assays generate methylation data with single base resolution, the cloning bias associated
with bsSEQ may introduce a degree of error. This problem can be circumvented by digital
bisulfite-sequencing (Weisenberger et al., 2008) whereby the dilution of samples to a
critical level allows PCR reactions starting with a single DNA template. RUNX3 and
DPYD have been reported to be methylated in 21% (Goel et al., 2004) and 13% (Yu et
al., 2008) of primary CRC, respectively. These workers used the MSP and
Pyrosequencing methods, respectively, but targeted different CpG sites to those in the
present study. The low sensitivity of Pyrosequencing (10%) (Tost et al., 2003) could
potentially preclude the detection of low methylation levels in the primary tumours.
Chapter 7 General discussion 97
The results from Chapter 4 show that methylation data derived from cell lines cannot be
used to predict RNA expression in primary tumours. The current study suggests that
modeling of methylation status in primary tumours is needed to identify panels of CpG
sites whose methylation correlates with RNA expression. Analysis of methylation at
single CpG resolution is required, preferably using digital bisulfite-sequencing. In
addition, the non-tumour cell content of each sample would need to be carefully
evaluated. Laser capture microdissection would likely be required to maximize tumour
cell content from clinical samples.
7.4 Comprehensive DNA methylation profiling to define CIMP
The CIMP+ subgroup of CRC is characterized by frequent hypermethylation of gene
promoter regions (Toyota et al., 1999a). Previous studies have used the MSP, COBRA,
pyrosequencing and MethyLight assays together with selected methylation markers to
investigate CIMP CRC. The present study is the first to use array-based methylation
profiling to characterize CIMP CRC (Chapter 5; Ang et al, submitted).
Using various candidate panels of methylation markers to define CIMP+ in CRC,
previous studies have reported frequencies ranging from 15%-62% (Barault et al., 2008a;
Hawkins et al., 2002a; Ogino et al., 2007a; Samowitz et al., 2005a; Toyota et al., 1999a;
Toyota et al., 2000; van Rijnsoever et al., 2002; Weisenberger et al., 2006a). In
comparison and based on unsupervised hierarchical clustering of methylation data from a
large number of CpG sites, this study found a higher frequency of CIMP+, or CIMP-H,
CRC (65%, Table 5.1). One of the major differences between the current work and
previous studies was the inclusion of hypomethylated CpG sites in tumours relative to
normal mucosa for the classification of CIMP. In the heatmap of methylation data shown
in Figure 5.1, the majority of these demethylated sites were found within CpG clusters D
Chapter 7 General discussion 98
and E. Interestingly, CpG sites contained within cluster D were mostly demethylated in
CIMP-H tumours but remained methylated in CIMP-L tumours relative to normal colonic
mucosa. This indicates that a small proportion of CpG sites undergo demethylation rather
than hypermethylation in CIMP-H tumours. In contrast to hypermethylated CpG sites, the
demethylated sites were mostly located outside of CpG islands and were not targets for
polycomb proteins.
Mutations in both KRAS and BRAF oncogenes were found in this study to segregate
strongly with CIMP-H CRC (Table 5.1). In contrast, CIMP-M tumours contained no
KRAS or BRAF mutations, while CIMP-L tumours contained no BRAF mutations and a
low 16% frequency of KRAS mutations. The association of BRAF V600E mutation with
CIMP+ CRC has been confirmed in multiple studies (Li et al., 2006a; Ogino et al.,
2007a; Weisenberger et al., 2006a), while the association of KRAS mutations with CIMP+
has been inconsistent (Barault et al., 2008a; Nagasaka et al., 2008a; Ogino et al., 2007a;
Shen et al., 2007b; van Rijnsoever et al., 2002; Weisenberger et al., 2006a). Although the
BRAF V600E mutation is often observed to be tightly associated with CIMP+ CRC, the
role of BRAF mutation in the pathogenesis of CIMP+ is unclear. In normal colon
epithelial cells, induced expression of BRAF V600E has been shown to lead to
hypermethylation of MLH1 during cellular transformation (Minoo et al., 2007). Similarly,
fibroblast cells transformed by RAS have been shown to up-regulate DNMT1 leading to
increased promoter methylation (Ordway et al., 2004).
The small subgroup of CIMP-M tumours identified in the current study (14%) showed
intermediate levels of CpG methylation relative to CIMP-L and CIMP-H. The complete
absence of KRAS and BRAF mutations, predilection for the distal colon and high
frequency of EMVI (Table 5.1) suggests that CIMP-M tumours may represent a clinically
Chapter 7 General discussion 99
distinctive subgroup of CRC. However, since CIMP-M was a relatively small subgroup,
further investigation is required to confirm these observations. The short follow-up time
of the CRC patient cohort in this study meant the prognostic significance of the three
CIMP subgroups could not be evaluated.
Available evidence suggests that mitotically heritable DNA methylation in normal cells
functions to determine cell fate (Reik, 2007; Shen et al., 2007a). Genes targeted for
hypermethylation in stem cells and in cancer cells show frequent association with PcG
proteins and a propensity for bivalent modification of associated histone proteins
(McCabe et al., 2009b; Ohm et al., 2007; Schlesinger et al., 2007; Zhao et al., 2007).
Hypermethylation of target genes may thus confer a survival advantage to cancer cells
and promote carcinogenesis through maintenance of epigenetic plasticity and cellular
pluripotency. To determine if specific methylation changes are involved in the
development of CIMP+ CRC, expression of the relevant genes would need to be assessed.
Since RNA expression was not evaluated in this tumour series, it was not possible to
assess the functional significance of aberrant CpG methylation.
A substantial number of genes showed highly significant, differential methylation
between CIMP-H and CIMP-L tumours (Supplementary Table 5.2). Methylation and
somatic mutations for some of these genes have been reported previously in CRC. Further
investigation of these genes in terms of their expression level and their role in
development of the CIMP-H phenotype is warranted. Integration of other important
genetic events in CRC such as mutations in APC and p53 and LOH of 18q and 17p may
also help to further define the three CIMP subgroups. As with any approach for the
classification of CIMP, the present results require confirmation in independent cohorts of
unselected CRC using the same methylation analysis platform.
Chapter 7 General discussion 100
Despite the “comprehensive” profiling of methylation in this study, only a subset of
cancer-related genes was analyzed (n=808). Methylation analysis at the genome-wide
scale is required to elucidate the entire methylome in CRC. This can be achieved using
commercially available products with greater coverage such as the Illumina Infinium II
methylation array or by combining chromatin immunoprecipitation-enriched DNA with
microarray platforms. Alternatively, massively-parallel sequencing technology (deep
sequencing) allows methylation analysis with high accuracy, throughput and coverage
and requires no a priori knowledge of the genome sequence (Lister and Ecker, 2009).
This approach will allow high resolution analysis of methylation changes within and
outside of CpG islands that may be involved in the development of CRC.
7.5 CIMP+ in early onset CRC
Although CIMP+ CRC occurs predominantly in elderly patients, the present study
estimated that 8% of CRC from patients aged <60 years were CIMP+ (Chapter 6; Ang et
al., 2009). CIMP+ in this cohort was determined using a consensus panel of methylation
markers and MethyLight analysis. Considering that about 25% of all CRCs occur in <60
year old patients (Morris et al., 2007) and that the overall frequency of CIMP+ in CRC is
approximately 20%, 1 in 10 CIMP+ CRC are extrapolated to occur in this young age
group. The clinicopathological and molecular characteristics of these CIMP+ tumours
closely resemble those found in older patients and include proximal tumour location,
advanced stage and association with BRAF V600E mutation.
The occurrence of CIMP+ tumours in early onset CRC patients, together with their
previously reported associations with serrated adenomas/hyperplastic polyps (Hawkins
and Ward, 2001; Jass et al., 2000; Mäkinen et al., 2001) suggests a possible familial
Chapter 7 General discussion 101
origin for this tumour phenotype. Jass and coworkers have proposed that hyperplastic
polyposis (HPP) and serrated polyposis syndrome (SPS) may predispose to CIMP+ CRC
(Young and Jass, 2006; Young et al., 2007). SPS and HPP are rare conditions in which
familial clustering is only sometimes observed, meaning the proportion of all CIMP+
CRCs with a hereditary origin is likely to be small (Young and Jass, 2006; Young et al.,
2007). Elevated methylation levels have been demonstrated in the normal mucosa of SPS
and HPP patients (Minoo et al., 2006; Wynter et al., 2004), paralleling observations made
in the normal colonic tissues of sporadic CIMP+ CRC patients (Kawakami et al., 2006).
Information on family history of CRC and detailed pathology information on serrated
architecture was not available for the young CIMP+ CRC patients identified in the present
study. This information should ideally be collected in further prospective research studies,
together with molecular screening for CIMP+ and BRAF mutation.
BRAF mutation in MSS CRC has been associated with positive family history of CRC
(Samowitz’05CR). In the present study (Chapter 6; Ang et al, 2009), BRAF mutations
were found in approximately half of the CIMP+ CRC from young patients. Serrated
adenomas also show a high frequency of BRAF mutation (Spring et al., 2006). These
findings suggest that screening for BRAF mutation in premalignant lesions and tumours
from young patients may be a convenient approach for the identification of possible
familial conditions such as SPS and HPP that could predispose to CIMP+ CRC. Another
approach may be to assess promoter methylation levels in the normal colonic mucosa of
individuals judged to be at high risk because of positive family history of CRC and/or the
presence of polyps with a serrated architecture. Because of the generally low methylation
levels present in normal colonic mucosa, techniques that quantify methylation with single
CpG site resolution and high sensitivity are needed. Digital bisulfite sequencing, mass
spectrometry and pyrosequencing should all be suitable.
Chapter 7 General discussion 102
7.6 Major Findings and Conclusions
Ct value quality control
The Ct value was established as a quality control to assess the suitability of DNA for
methylation analysis, thus permitting efficient sample management. In the present study,
the Ct value was useful for ensuring the reproducibility of results using several
methylation analysis techniques including MSP, MethyLight, pyrosequencing, bsSEQ and
GoldenGate methylation arrays. As real-time quantification of genomic DNA is a
relatively straight forward process requiring minimal optimization, the Ct value represents
an ideal quality control system for widespread use in research and clinical settings.
CpG site methylation and gene expression
To date there has been no systematic study aimed at identifying CpG sites whose
methylation correlates with gene expression. Methylation data from single CpG sites in
CRC cell lines was used to construct a predictive model for RNA expression. This model
failed to predict RNA expression in primary CRCs, suggesting the same experimental
system should be used for both the construction and validation of such models.
Analysis of CIMP using methylation arrays
Unbiased analysis of comprehensive methylation data revealed three CIMP subgroups,
each associated with distinct clinicopathological and molecular features. KRAS and BRAF
mutations were significantly associated with the CIMP-H subgroup. The use of
methylation arrays allows both hyper- and hypomethylated genes to be investigated in
tumours relative to normal tissue. Genome-wide analysis of methylation and gene
expression should help to identify the aberrant biological pathways that underlie the
different CRC CIMP subgroups.
Chapter 7 General discussion 103
Possible familial origin for CIMP+
Approximately 10% of all CIMP+ CRC were found to arise in relatively young patients,
of which half also showed BRAF mutation. Several groups have proposed that hereditary
factors may contribute to the development of some CIMP+ CRC. The lack of information
on family history of cancer and on pathological information relating to serrated
architecture precluded investigation of this concept in the present study.
References 104
References
Aaltonen L, Johns L, Jarvinen H, Mecklin JP, Houlston R (2007). Explaining the familial colorectal cancer risk associated with mismatch repair (MMR)-deficient and MMR-stable tumours. Clin Cancer Res 13: 356-61. Ang PW, Li WQ, Soong R, Iacopetta B (2009). BRAF mutation is associated with the CpG island methylator phenotype in colorectal cancer from young patients. Cancer Lett 273: 221-4. Ang PW, Toh HB, Iacopetta B, Soong R (2008). An improved quality control for bisulfite-PCR-based DNA methylation analysis: cycle threshold value. Clin Chem Lab Med 46: 1117-21. Barault L, Charon-Barra C, Jooste V, de la Vega M, Martin L, Roignot P et al (2008a). Hypermethylator phenotype in sporadic colon cancer: study on a population-based series of 582 cases. Cancer Res 68: 8541-6. Barault L, Charon-Barra C, Jooste V, de la Vega MF, Martin L, Roignot P et al (2008b). Hypermethylator phenotype in sporadic colon cancer: study on a population-based series of 582 cases. Cancer Res 68: 8541-6. Bibikova M, Fan JB (2009). GoldenGate assay for DNA methylation profiling. Methods Mol Biol 507: 149-63. Bibikova M, Lin Z, Zhou L, Chudin E, Garcia EW, Wu B et al (2006). High-throughput DNA methylation profiling using universal bead arrays. Genome Res 16: 383-93. Byun HM, Siegmund KD, Pan F, Weisenberger DJ, Kanel G, Laird PW et al (2009). Epigenetic profiling of somatic tissues from human autopsy specimens identifies tissue- and individual-specific DNA methylation patterns. Hum Mol Genet. Campan M, Weisenberger DJ, Trinh B, Laird PW (2009). MethyLight. Methods Mol Biol 507: 325-37. Cedar H, Bergman Y (2009). Linking DNA methylation and histone modification: patterns and paradigms. Nat Rev Genet 10: 295-304. Chen T, Hevi S, Gay F, Tsujimoto N, He T, Zhang B et al (2007). Complete inactivation of DNMT1 leads to mitotic catastrophe in human cancer cells. Nat Genet 39: 391-6. Christensen BC, Houseman EA, Marsit CJ, Zheng S, Wrensch MR, Wiemels JL et al (2009). Aging and environmental exposures alter tissue-specific DNA methylation dependent upon CpG island context. PLoS Genet 5: e1000602. Clark SJ, Statham A, Stirzaker C, Molloy PL, Frommer M (2006). DNA methylation: bisulphite modification and analysis. Nat Protoc 1: 2353-64.
References 105
Cortez CC, Jones PA (2008). Chromatin, cancer and drug therapies. Mutat Res 647: 44-51. Crook S, Seth R, Jackson D, Ilyas M (2009). Concomitant mutations and splice variants in KRAS and BRAF demonstrate complex perturbation of the Ras/Raf signalling pathway in Colorectal Cancer. Gut. Cropley JE, Martin DI, Suter CM (2008). Germline epimutation in humans. Pharmacogenomics 9: 1861-8. Crott JW, Liu Z, Keyes MK, Choi SW, Jang H, Moyer MP et al (2008). Moderate folate depletion modulates the expression of selected genes involved in cell cycle, intracellular signaling and folate uptake in human colonic epithelial cell lines. J Nutr Biochem 19: 328-35. Curtin K, Samowitz W, Wolff R, Caan B, Ulrich C, Potter J et al (2009). MSH6 G39E polymorphism and CpG island methylator phenotype in colon cancer. Mol Carcinog. Curtin K, Slattery ML, Ulrich CM, Bigler J, Levin TR, Wolff RK et al (2007). Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet. Carcinogenesis 28: 1672-9. Dejeux E, El abdalaoui H, Gut IG, Tost J (2009). Identification and quantification of differentially methylated loci by the pyrosequencing technology. Methods Mol Biol 507: 189-205. Dobrovic A, Kristensen LS (2009). DNA methylation, epimutations and cancer predisposition. Int J Biochem Cell Biol 41: 34-9. Downward J (2003). Targeting RAS signalling pathways in cancer therapy. Nat Rev Cancer 3: 11-22. Ehrich M, Zoll S, Sur S, van den Boom D (2007). A new method for accurate assessment of DNA quality after bisulfite treatment. Nucleic Acids Res 35: e29. Ellison J, Dean M, Goldman D (1993). Efficacy of fluorescence-based PCR-SSCP for detection of point mutations. Biotechniques 15: 684-91. Esteller M (2002). CpG island hypermethylation and tumour suppressor genes: a booming present, a brighter future. Oncogene 21: 5427-40. Esteller M (2007). Epigenetic gene silencing in cancer: the DNA hypermethylome. Hum Mol Genet 16 Spec No 1: R50-9. Fearon E, Vogelstein B (1990). A genetic model for colorectal tumourigenesis. Cell 61: 759-67. Ferracin M, Gafa R, Miotto E, Veronese A, Pultrone C, Sabbioni S et al (2008a). The methylator phenotype in microsatellite stable colorectal cancers is characterized by a distinct gene expression profile. J Pathol 214: 594-602.
References 106
Ferracin M, Gafà R, Miotto E, Veronese A, Pultrone C, Sabbioni S et al (2008b). The methylator phenotype in microsatellite stable colorectal cancers is characterized by a distinct gene expression profile. J Pathol 214: 594-602. Frazier M, Xi L, Zong J, Viscofsky N, Rashid A, Wu E et al (2003). Association of the CpG island methylator phenotype with family history of cancer in patients with colorectal cancer. Cancer Res 63: 4805-8. Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW et al (1992). A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A 89: 1827-31. Genereux DP, Johnson WC, Burden AF, Stoger R, Laird CD (2008). Errors in the bisulfite conversion of DNA: modulating inappropriate- and failed-conversion frequencies. Nucleic Acids Res 36: e150. Gilbert MT, Haselkorn T, Bunce M, Sanchez JJ, Lucas SB, Jewell LD et al (2007). The isolation of nucleic acids from fixed, paraffin-embedded tissues-which methods are useful when? PLoS One 2: e537. Goel A, Arnold CN, Tassone P, Chang DK, Niedzwiecki D, Dowell JM et al (2004). Epigenetic inactivation of RUNX3 in microsatellite unstable sporadic colon cancers. Int J Cancer 112: 754-9. Goll MG, Bestor TH (2005). Eukaryotic cytosine methyltransferases. Annu Rev Biochem 74: 481-514. Grady W, Carethers J (2008). Genomic and epigenetic instability in colorectal cancer pathogenesis. Gastroenterology 135: 1079-99. Grønbaek K, Hother C, Jones P (2007). Epigenetic changes in cancer. APMIS 115: 1039-59. Guil S, Esteller M (2009). DNA methylomes, histone codes and miRNAs: tying it all together. Int J Biochem Cell Biol 41: 87-95. Hammons G, Yan Y, Lopatina N, Jin B, Wise C, Blann E et al (1999). Increased expression of hepatic DNA methyltransferase in smokers. Cell Biol Toxicol 15: 389-94. Hastie T, Tibshirani R, Sherlock G, Eisen M, Brown P, Botstein D. (1999). Stanford University Statistics Department Technical report Stanford University Statistics Department. Hawkins N, Norrie M, Cheong K, Mokany E, Ku SL, Meagher A et al (2002). CpG island methylation in sporadic colorectal cancers and its relationship to microsatellite instability. Gastroenterology 122: 1376-87. Hawkins NJ, Ward RL (2001). Sporadic colorectal cancers with microsatellite instability and their possible origin in hyperplastic polyps and serrated adenomas. J Natl Cancer Inst 93: 1307-13.
References 107
He L, Hannon GJ (2004). MicroRNAs: small RNAs with a big role in gene regulation. Nat Rev Genet 5: 522-31. Herman J, Graff J, Myohanen S, Nelkin B, Baylin S (1996). Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 93: 9821-6. Hitchins MP, Ward RL (2009). Constitutional (germline) MLH1 epimutation as an aetiological mechanism for hereditary non-polyposis colorectal cancer. J Med Genet. Hoensch H, Peters W, Roelofs H, Kirch W (2006). Expression of the glutathione enzyme system of human colon mucosa by localisation, gender and age. Curr Med Res Opin 22: 1075-83. Humphries SE, Gudnason V, Whittall R, Day IN (1997). Single-strand conformation polymorphism analysis with high throughput modifications, and its use in mutation detection in familial hypercholesterolemia. International Federation of Clinical Chemistry Scientific Division: Committee on Molecular Biology Techniques. Clin Chem 43: 427-35. Iacobuzio-Donahue CA (2009). Epigenetic changes in cancer. Annu Rev Pathol 4: 229-49. Iacopetta B, Grieu F (2000). Routine detection of the replication error phenotype in clinical tumour specimens using fluorescence-SSCP. Biotechniques 28: 566-8, 570. Iacopetta B, Grieu F, Li W, Ruszkiewicz A, Caruso M, Moore J et al (2006). APC gene methylation is inversely correlated with features of the CpG island methylator phenotype in colorectal cancer. Int J Cancer 119: 2272-8. Iacopetta B, Heyworth J, Girschik J, Grieu F, Clayforth C, Fritschi L (2009). The MTHFR C677T and DeltaDNMT3B C-149T polymorphisms confer different risks for right- and left-sided colorectal cancer. Int J Cancer 125: 84-90. Iacopetta B, Kawakami K, Watanabe T (2008). Predicting clinical outcome of 5-fluorouracil-based chemotherapy for colon cancer patients: is the CpG island methylator phenotype the 5-fluorouracil-responsive subgroup? . Int J Clin Oncol 13: 498-503. Imai K, Yamamoto H (2008). Carcinogenesis and microsatellite instability: the interrelationship between genetics and epigenetics. Carcinogenesis 29: 673-80. Jass J (2005). Serrated adenoma of the colorectum and the DNA-methylator phenotype. Nat Clin Pract Oncol 2: 398-405. Jass J (2007a). Classification of colorectal cancer based on correlation of clinical, morphological and molecular features. Histopathology 50: 113-30. Jass J (2007b). Molecular heterogeneity of colorectal cancer: Implications for cancer control. Surg Oncol 16: S7-9.
References 108
Jass J, Whitehall V, Young J, Leggett B (2002). Emerging concepts in colorectal neoplasia. Gastroenterology 123: 862-76. Jass JR (2007c). Classification of colorectal cancer based on correlation of clinical, morphological and molecular features. Histopathology 50: 113-30. Jass JR, Iino H, Ruszkiewicz A, Painter D, Solomon MJ, Koorey DJ et al (2000). Neoplastic progression occurs through mutator pathways in hyperplastic polyposis of the colorectum. Gut 47: 43-9. Kanai Y, Ushijima S, Kondo Y, Nakanishi Y, Hirohashi S (2001). DNA methyltransferase expression and DNA methylation of CPG islands and peri-centromeric satellite regions in human colorectal and stomach cancers. Int J Cancer 91: 205-12. Kawakami K, Ooyama A, Ruszkiewicz A, Jin M, Watanabe G, Moore J et al (2008). Low expression of gamma-glutamyl hydrolase mRNA in primary colorectal cancer with the CpG island methylator phenotype. Br J Cancer 98: 1555-61. Kawakami K, Ruszkiewicz A, Bennett G, Moore J, Grieu F, Watanabe G et al (2006). DNA hypermethylation in the normal colonic mucosa of patients with colorectal cancer. Br J Cancer 94: 593-8. Kawasaki T, Ohnishi M, Nosho K, Suemoto Y, Kirkner GJ, Meyerhardt JA et al (2008). CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci. Mod Pathol 21: 245-55. Keyes MK, Jang H, Mason JB, Liu Z, Crott JW, Smith DE et al (2007). Older age and dietary folate are determinants of genomic and p16-specific DNA methylation in mouse colon. J Nutr 137: 1713-7. Kim K, Park U, Wang J, Lee J, Park S, Kim S et al (2008). Gene profiling of colonic serrated adenomas by using oligonucleotide microarray. Int J Colorectal Dis 23: 569-80. Kim YI (2005). 5,10-Methylenetetrahydrofolate reductase polymorphisms and pharmacogenetics: a new role of single nucleotide polymorphisms in the folate metabolic pathway in human health and disease. Nutr Rev 63: 398-407. Kiriakidou M, Tan GS, Lamprinaki S, De Planell-Saguer M, Nelson PT, Mourelatos Z (2007). An mRNA m7G cap binding-like motif within human Ago2 represses translation. Cell 129: 1141-51. Kristensen LS, Hansen LL (2009). PCR-based methods for detecting single-locus DNA methylation biomarkers in cancer diagnostics, prognostics, and response to treatment. Clin Chem 55: 1471-83. Lacey MR, Ehrlich M (2009). Modeling dependence in methylation patterns with application to ovarian carcinomas. Stat Appl Genet Mol Biol 8: Article 40.
References 109
Ladd-Acosta C, Pevsner J, Sabunciyan S, Yolken RH, Webster MJ, Dinkins T et al (2007). DNA methylation signatures within the human brain. Am J Hum Genet 81: 1304-15. Lee TI, Jenner RG, Boyer LA, Guenther MG, Levine SS, Kumar RM et al (2006). Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125: 301-13. Li D, Jin C, McCulloch C, Kakar S, Berger BM, Imperiale TF et al (2009). Association of large serrated polyps with synchronous advanced colorectal neoplasia. Am J Gastroenterol 104: 695-702. Li LC, Dahiya R (2002). MethPrimer: designing primers for methylation PCRs. Bioinformatics 18: 1427-31. Li W, Kawakami K, Ruszkiewicz A, Bennett G, Moore J, Iacopetta B (2006a). BRAF mutations are associated with distinctive clinical, pathological and molecular features of colorectal cancer independently of microsatellite instability status. Mol Cancer 5. Li WQ, Kawakami K, Ruszkiewicz A, Bennett G, Moore J, Iacopetta B (2006b). BRAF mutations are associated with distinctive clinical, pathological and molecular features of colorectal cancer independently of microsatellite instability status. Mol Cancer 5: 2. Licchesi JD, Herman JG (2009). Methylation-specific PCR. Methods Mol Biol 507: 305-23. Lister R, Ecker JR (2009). Finding the fifth base: genome-wide sequencing of cytosine methylation. Genome Res 19: 959-66. Lopez-Serra L, Esteller M (2008). Proteins that bind methylated DNA and human cancer: reading the wrong words. Br J Cancer 98: 1881-5. Lunn D, Thomas A, Best N, Spiegelhalter D (2000). WinBUGS -- a Bayesian modelling framework: concepts, structure, and extensibility. Statistics and Computing 10: 325-337. Mäkinen M, George S, Jernvall P, Mäkelä J, Vihko P, Karttunen T (2001). Colorectal carcinoma associated with serrated adenoma--prevalence, histological features, and prognosis. J Pathol 193: 286-94. Makino R, Yazyu H, Kishimoto Y, Sekiya T, Hayashi K (1992). F-SSCP: fluorescence-based polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) analysis. PCR Methods Appl 2: 10-3. Marsit CJ, Christensen BC, Houseman EA, Karagas MR, Wrensch MR, Yeh RF et al (2009). Epigenetic profiling reveals etiologically distinct patterns of DNA methylation in head and neck squamous cell carcinoma. Carcinogenesis 30: 416-22. Martin-Subero JI, Ammerpohl O, Bibikova M, Wickham-Garcia E, Agirre X, Alvarez S et al (2009). A comprehensive microarray-based DNA methylation study of 367 hematological neoplasms. PLoS One 4: e6986.
References 110
Martinez R, Martin-Subero JI, Rohde V, Kirsch M, Alaminos M, Fernandez AF et al (2009). A microarray-based DNA methylation study of glioblastoma multiforme. Epigenetics 4: 255-64. McCabe MT, Brandes JC, Vertino PM (2009). Cancer DNA methylation: molecular mechanisms and clinical implications. Clin Cancer Res 15: 3927-37. McRonald FE, Morris MR, Gentle D, Winchester L, Baban D, Ragoussis J et al (2009). CpG methylation profiling in VHL related and VHL unrelated renal cell carcinoma. Mol Cancer 8: 31. Menigatti M, Truninger K, Gebbers J, Marbet U, Marra G, Schär P (2009). Normal colorectal mucosa exhibits sex- and segment-specific susceptibility to DNA methylation at the hMLH1 and MGMT promoters. Oncogene 28: 899-909. Minoo P, Baker K, Goswami R, Chong G, Foulkes WD, Ruszkiewicz AR et al (2006). Extensive DNA methylation in normal colorectal mucosa in hyperplastic polyposis. Gut 55: 1467-74. Minoo P, Moyer M, Jass J (2007). Role of BRAF-V600E in the serrated pathway of colorectal tumourigenesis. J Pathol 212: 124-33. Miyamoto K, Asada K, Fukutomi T, Okochi E, Yagi Y, Hasegawa T et al (2003). Methylation-associated silencing of heparan sulfate D-glucosaminyl 3-O-sulfotransferase-2 (3-OST-2) in human breast, colon, lung and pancreatic cancers. Oncogene 22: 274-80. Morris M, Platell C, Iacopetta B (2007). A population-based study of age-related variation in clinicopathological features, molecular. Markers and outcome from colorectal cancer. Anticancer Res 27: 2833-8. Mulero-Navarro S, Esteller M (2008). Epigenetic biomarkers for human cancer: the time is now. Crit Rev Oncol Hematol 68: 1-11. Munson K, Clark J, Lamparska-Kupsik K, Smith SS (2007). Recovery of bisulfite-converted genomic sequences in the methylation-sensitive QPCR. Nucleic Acids Res 35: 2893-903. Myers R (1992). Classical and Modern Regression Analysis, 2nd edn. Wiley. Nagasaka T, Koi M, Kloor M, Gebert J, Vilkin A, Nishida N et al (2008a). Mutations in both KRAS and BRAF may contribute to the methylator phenotype in colon cancer. Gastroenterology 134: 1950-60. Nagasaka T, Koi M, Kloor M, Gebert J, Vilkin A, Nishida N et al (2008b). Mutations in both KRAS and BRAF may contribute to the methylator phenotype in colon cancer. Gastroenterology 134: 1950-60, 1960 e1. Nagasaka T, Sasamoto H, Notohara K, Cullings HM, Takeda M, Kimura K et al (2004). Colorectal cancer with mutation in BRAF, KRAS, and wild-type with respect to both oncogenes showing different patterns of DNA methylation. J Clin Oncol 22: 4584-94.
References 111
Ng EK, Tsang WP, Ng SS, Jin HC, Yu J, Li JJ et al (2009). MicroRNA-143 targets DNA methyltransferases 3A in colorectal cancer. Br J Cancer 101: 699-706. Niessen RC, Hofstra RM, Westers H, Ligtenberg MJ, Kooi K, Jager PO et al (2009). Germline hypermethylation of MLH1 and EPCAM deletions are a frequent cause of Lynch syndrome. Genes Chromosomes Cancer 48: 737-44. Normanno N, Tejpar S, Morgillo F, De Luca A, Van Cutsem E, Ciardiello F (2009). Implications for KRAS status and EGFR-targeted therapies in metastatic CRC. Nat Rev Clin Oncol. Nosho K, Irahara N, Shima K, Kure S, Kirkner GJ, Schernhammer ES et al (2008). Comprehensive biostatistical analysis of CpG island methylator phenotype in colorectal cancer using a large population-based sample. PLoS One 3: e3698. O'Riain C, O'Shea DM, Yang Y, Le Dieu R, Gribben JG, Summers K et al (2009). Array-based DNA methylation profiling in follicular lymphoma. Leukemia 23: 1858-66. Ogino S, Cantor M, Kawasaki T, Brahmandam M, Kirkner G, Weisenberger D et al (2006a). CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies. Gut 55: 1000-6. Ogino S, Cantor M, Kawasaki T, Brahmandam M, Kirkner GJ, Weisenberger DJ et al (2006b). CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies. Gut 55: 1000-6. Ogino S, Kawasaki T, Kirkner G, Kraft P, Loda M, Fuchs C (2007a). Evaluation of markers for CpG island methylator phenotype (CIMP) in colorectal cancer by a large population-based sample. J Mol Diagn 9: 305-14. Ogino S, Kawasaki T, Kirkner GJ, Kraft P, Loda M, Fuchs CS (2007b). Evaluation of markers for CpG island methylator phenotype (CIMP) in colorectal cancer by a large population-based sample. J Mol Diagn 9: 305-14. Ogino S, Kawasaki T, Kirkner GJ, Loda M, Fuchs CS (2006c). CpG island methylator phenotype-low (CIMP-low) in colorectal cancer: possible associations with male sex and KRAS mutations. J Mol Diagn 8: 582-8. Ogino S, Odze RD, Kawasaki T, Brahmandam M, Kirkner GJ, Laird PW et al (2006d). Correlation of pathologic features with CpG island methylator phenotype (CIMP) by quantitative DNA methylation analysis in colorectal carcinoma. Am J Surg Pathol. 30:1175-83. Ogino S, Nosho K, Kirkner G, Kawasaki T, Meyerhardt J, Loda M et al (2009). CpG island methylator phenotype, microsatellite instability, BRAF mutation and clinical outcome in colon cancer. Gut 58: 90-6.
References 112
Oliveira C, Velho S, Moutinho C, Ferreira A, Preto A, Domingo E et al (2007). KRAS and BRAF oncogenic mutations in MSS colorectal carcinoma progression. Oncogene 26: 158-63. Ordway JM, Williams K, Curran T (2004). Transcription repression in oncogenic transformation: common targets of epigenetic repression in cells transformed by Fos, Ras or Dnmt1. Oncogene 23: 3737-48. Osborn NK, Zou H, Molina JR, Lesche R, Lewin J, Lofton-Day C et al (2006). Aberrant methylation of the eyes absent 4 gene in ulcerative colitis-associated dysplasia. Clin Gastroenterol Hepatol 4: 212-8. Paz MF, Fraga MF, Avila S, Guo M, Pollan M, Herman JG et al (2003). A systematic profile of DNA methylation in human cancer cell lines. Cancer Res 63: 1114-21. Perrimon N, Bernfield M (2000). Specificities of heparan sulphate proteoglycans in developmental processes. Nature 404: 725-8. Preto A, Figueiredo J, Velho S, Ribeiro A, Soares P, Oliveira C et al (2008). BRAF provides proliferation and survival signals in MSI colorectal carcinoma cells displaying BRAF(V600E) but not KRAS mutations. J Pathol 214: 320-7. Probst A, Dunleavy E, Almouzni G (2009). Epigenetic inheritance during the cell cycle. Nat Rev Mol Cell Biol 10: 192-206. Rashid A, Issa JP (2004). CpG island methylation in gastroenterologic neoplasia: a maturing field. Gastroenterology 127: 1578-88. Ray S, Swanson H (2004). Dioxin-induced immortalization of normal human keratinocytes and silencing of p53 and p16. J Biol Chem 279: 27187–93. Reed K, Poulin ML, Yan L, Parissenti AM (2009). Comparison of bisulfite sequencing PCR with pyrosequencing for measuring differences in DNA methylation. Anal Biochem. Reik W (2007). Stability and flexibility of epigenetic gene regulation in mammalian development. Nature 447: 425-32. Rodriguez J, Frigola J, Vendrell E, Risques RA, Fraga MF, Morales C et al (2006). Chromosomal instability correlates with genome-wide DNA demethylation in human primary colorectal cancers. Cancer Res 66: 8462-9468. Royo JL, Hidalgo M, Ruiz A (2007). Pyrosequencing protocol using a universal biotinylated primer for mutation detection and SNP genotyping. Nat Protoc 2: 1734-9. Samowitz W, Albertsen H, Herrick J, Levin T, Sweeney C, Murtaugh M et al (2005a). Evaluation of a large, population-based sample supports a CpG island methylator phenotype in colon cancer. Gastroenterology 129: 837-45. Samowitz W, Slattery M, Sweeney C, Herrick J, Wolff R, Albertsen H (2007). APC mutations and other genetic and epigenetic changes in colon cancer. Mol Cancer Res 5: 165-70.
References 113
Samowitz W, Sweeney C, Herrick J, Albertsen H, Levin T, Murtaugh M et al (2005b). Poor survival associated with the BRAF V600E mutation in microsatellite-stable colon cancers. Cancer Res 65: 6063-9. Samowitz WS, Albertsen H, Herrick J, Levin TR, Sweeney C, Murtaugh MA et al (2005c). Evaluation of a large, population-based sample supports a CpG island methylator phenotype in colon cancer. Gastroenterology 129: 837-45. Samowitz WS, Albertsen H, Sweeney C, Herrick J, Caan BJ, Anderson KE et al (2006). Association of smoking, CpG island methylator phenotype, and V600E BRAF mutations in colon cancer. J Natl Cancer Inst 98: 1731-8. Sarter B, Long T, Tsong W, Koh W, Yu M, Laird P (2005). Sex differential in methylation patterns of selected genes in Singapore Chinese. Hum Genet 117: 402-3. Schatz P, Distler J, Berlin K, Schuster M (2006). Novel method for high throughput DNA methylation marker evaluation using PNA-probe library hybridization and MALDI-TOF detection. Nucleic Acids Res 34: e59. Schmittgen TD, Livak KJ (2008). Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3: 1101-8. Schofield L, Watson N, Grieu F, Li WQ, Zeps N, Harvey J et al (2009). Population-based detection of Lynch syndrome in young colorectal cancer patients using microsatellite instability as the initial test. Int J Cancer 124: 1097-102. Sepulveda AR, Jones D, Ogino S, Samowitz W, Gulley ML, Edwards R et al (2009). CpG methylation analysis--current status of clinical assays and potential applications in molecular diagnostics: a report of the Association for Molecular Pathology. J Mol Diagn 11: 266-78. Shen L, Kondo Y, Guo Y, Zhang J, Zhang L, Ahmed S et al (2007a). Genome-wide profiling of DNA methylation reveals a class of normally methylated CpG island promoters. PLoS Genet 3: 2023-36. Shen L, Toyota M, Kondo Y, Lin E, Zhang L, Guo Y et al (2007b). Integrated genetic and epigenetic analysis identifies three different subclasses of colon cancer. Proc Natl Acad Sci U S A 104: 18654-9. Shworak NW, Liu J, Petros LM, Zhang L, Kobayashi M, Copeland NG et al (1999). Multiple isoforms of heparan sulfate D-glucosaminyl 3-O-sulfotransferase. Isolation, characterization, and expression of human cdnas and identification of distinct genomic loci. J Biol Chem 274: 5170-84. Sohn KJ, Stempak JM, Reid S, Shirwadkar S, Mason JB, Kim YI (2003). The effect of dietary folate on genomic and p53-specific DNA methylation in rat colon. Carcinogenesis 24: 81-90.
References 114
Soong R, Iacopetta BJ (1997). A rapid and nonisotopic method for the screening and sequencing of p53 gene mutations in formalin-fixed, paraffin-embedded tumours. Mod Pathol 10: 252-8. Soong R, Ladanyi A (2003). Improved indicators for assessing the reliability of detection and quantification by kinetic PCR. Clin Chem 49: 973-6. Söreide K, Janssen E, Söiland H, Körner H, Baak J (2006). Microsatellite instability in colorectal cancer. Br J Surg 93: 395-406. Søreide K, Nedrebø B, Knapp J, Glomsaker T, Søreide J, Kørner H (2009). Evolving molecular classification by genomic and proteomic biomarkers in colorectal cancer: potential implications for the surgical oncologist. Surg Oncol 18: 31-50. Spring K, Zhao Z, Karamatic R, Walsh M, Whitehall V, Pike T et al (2006). High prevalence of sessile serrated adenomas with BRAF mutations: a prospective study of patients undergoing colonoscopy. Gastroenterology 131: 1400-7. Suter CM, Martin DI, Ward RL (2004). Hypomethylation of L1 retrotransposons in colorectal cancer and adjacent normal tissue. Int J Colorectal Dis 19: 95-101. Suter CM, Norrie M, Ku SL, Cheong KF, Tomlinson I, Ward RL (2003). CpG island methylation is a common finding in colorectal cancer cell lines. Br J Cancer 88: 413-9. Tan YH, Liu Y, Eu KW, Ang PW, Li WQ, Salto-Tellez M et al (2008). Detection of BRAF V600E mutation by pyrosequencing. Pathology 40: 295-8. Tost J (2009). DNA methylation: an introduction to the biology and the disease-associated changes of a promising biomarker. Methods Mol Biol 507: 3-20. Tost J, Dunker J, Gut IG (2003). Analysis and quantification of multiple methylation variable positions in CpG islands by Pyrosequencing. Biotechniques 35: 152-6. Tost J, Gut IG (2007). DNA methylation analysis by pyrosequencing. Nat Protoc 2: 2265-75. Toyota M, Ahuja N, Ohe-Toyota M, Herman J, Baylin S, Issa J (1999a). CpG island methylator phenotype in colorectal cancer. Proc Natl Acad Sci U S A 96: 8681-6. Toyota M, Ahuja N, Ohe-Toyota M, Herman JG, Baylin SB, Issa JP (1999b). CpG island methylator phenotype in colorectal cancer. Proc Natl Acad Sci U S A 96: 8681-6. Toyota M, Ohe-Toyota M, Ahuja N, Issa JP (2000). Distinct genetic profiles in colorectal tumours with or without the CpG island methylator phenotype. Proc Natl Acad Sci U S A 97: 710-5. Troyanskaya O, Cantor M, Sherlock G, Brown P, Hastie T, Tibshirani R et al (2001). Missing value estimation methods for DNA microarrays. Bioinformatics 17: 520-5. Ulrich CM, Reed MC, Nijhout HF (2008). Modeling folate, one-carbon metabolism, and DNA methylation. Nutr Rev 66 Suppl 1: S27-30.
References 115
Van Rijnsoever M, Elsaleh H, Joseph D, McCaul K, Iacopetta B (2003). CpG island methylator phenotype is an independent predictor of survival benefit from 5-fluorouracil in stage III colorectal cancer. Clin Cancer Res 9: 2898-903. van Rijnsoever M, Grieu F, Elsaleh H, Joseph D, Iacopetta B (2002). Characterisation of colorectal cancers showing hypermethylation at multiple CpG islands. Gut 51: 797-802. Wallace K, Grau MV, Ahnen D, Snover DC, Robertson DJ, Mahnke D et al (2009). The association of lifestyle and dietary factors with the risk for serrated polyps of the colorectum. Cancer Epidemiol Biomarkers Prev 18: 2310-7. Walther A, Johnstone E, Swanton C, Midgley R, Tomlinson I, Kerr D (2009). Genetic prognostic and predictive markers in colorectal cancer. Nat Rev Cancer 9: 489-99. Wang C, van Rijnsoever M, Grieu F, Bydder S, Elsaleh H, Joseph D et al (2003). Prognostic significance of microsatellite instability and Ki-ras mutation type in stage II colorectal cancer. Oncology 64: 259-65. Wang X, Lam EK, Zhang J, Jin H, Sung JJ (2009). MicroRNA-122a functions as a novel tumour suppressor downstream of adenomatous polyposis coli in gastrointestinal cancers. Biochem Biophys Res Commun 387: 376-80. Ward R, Williams R, Law M, Hawkins N (2004). The CpG island methylator phenotype is not associated with a personal or family history of cancer. Cancer Res 64: 7618-21. Watson N, Grieu F, Morris M, Harvey J, Stewart C, Schofield L et al (2007). Heterogeneous staining for mismatch repair proteins during population-based prescreening for hereditary nonpolyposis colorectal cancer. J Mol Diagn 9: 472-8. Weisenberger D, Siegmund K, Campan M, Young J, Long T, Faasse M et al (2006a). CpG island methylator phenotype underlies sporadic microsatellite instability and is tightly associated with BRAF mutation in colorectal cancer. Nat Genet 38: 787-93. Weisenberger DJ, Siegmund KD, Campan M, Young J, Long TI, Faasse MA et al (2006b). CpG island methylator phenotype underlies sporadic microsatellite instability and is tightly associated with BRAF mutation in colorectal cancer. Nat Genet 38: 787-93. Weisenberger DJ, Trinh BN, Campan M, Sharma S, Long TI, Ananthnarayan S et al (2008). DNA methylation analysis by digital bisulfite genomic sequencing and digital MethyLight. Nucleic Acids Res 36: 4689-98. Weitz J, Koch M, Debus J, Hohler T, Galle PR, Buchler MW (2005). Colorectal cancer. Lancet 365: 153-65. Whittaker JC, Thompson R, Denham MC (2000). Marker-assisted selection using ridge regression. Genet Res 75: 249-52. Widschwendter M, Fiegl H, Egle D, Mueller-Holzner E, Spizzo G, Marth C et al (2007). Epigenetic stem cell signature in cancer. Nat Genet 39: 157-8.
References 116
Wood LD, Calhoun ES, Silliman N, Ptak J, Szabo S, Powell SM et al (2006). Somatic mutations of GUCY2F, EPHA3, and NTRK3 in human cancers. Hum Mutat 27: 1060-1. Wynter C, Walsh M, Higuchi T, Leggett B, Young J, Jass J (2004). Methylation patterns define two types of hyperplastic polyp associated with colorectal cancer. Gut 53: 573-80. Xiao Y, Word B, Starlard-Davenport A, Haefele A, Lyn-Cook B, Hammons G (2008). Age and gender affect DNMT3a and DNMT3b expression in human liver. Cell Biol Toxicol 24: 265-72. Young J, Jass JR (2006). The case for a genetic predisposition to serrated neoplasia in the colorectum: hypothesis and review of the literature. Cancer Epidemiol Biomarkers Prev 15: 1778-84. Young J, Jenkins M, Parry S, Young B, Nancarrow D, English D et al (2007). Serrated pathway colorectal cancer in the population: genetic consideration. Gut 56: 1453-9. Yu J, Freimuth RR, Culverhouse R, Marsh S, Watson MA, McLeod HL (2008). DNA methylotype analysis in colorectal cancer. Oncol Rep 20: 921-7. Zhang Y, Rohde C, Tierling S, Stamerjohanns H, Reinhardt R, Walter J et al (2009). DNA methylation analysis by bisulfite conversion, cloning, and sequencing of individual clones. Methods Mol Biol 507: 177-87.
Appendices 117
Appendices
Supplementary Table 2.1 CRC cell lines and corresponding culture medium as
recommended by American Type Culture Collection (ATCC).
Cell lines Culture medium
Colo 201 RPMI-1640
Colo 205 RPMI-1640
Colo 320 RPMI-1640
HCT 116 DMEM
HL 60 DMEM
LS 174T DMEM
SW 480 DMEM
SW 620 DMEM
SW 837 DMEM
RKO DMEM
Supplementary Table 2.2 PCR amplification conditions for F-SSCP analysis of BRAF,
KRAS, and MSI.
Primer
Sequence
Annealing Temperature
(°C)
Amplicon size (bp)
BAT26 F 5’ – TTGGATATTGCAGCAGTCAG – 3’ 46 136 BAT26 R 5’ – GCTCCTTTATAAGCTTCTTCA – 3’
BRAF F 5’ – TCATAATGCTTGCTCTGATAGGA – 3’ 60 224 BRAF R 5’ – GGCCAAAAATTTAATCAGTGGA – 3’
KRAS F 5’ – GACTGAATATAAACTTGTGG – 3’ 54 107 KRAS R 5’ – CTATTGTTGGATCATATTCG – 3’
Appendices 118
Supplementary Table 2.3 Pyrosequencing PCR conditions, PCR primers, pyrosequencing primers
Gene PCR Forward primer (5’ – 3’) PCR Reverse primer (5’ – 3’) tagged with universal seq GGGACACCGCTGATCGTTTA at the 5’ end
Sequencing primer (5’ – 3’)
Amplicon size (bp)
Annealing Temp (°C)
Sequence to analyse Dispensation order
RUNX3
R133 TAGGGTTTTTAGGAGATT CCCAAAAACCTCCACCCCACA TTTTAGGAGATTTTTTTT 133 55 ATCAGTG YGTTTGTTTT
R147 GGGACACCGCTGATCGTTTATTATYGGTTTTGAGATTT CTCRAATCGTAACTCCCT CAACCCCGAACTAAAAAC 147 60 TCGATCAGAGTC CRCRAAATCT
R147a TTATYGGTTTTGAGATTT CTCRAATCGTAACTCCCT GTTGTAGAAGTTATAGGT 147 50 ATCTGAGTA TYGAAGTAG GAAGGGGTTGYGTTTTAG ATCAGTAGA YGTTAGGGAGT R170 GYGGTTTTYGGTAGGTTT ATCCTCCAAAATCAAATA GTAGGTTTYGTTTTTTTT 170 55 ATCAGTCTGATCAGT YGYGAAYGTTAT
R140 GGGACACCGCTGATCGTTTAGTYGYGTYGTTTTYGTTTGTT AATCCCRCACTCACCTTA AACAACRACCRTCAAAAC 140 58 TGATCAGAGC RCCRAACAA
R181 AGGYGGTYGTGGGGTTYGGA AATCCCRCACTCACCTTA TYGAGGTGYGTTYGATGGTGG 181 60 GATCAGTGT AYGTGTTGG R148 TYGAGGTGYGTTYGATGGTGG AATCCCRCACTCACCTTA ATTGGYGTTGTAATAAGA 148 60 ATCAGTGTCAGTC YGTTGTTYGTYG
DPYD
D244 TTTTTGTTTGTAGGTTGGG TACCAATAACAAACCCTCCTTAC YGTGTTTGGYGYGGGAGT 244 60 ATCAGTAGATCTGAGAGTCTG YGTAGGATYGAGAGYGT TYGTTTYGYGTTYGT 244 ATCAGTCAGTCTG TTYGTTTTYGYGTYGT D230 AGTAAGGATTYGGYGGATAT AAAATCCTCCCCTAAACT YGTGTTTGGYGYGGGAGT 230 55 ATCAGTCAGTC YGYGTYGG GGTGGTGGGGAGTGTTTT 230 AGTCAGTAG GYGGGTAGGTG TTTTYGYGGTTTTYGTATTT 230 ATCTGAGAGTGAGAGATCAGTCTG YGGAGAGTGAGAGAYGYG
Appendices 119
Supplementary Table 2.4 Bisulfite-cloning sequencing PCR conditions, primers
Amplicon size (bp)
Forward primer (5’ – 3’)
Reverse primer (5’ – 3’)
PCR annealing
temperature (°C)
DPYD
289 AGAGATTAAAGGTTAGTTT CCAATAACAAACCCTCCTTACRTC 55
295 AGTYGTAGGATYGAGAGYGT ACACCTACCCRCAAAACACT 60
287 AAGGAGGGTTTGTTATTGGT AAAATCCTCCCCTAAACT 65
226 AGTGTTTTGYGGGTAGGTGT CAAACTTCCTAAAATCTCTT 60
RUNX3
428 GAAATTTGTTTTGAGGGGAGAGTAG ACCRCCCTCTCTCRAATCRTAACT 65
410 TAGAAAGAGTTGGGGAAGTT AACAAATCCTCCAAAATCAAATAAC 60
438 ATGGGGGTTTYGTYGATTGGT ACRCCTCCTCRACCRCCRCTA 65
338 GAGGATGYGGGATTAGTYGGGT CCRCTATTCTCRCCCATCTTA 65
422 GGYGTTTTGAYGGTYGTTGTTA ATATCRCCRCRACRTCTCRAA 57
347 TAAGGTGAGTGYGGGATT AAATCCTCTTCTCCRTTACCCRCA 65
Appendices 120
Supplementary Table 2.5 Reagents and suppliers
Reagents Supplier
Acrylamide (�99%) Sigma-Aldrich, St. Louis, MO Ammonium acetate Sigma-Aldrich, St. Louis, MO Ammonium persulfate (�98%) Sigma-Aldrich, St. Louis, MO Ampicilin Sigma-Aldrich, St. Louis, MO Boric Acid MERCK Pte Ltd. Victoria, Australia Chloroform Sigma-Aldrich, St. Louis, MO Dulbecco’s modified Eagle medium (DMEM)
GIBCO® Invitrogen Cell Culture, Invitrogen Corporation, Carlsbad, CA
EDTA MERCK Pte Ltd. Victoria, Australia Fetal bovine calf serum (FBS) GIBCO® Invitrogen Cell Culture, Invitrogen
Corporation, Carlsbad, CA Glycerol MERCK Pte Ltd. Victoria, Australia Glycogen Sigma-Aldrich, St. Louis, MO
L-glutamine GIBCO® Invitrogen Cell Culture, Invitrogen Corporation, Carlsbad, CA
Hydrochloric acid Sigma-Aldrich, St. Louis, MO IPTG Probiogen AG, Berlin, Germany Magnesium acetate Sigma-Aldrich, St. Louis, MO Penicillin Sigma-Aldrich, St. Louis, MO Phosphate buffer saline (PBS) Invitrogen Corporation, Carlsbad, CA Proteinase K Solution (20 mg/ml) Invitrogen Corporation, Carlsbad, CA Phenol:Chloroform:Isoamyl Alcohol
25:24:1 Saturated with 10 mM Tris, pH 8.0, 1 mM EDTA.
Sigma-Aldrich, St. Louis, MO
RPMI 1640 Invitrogen Corporation, Carlsbad, CA Streptomycin sulphate Sigma-Aldrich, St. Louis, MO Sodium chloride Sigma-Aldrich, St. Louis, MO Streptavidin SepharoseTM High
Performance beads Amersham Biosciences, Uppsala, Sweden
Sodium acetate Sigma-Aldrich, St. Louis, MO SYBR® Safe DNA gel stain Invitrogen Corporation, Carlsbad, CA Trypsin Gibco Tween® 20, Molecular Grade Promega, Madison, WI TRI Reagent® Molecular Research Centre, Cincinnati, OH) Tris MERCK Pte Ltd. Victoria, Australia Tris acetate MERCK Pte Ltd. Victoria, Australia X-gal Promega, Madison, WI
Appendices 121
Supplementary Table 2.6 Commercial kits and suppliers
Commercial kits/assays Manufacturer/supplier Cell lines Colorectal cancer cell lines American Type Culture Collection (ATCC),
Manassas, VA
Cloning & sequencing BigDye Terminator v 3.1 Cycle Sequencing kit Applied Biosystems, Foster City, CA MAX Efficiency® DH5�™ Competent Cells Invitrogen, Carlsbad, CA pGEM®-T Easy Vector Systems Promega, Madison, WI Wizard® DNA Clean-Up System Promega, Madison, WI Wizard® Plus SV Minipreps DNA Purification System
Promega, Madison, WI
Enzyme CpG Methyltransferase (M.SssI) New England Biolabs, Ipswich, MA GoldenGate methylation analysis Goldengate Cancer Panel I methylation array Illumina Inc. San Diego Nucleic acid extraction kits DNeasy Blood & Tissue Kit Qiagen, Valencia, CA RNeasy® Mini Kit Qiagen, Valencia, CA QIAquick DNA Purification kit Qiagen, Valencia, CA PCR reagents FastStart Taq polymerase Roche, Mannheim, Germany HEX-fluorescently tagged oligonucleotides GeneWorks Pty Ltd, Adelaide PCR-grade oligonucleotides 1st BASE Pte Ltd, Singapore Taq DNA Polymerase Qiagen, Valencia, CA 6FAM, TAMRA-labelled probes 1st BASE Pte Ltd, Singapore Pyrosequencing enzymes Pyro Gold Reagents Biotage RNA quantification High Capacity cDNA Reverse Transcription Kit
Applied Biosystems, Foster City, CA
TaqMan® Gene Expression Assays Hs00559279_m1 (DPYD), Hs00231709_m1 (RUNX3), Hs99999905_m1 (GAPDH)
Applied Biosystems, Foster City, CA
TaqMan® Fast Universal PCR Master Mix (2x) without AmpErase® UNG
Applied Biosystems, Foster City, CA
Appendices 122
Supplementary Table 2.7 Instrument, software, labware and manufacturers
Instruments, software, labware Manufacturer
BeadArray Reader Illumina Inc. San Diego BeadScan Illumina Inc. San Diego BeadStudio Illumina Inc. San Diego Bio-Rad Gel DocTM 2000 system Bio-Rad Laboratories, Inc, Hercules, CA Forma 310 Series Direct Heat CO2 Incubator Thermo Fisher Scientific Inc.,
Wilmington, DE , USA MicroAmp® Fast 96-Well Reaction Plate Applied Biosystems Inc, Foster City, CA MicroAmp® Optical Adhesive Film Applied Biosystems Inc, Foster City, CA Nanodrop ND-1000 Thermo Fisher, Wilmington, DE One-D gel analysis software (1.3) Scanalytics Inc., Fairfax, VA, USA PSQ96MA instrument Qiagen, Valencia, CA Sequencing Analysis 5.2 with KB basecaller Applied Biosystems, Foster City, CA Tomy MV-100 Micro Vac Tomy Tech USA Inc, Encyclopedia
Circle Fremont, CA T25 tissue culture flask Corning Incorporated Life Sciences,
Lowell, MA QIAxcel system Qiagen, Valencia, CA 3130xl Genetic Analyzer Applied Biosystems, Foster City, CA 7900HT Fast Real-Time PCR System Applied Biosystems, Foster City, CA
Supplementary Table 2.8 Constituents of buffers and solutions
Buffers/Solutions Constituents LB (Luria-Bertani) Agar with ampicilin, X-gal and IPTG
1% bacto tryptone, 0.5% yeast extract, 0.5% sodium choride, 0.08% sodium hydroxide 5 M, 100 �g/ml ampicilin, 0.08 mg/ml X-Gal, 5 �M IPTG, 1.5% agar
LB (Luria-Bertani) broth with ampicilin
1% bacto tryptone, 0.5% yeast extract, 0.5% sodium choride, 0.08% sodium hydroxide 5 M, 100 �g/ml ampicilin
SOC medium 2% bacto tryptone, 0.5% yeast extract, 0.05% sodium chloride, 0.02% potassium chloride, 2 M glucose, 2 M Mg2+sctock
TBE buffer 89 mM Tris, 89 M boric acid, 2 mM EDTA in H2O Tris-HCl 121 g Tris base, 800 ml H2O
Adjusted to desired pH with concentrated HCl, add H2O to 1 liter
30% Acrylamide (50:1) Acrylamide 30g, N-N’-methylene-bis acrylamide 0.6g in H2O
Appendices 123
Supplementary Table 4.1 Simulated MethyLight are designed based on the number of
CG sites probed by forward primer (F), probe (P) and reverse primer (R), the number of
CG not examined between forward primer and probe (CGs btw FP), probe and reverse
primer (CGs btw PR) and the distance between forward primer and probe (F to P), probe
and reverse primer (P to R), the length of each oligonucleotide and the entire amplicon.
Gene F CGs between
FP
P CGs between
PR
R F (bp)
F to P (bp)
P (bp)
P to R (bp)
R (bp)
Amplicon (bp)
RUNX 3 0 5 3 3 19 3 25 45 25 117 CACNA1G 3 0 4 0 4 22 1 25 1 18 67 IGF2 3 2 4 0 3 20 22 22 3 21 88 NEU 3 0 4 0 3 23 3 27 10 25 88 SOCS2 3 0 4 1 2 21 6 26 10 21 84 CDH1 3 0 3 3 1 20 3 21 31 21 96 CHFR 2 2 3 3 2 19 20 25 19 21 104 DAPK 4 0 3 0 3 21 2 21 5 19 68 hMLH1 2 0 4 0 2 21 4 31 7 21 84 p15 2 0 2 0 3 20 6 29 5 21 81 p16 1 1 4 0 2 22 9 18 2 19 70 p57 3 0 3 0 3 20 4 31 2 18 75 RASSF1A 1 1 2 0 3 20 6 18 1 20 65 TIMP3 2 2 4 4 3 21 8 19 25 22 95 ER 2 0 5 3 3 19 9 24 30 19 101 Mlh1 4 2 4 0 3 30 5 22 13 18 88 Average bp 3 1 4 1 3 21 7 24 13 21 86
Appendices 124
Supplementary Figure 5.1 Unsupervised hierarchical clustering of 1505 probes (rows)
in 28 normal colonic tissues (columns). Methylation of X-chromosome genes (enclosed
within yellow rectangle) showed 100% correlation to gender as indicated by the red
(female) and blue (male) bar above the heatmap.
Supplementary Figure 5.2 Unsupervised hierarchical clustering of 1505 probes (rows)
in 91 colorectal tumours (columns) revealed three tumour subgroups.
Appendices 125
Supplementary Figure 5.3 Principal component analysis of 202 CpG loci that were
differentially methylated between tumour and normal colonic tissue. This identified
principal component 2 as the top ranking dimension and which explained 20% of the
variability in the dataset. CIMP-H tumours are denoted in black, CIMP-M in black and
CIMP-L in red.
Appendices 126
Supplementary Table 5.1 202 CpG sites differentially methylated between normal and tumour tissues. Probe Gene P-value
(Normal vs Tumor)
Hypermethylation/Hypomethylation1
Overlap_with_Repeat2
SNP contained in the probe2
SNP frequency Variant Freq > 5%
EYA4_E277_F EYA4 1.27E-13 1 HS3ST2_E145_R HS3ST2 8.90E-13 1 TFPI2_P152_R TFPI2 3.20E-12 1 SLIT2_P208_F SLIT2 7.70E-12 1 NO rs2301252 G/T: G allele=64%, T
allele=36% Yes
SLIT2_E111_R SLIT2 2.43E-11 1 TMEFF2_P152_R TMEFF2 3.36E-11 1 DBC1_E204_F DBC1 3.39E-11 1 HTR1B_E232_R HTR1B 3.91E-11 1 TMEFF2_E94_R TMEFF2 1.02E-10 1 TWIST1_E117_R TWIST1 1.03E-10 1 NO rs34354639 ins/delG: freq unknown na NPY_E31_R NPY 1.09E-10 1 TWIST1_P44_R TWIST1 1.38E-10 1 NEFL_P209_R NEFL 1.53E-10 1 TFPI2_P9_F TFPI2 2.16E-10 1 YES rs2071458 G/T: G allele=79%, T
allele=21% Yes
SFRP1_P157_F SFRP1 2.72E-10 1 ESR1_P151_R ESR1 3.55E-10 1 NO rs34430742 A/G: G allele=100%, A
allele=0% No
FLI1_E29_F FLI1 4.34E-10 1 NTRK3_P752_F NTRK3 4.59E-10 1 TGFB2_E226_R TGFB2 5.18E-10 1 FLI1_P620_R FLI1 5.28E-10 1 NO rs2227636 A/G: G allele=100%, A
allele=0% No
RASGRF1_E16_F RASGRF1 5.39E-10 1 EYA4_P794_F EYA4 6.36E-10 1 SPP1_P647_F SPP1 7.39E-10 0 NGFB_E353_F NGFB 8.07E-10 1
Appendices 127
SOX17_P287_R SOX17 1.00E-09 1 NPY_P295_F NPY 1.02E-09 1 NPY_P91_F NPY 1.04E-09 1 NGFB_P13_F NGFB 1.31E-09 1 GSTM2_E153_F GSTM2 1.42E-09 1 SCGB3A1_E55_R SCGB3A1 1.48E-09 1 BMP4_P199_R BMP4 1.71E-09 0 DLK1_E227_R DLK1 1.88E-09 1 TPEF_seq_44_S88_R TPEF 2.30E-09 1 GABRB3_E42_F GABRB3 3.08E-09 1 TWIST1_P355_R TWIST1 4.06E-09 1 NO rs10717999 ins/delG: freq unknown na TNFSF8_P184_F TNFSF8 5.16E-09 0 NTRK3_E131_F NTRK3 5.78E-09 1 KDR_P445_R KDR 6.97E-09 1 NO rs39315 C/T: C allele=43%, T
allele=57% Yes
CDH13_E102_F CDH13 7.88E-09 1 NOS3_P38_F NOS3 8.02E-09 0 EYA4_P508_F EYA4 8.29E-09 1 ALK_E183_R ALK 8.43E-09 1 FLT4_E206_F FLT4 1.02E-08 1 GAS7_E148_F GAS7 1.12E-08 1 CDH13_P88_F CDH13 1.22E-08 1 WNT2_E109_R WNT2 1.23E-08 1 FGF5_P238_R FGF5 1.27E-08 1 NO rs2051548 A/G: G allele=100%, A
allele=0% No
HLA-DPA1_P205_R HLA-DPA1 1.43E-08 0 NO rs7047734 C/G: freq unknown na HLA-DPA1_P28_R HLA-DPA1 1.60E-08 0 ALK_P28_F ALK 1.75E-08 1 NO rs2303368 A/C: C allele=100%, A
allele=0% No
GSTM2_P453_R GSTM2 1.79E-08 1 THY1_P149_R THY1 1.83E-08 1 PTPRH_E173_F PTPRH 1.93E-08 0 GABRB3_P92_F GABRB3 1.96E-08 1 NO rs36005339 A/T: A allele=100%, T
allele=0% No
Appendices 128
KRT1_P798_R KRT1 2.02E-08 0 HS3ST2_P171_F HS3ST2 2.55E-08 1 NO rs1805088;rs45592943 C/T: C allele=100%, T
allele=0% No
NTRK3_P636_R NTRK3 3.42E-08 1 IGFBP3_P423_R IGFBP3 3.51E-08 1 NO rs9951523 C/T: C allele=97%, T
allele=3% No
MYOD1_E156_F MYOD1 3.58E-08 1 TUSC3_P85_R TUSC3 3.65E-08 1 NO rs34597537;rs3215003 ins/delC: del/del=100% No MEST_E150_F MEST 3.71E-08 0 NRG1_P558_R NRG1 3.82E-08 1 YES rs7420590 G/A: freq unknown na PGR_P790_F PGR 3.93E-08 0 GAS7_P622_R GAS7 4.34E-08 1 ADCYAP1_P398_F ADCYAP1 5.22E-08 1 EPHA5_E158_R EPHA5 5.23E-08 1 GSTM2_P109_R GSTM2 5.52E-08 1 CPA4_E20_F CPA4 5.88E-08 0 IFNG_E293_F IFNG 6.93E-08 0 NO rs1883832 C/T: C allele=78%, T
allele=22% Yes
MPO_P883_R MPO 7.70E-08 0 DAB2IP_E18_R DAB2IP 8.24E-08 1 ADAMTS12_E52_R ADAMTS12 8.45E-08 1 ADCYAP1_P455_R ADCYAP1 8.63E-08 1 DLC1_P695_F DLC1 9.66E-08 0 PI3_P274_R PI3 1.08E-07 0 BDNF_P259_R BDNF 1.19E-07 1 NO rs4906901 A/C: freq unknown na S100A2_E36_R S100A2 1.21E-07 0 MME_E29_F MME 1.31E-07 1 FLT4_P180_R FLT4 1.34E-07 1 TUSC3_E29_R TUSC3 1.35E-07 1 TNFSF10_E53_F TNFSF10 1.39E-07 0 WNT8B_E487_F WNT8B 1.48E-07 0 SOX17_P303_F SOX17 1.55E-07 1 CSPG2_E38_F CSPG2 1.60E-07 1 SFRP1_E398_R SFRP1 1.82E-07 1
Appendices 129
MEG3_E91_F MEG3 1.92E-07 1 NO rs6498979 C/T: freq unknown na KDR_E79_F KDR 1.97E-07 1 NTSR1_P318_F NTSR1 1.99E-07 1 CTLA4_P1128_F CTLA4 2.02E-07 0 WT1_P853_F WT1 2.05E-07 1 NO rs34456313 ins/delG: freq unknown na ESR1_E298_R ESR1 2.07E-07 1 RIPK3_P124_F RIPK3 2.09E-07 0 HS3ST2_P546_F HS3ST2 2.20E-07 1 PENK_P447_R PENK 2.28E-07 1 FGF5_E16_F FGF5 2.46E-07 1 NO rs41416852 A/G: G allele=100%, A
allele=0% No
CD40_P372_R CD40 2.50E-07 1 NO rs10234713 A/G: A allele=99%, G allele=1%
Yes
SPI1_P929_F SPI1 2.55E-07 0 COL1A2_P48_R COL1A2 2.89E-07 1 NO rs3810773 A/G: freq unknown na DCC_P471_R DCC 2.98E-07 1 HOXA5_P1324_F HOXA5 3.05E-07 1 RBP1_E158_F RBP1 3.13E-07 1 NEFL_E23_R NEFL 3.13E-07 1 HBII-52_E142_F HBII-52 3.22E-07 0 NO rs433139 C/G: freq unknown na AGTR1_P154_F AGTR1 3.58E-07 1 MEG3_P235_F MEG3 3.64E-07 1 MME_P388_F MME 3.65E-07 1 CARD15_P665_F CARD15 3.79E-07 0 NO rs28736786; rs4292323 A/C: freq unknown na ER_seq_a1_S60_F ER 3.85E-07 1 EPHA5_P66_F EPHA5 4.14E-07 1 DES_E228_R DES 4.35E-07 1 IRAK3_P13_F IRAK3 4.71E-07 1 LMO1_E265_R LMO1 4.96E-07 1 NO rs28372675 C/T: C allele=67%, T
allele=33% Yes
PEG10_P978_R PEG10 5.02E-07 1 EMR3_E61_F EMR3 5.19E-07 0 WNT2_P217_F WNT2 5.25E-07 1 NO rs10706596 ins/delG: freq unknown na TBX1_P885_R TBX1 5.59E-07 1
Appendices 130
MMP7_E59_F MMP7 5.68E-07 0 VAMP8_P114_F VAMP8 6.19E-07 0 AGTR1_P41_F AGTR1 7.64E-07 1 DBC1_P351_R DBC1 7.76E-07 1 ALOX12_P223_R ALOX12 8.39E-07 1 PI3_P1394_R PI3 9.20E-07 0 MMP2_E21_R MMP2 9.40E-07 1 DCC_P177_F DCC 9.58E-07 1 OPCML_E219_R OPCML 9.64E-07 1 EMR3_P39_R EMR3 1.18E-06 0 FGF3_P171_R FGF3 1.19E-06 1 PI3_E107_F PI3 1.28E-06 0 NO rs11736206 G/T: G allele=100%, T
allele=0% No
VAMP8_P241_F VAMP8 1.33E-06 0 CSPG2_P82_R CSPG2 1.35E-06 1 CDH11_P354_R CDH11 1.50E-06 1 NO rs4995341;rs4995342;rs49
95343 A/G: freq unknown na
MYH11_P22_F MYH11 1.95E-06 1 NO rs9340771 C/T: T allele=99%, C allele=1%
No
CEACAM1_P44_R CEACAM1 1.96E-06 0 NO rs34178679 A/G: freq unknown na ALOX12_E85_R ALOX12 2.00E-06 1 FLT3_E326_R FLT3 2.12E-06 1 NRG1_E74_F NRG1 2.12E-06 1 ERN1_P809_R ERN1 2.13E-06 0 WT1_E32_F WT1 2.17E-06 1 CCNA1_P216_F CCNA1 2.21E-06 1 CCNA1_E7_F CCNA1 2.24E-06 1 LYN_P241_F LYN 2.25E-06 1 EPHA7_E6_F EPHA7 2.27E-06 1 YES ;rs45537841 A/G: G allele = 73%, A
allele=27% Yes
CD40_E58_R CD40 2.51E-06 1 NO rs45521832; rs11765572 A/G: A allele=14%, G allele=86%
Yes
CD34_E20_R CD34 2.56E-06 1 MOS_E60_R MOS 2.75E-06 1
Appendices 131
CSF1R_E26_F CSF1R 2.92E-06 0 FGFR1_P204_F FGFR1 3.31E-06 1 IRAK3_E130_F IRAK3 3.37E-06 1 ABCB4_P892_F ABCB4 3.53E-06 0 NO rs28383487 A/C: A allele=3%, C
allele=97% No
PDE1B_P263_R PDE1B 3.67E-06 1 CAPG_E228_F CAPG 3.85E-06 0 SEZ6L_P299_F SEZ6L 4.48E-06 1 AIM2_P624_F AIM2 4.50E-06 0 VAMP8_E7_F VAMP8 4.67E-06 0 IGF2AS_E4_F IGF2AS 4.86E-06 1 SEZ6L_P249_F SEZ6L 4.92E-06 1 CCL3_P543_R CCL3 5.12E-06 0 NO rs3806469 A/G: A allele =1%, G
allele =99% No
HPN_P374_R HPN 5.26E-06 1 PTPRH_P255_F PTPRH 5.36E-06 0 MMP9_E88_R MMP9 5.46E-06 0 NO rs45546040 C/T: freq unknown na HCK_P858_F HCK 5.51E-06 1 IGF2AS_P203_F IGF2AS 6.16E-06 1 TMEFF2_P210_R TMEFF2 6.35E-06 1 NO rs2069711 G/T: T allele=100%, G
allele=0% No
SRC_E100_R SRC 6.87E-06 0 COL1A2_E299_F COL1A2 7.14E-06 1 MEST_P62_R MEST 7.76E-06 0 TFPI2_E141_F TFPI2 7.85E-06 1 EPHA7_P205_R EPHA7 7.99E-06 1 TSP50_P137_F TSP50 8.78E-06 1 PGR_E183_R PGR 8.84E-06 0 HLA-DPB1_E2_R HLA-DPB1 9.08E-06 0 SRC_P164_F SRC 9.43E-06 0 SERPINB2_P939_F SERPINB2 9.90E-06 0 TCF4_P317_F TCF4 1.04E-05 1 HTR1B_P222_F HTR1B 1.08E-05 1 NO rs12324391;rs2009256 C/T: C allele=73%; T
allele=27% Yes
Appendices 132
SGCE_E149_F SGCE 1.11E-05 1 MYOD1_P50_F MYOD1 1.16E-05 1 EPO_E244_R EPO 1.26E-05 1 GALR1_E52_F GALR1 1.36E-05 1 GLI3_P453_R GLI3 1.37E-05 1 CHFR_P501_F CHFR 1.41E-05 1 NO rs41282752;rs17333103 A/G: freq unknown na GML_E144_F GML 1.45E-05 0 NO rs34311679 A/T: A allele=100%, T
allele=0% No
IRAK3_P185_F IRAK3 1.49E-05 1 CHGA_E52_F CHGA 1.61E-05 1 CYP1B1_E83_R CYP1B1 1.66E-05 1 SERPINE1_E189_R SERPINE1 1.77E-05 1 NO rs12362192 G/T: G allele=100%, A
allele=0% No
PRSS1_E45_R PRSS1 2.06E-05 0 CARD15_P302_R CARD15 2.15E-05 0 RBP1_P150_F RBP1 2.24E-05 1 CCKBR_P480_F CCKBR 2.26E-05 1 NO rs13309040 A/C: freq unknown na LMTK2_P1034_F LMTK2 2.29E-05 0 SPI1_E205_F SPI1 2.49E-05 0 FGF3_E198_R FGF3 2.55E-05 1 VIM_P343_R VIM 2.57E-05 1 EPHB6_E342_F EPHB6 2.81E-05 1 MST1R_P392_F MST1R 2.88E-05 0 DCC_E53_R DCC 2.88E-05 1 NO rs2522207 A/G: freq unknown na PALM2-AKAP2_P420_R
PALM2-AKAP2
2.88E-05 1 NO rs34475065 G/T: freq unknwon na
CDH11_E102_R CDH11 3.00E-05 1 CCR5_P630_R CCR5 3.07E-05 0 MEST_P4_F MEST 3.23E-05 0 NO rs12420823 C/T: freq unknown na GLI2_P295_F GLI2 3.28E-05 0 1Differential methylation of genes in tumour relative to normal colonic tissues, "1" and "0" denotes hypermethylation and hypomethylation respectively. 2Data obtained from Byun et al (Byun'09HMG), “na” denotes no available data.
Appendices 133
Supplementary Table 5.2 Known functions of 112 genes differentially methylated between CIMP-H and CIMP-L and their reported methylation in cancer and putative roles in gastrointestinal cancer.
Gene Mean �-value in CIMP-H
Mean �-value in CIMP-L
P-value (CIMP-L vs
CIMP-H)
Reported methylation in cancer Known function Involvement in GI cancers References
NTRK3 0.81 0.10 1.15E-21 no a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers
In the highly metastatic CT26 murine colon cancer cell line, which expresses endogenous TrkC, silencing TrkC expression by small interfering RNA significantly enhanced BMP-2-induced Smad1 phosphorylation and restored BMP-2 growth inhibitory activity, somatic mutations found in colon cancer
Cancer Res. 2007 Oct 15;67(20):9869-77, Science. 2003 May 9;300(5621):949
HS3ST2 0.46 0.07 4.57E-21 methylated in hematological, breast and cervical cancer, methylated in CRC
heparan sulfate biosynthetic enzyme family. It is a type II integral membrane protein and possesses heparan sulfate glucosaminyl 3-O-sulfotransferase activity. This gene is expressed predominantly in brain and may play a role in the nervous system
unknown J Histochem Cytochem. 2009 May;57(5):477-89, PLoS One. 2009 Sep 11;4(9):e6986, Gynecol Oncol. 2007 Dec;107(3):549-53, Nat Genet. 2007 Feb;39(2):232-6, Oncogene. 2003 Jan 16;22(2):274-80.
FLT3 0.80 0.08 1.61E-19 no class III receptor tyrosine kinase that regulates hematopoiesis, activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow
unknown na
TWIST1 0.70 0.18 2.76E-19 methylated in breast, bladder, gastric, lung, cervical,
Basic helix-loop-helix (bHLH) transcription factors have been implicated in cell lineage determination and differentiation
TWIST1 overexpression is associated with nodal invasion and male sex in primary colorectal cancer.
Eur Urol. 2009 Aug 5, Cancer Epidemiol Biomarkers Prev. 2008 Dec;17(12):3325-30, Lab Invest. 2008 Feb;88(2):161-70, Mol Cancer. 2007 Oct 29;6:70, Cancer Epidemiol Biomarkers Prev. 2007 Jun;16(6):1178-84, Ann Surg Oncol. 2009 Jan;16(1):78-87
Appendices 134
EPHA5 0.57 0.17 7.89E-19 methylated in breast Ca ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system
unknown Hum Pathol. 2009 Sep 4
NRG1 0.41 0.06 6.10E-18 no a signaling protein that mediates cell-cell interactions and plays critical roles in the growth and development of multiple organ systems
unknown na
SEZ6L 0.61 0.05 7.08E-18 methylated in Gastric Ca,
unknown unknown Lab Invest. 2008 Feb;88(2):161-70
AGTR1 0.66 0.09 1.03E-17 no Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system.
unknown na
CD40 0.66 0.31 1.02E-16 no TNF-receptor superfamily. This receptor has been found to be essential in mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation
CD40 is expressed in a proportion of established CRC lines in culture and that receptor expression is functional. Activation of CD40 by membrane-presented CD40L causes high levels of death in CD40-positive CRC cells and induces secretion of proinflammatory cytokines
Int J Cancer. 2007 Sep 15;121(6):1373-81
EYA4 0.50 0.18 2.41E-16 methylated in ulcerative-colitis-related dysplasia, Barrett's esophagus and esophageal adenocarcinoma, colon Ca
aberrant expression in the steady state level of EYA4 triggers distinct apoptotic mechanisms, implicating these genes as possible regulators of programmed cell death
Methylated in ulcerative colitis-associated dysplasia, CRC
Clin Gastroenterol Hepatol. 2006 Feb;4(2):212-8, Cancer Epidemiol Biomarkers Prev. 2005 Apr;14(4):830-4, Nucleic Acids Res. 2006 May 2;34(8):e59
NOS3 0.54 0.86 3.94E-16 no Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoural activities
eNOS-deficient mice had greater leukocyte infiltration, gut injury, and expressed higher levels of the mucosal addressin, MAdCAM-1. These results demonstrate that eNOS plays an important role in limiting injury to the intestine during experimental colitis and altered eNOS content and/or activity may contribute to human IBD. The number of NOS-3-immunoreactive vascular profiles increased in the lamina propria of UC colon, overexpression of NOS3 may correlate with tumor growth and vascular invasion
Free Radic Biol Med. 2003 Dec 15;35(12):1679-87, Scand J Gastroenterol. 2001 Feb;36(2):180-9, Virchows Arch. 2000 Feb;436(2):109-14,
EPHA7 0.56 0.18 6.99E-16 methylated in CRC, prostate, gastric Ca, lymphoma
ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the
hypermethylation of colorectal cancers was more frequent in male than in female (P=0.0078), and in moderately differentiated than in well-differentiated adenocarcinomas
Oncogene. 2005 Aug 25;24(36):5637-47, Int J Cancer. 2009 Jan 1;124(1):88-94, Hum Pathol. 2007 Nov;38(11):1649-
Appendices 135
nervous system (P=0.0361). There was a tendency that hypermethylation in rectal cancers was more frequent than in colon cancers (P=0.0816). Hypermethylation was also observed in colorectal adenomas
56, Oncogene. 2007 Jun 21;26(29):4243-52
CSPG2 0.73 0.13 1.16E-15 methylated in astrocytoma, hepatocellular carcinoma, dysplastic epithelium from high-grade dysplasia (HGD)/cancer patients with UC
a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance.
CSPG2 is directly transactivated by p53 BMC Cancer. 2004 Sep 14;4:65, Cell Res. 2003 Oct;13(5):319-33, Cancer Res. 2001 May 1;61(9):3573-7, Proc Natl Acad Sci U S A. 2002 Nov 26;99(24):15632-7
RASGRF1 0.73 0.16 1.48E-15 no a guanine nucleotide exchange factor that stimulates the dissociation of GDP from RAS protein
unknown na
NGFB 0.82 0.41 1.82E-15 no This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons
unknown na
RBP1 0.49 0.06 2.12E-15 methylated in esophageal SCC, B-cell lymphoma, intrahepatic cholangiocarcinoma, prostate Ca, gastric Ca, CRC
encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision
RBP1 is methylated in the aberrant crypt foci and tumour of CRC patients
Int J Cancer. 2005 Jul 10;115(5):747-51, Oncol Rep. 2009 Apr;21(4):1067-73, Leukemia. 2008 May;22(5):1035-43, Arch Pathol Lab Med. 2007 Jun;131(6):923-30, J Pathol. 2007 Feb;211(3):269-77, Cancer. 2005 Oct 15;104(8):1609-19
ALK 0.63 0.27 4.18E-15 no The 2;5 chromosomal translocation is frequently associated with anaplastic large cell lymphomas (ALCLs). The translocation creates a fusion gene consisting of the ALK (anaplastic lymphoma kinase) gene and the nucleophosmin (NPM) gene: ALK plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system
echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK) fusion gene is an oncogene in CRC
Mol Cancer Res. 2009 Sep;7(9):1466-76
MYH11 0.72 0.14 4.93E-15 no It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP.
mutated & differentially expressed in CRC of HNPCC patients, somatic protein-elongating frameshift mutations in 55% of CRCs displaying microsatellite instability and in the germ-line of one individual with PJS. All mutations resulted in unregulated molecules displaying constitutive motor activity. Unregulated MYH11 may affect the cellular
Br J Cancer. 2008 Nov 18;99(10):1726-8, Proc Natl Acad Sci U S A. 2008 Apr 8;105(14):5513-8, J Surg Res. 2008 Jan;144(1):29-35
Appendices 136
energy balance or disturb cell lineage decisions in tumour progenitor cells, downregulate in MSS-CRC
NPY 0.52 0.18 5.22E-15 no a neurotransmitter expressed in submucous and myenteric nerves
decrease in vasoconstrictor neurotransmitters NPY around submucosal arterioles of both early and advanced polyps, Gastrointestinal secretion, absorption, motility, cell proliferation, local immune defense and blood flow are all regulated by the neuroendocrine peptides, In 12-month-old mice, the concentrations of PYY, somatostatin, VIP, NPY, galanin and neurotensin decreased compared with those in 3-month-old mice
Colorectal Dis. 2006 Mar;8(3):230-4, Gerontology. 1999 Jan-Feb;45(1):17-22
LMO1 0.61 0.17 6.89E-15 no It is mapped to an area of consistent chromosomal translocation in chromosome 11, disrupting it in T-cell leukemia
unknown na
PEG10 0.69 0.22 7.40E-15 no the imprinted gene paternally expressed gene-10 (PEG10) has been reported to support proliferation in hepatocellular carcinomas
unknown na
GAS7 0.67 0.11 2.12E-14 no expressed primarily in terminally differentiated brain cells and predominantly in mature cerebellar Purkinje neurons. GAS7 plays a putative role in neuronal development
Expression downregulated in MSI+ CRC Mol Cancer. 2007 Aug 23;6:54
ADAMTS12 0.65 0.24 2.28E-14 methylated in cancer cell lines and CRC,
It may play roles in pulmonary cells during fetal development or in tumour processes through its proteolytic activity or as a molecule potentially involved in regulation of cell adhesion
Anti-tumour protease that can reduce the proliferative properties of tumour cells. This function is lost by epigenetic silencing in tumour cells, but concurrently induced in stromal cells, probably as part of a response of the normal tissue aimed at controlling the progression of cancer.
J Cell Sci. 2009 Aug 15;122(Pt 16):2906-13
PTPRH 0.64 0.91 2.44E-14 methylated in breast Ca a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation.
Overexpressed in CRC Mol Endocrinol. 2009 Feb;23(2):176-87; Biochem Biophys Res Commun. 1997 Feb 24;231(3):705-11
IRAK3 0.54 0.09 2.50E-14 no IRAK-M is a negative regulator of Toll-like receptor signalling , deletion of IRAK-M enhances host anti-tumour immune response
unknown Cell. 2002 Jul 26;110(2):191-202, Mol Immunol. 2007 Jul;44(14):3453-61.
CDH13 0.69 0.16 5.09E-14 methylated in CRC, endometrial, prostate, breast Ca
a calcium dependent cell-cell adhesion glycoprotein, a putative mediator of cell-cell interaction in the heart and may act as a negative regulator of neural cell growth
CDH13 expression is frequently silenced by aberrant methylation in colorectal cancers and adenomas and that methylation of CDH13 commences at an early stage of multistep colorectal tumourigenesis; specifically methylated in poorly differentiated CRC; methylated in CRC without lymph node
Cancer Res. 2002 Jun 15;62(12):3382-6; Br J Cancer. 2004 Mar 8;90(5):1030-3; Dis Colon Rectum. 2005 Jun;48(6):1282-6; Anticancer Res. 2006 Jan-Feb;26(1A):55-8
Appendices 137
metastasis
FGF3 0.27 0.02 1.15E-13 no possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumour growth and invasion. This gene was identified by its similarity with mouse fgf3/int-2, a proto-oncogene activated in virally induced mammary tumours in the mouse. Frequent amplification of this gene has been found in human tumours, which may be important for neoplastic transformation and tumour progression
FGF-3 is activated in tumours induced in nude mice by MYC-transfected cells from non-tumourigenic clones. However, in most of the cell lines established from these tumours, FGF-3 expression tends to be lost upon in vitro propagation, The FGF-3 gene is constitutively expressed in tumourigenic clones from the SW613-S human colon carcinoma cell line but is silent in non-tumourigenic clones, Int-2 was positively detected in only four tumours (i.e. 5% of the cases examined).
Oncogene. 1995 Jun 15;10(12):2331-42, J Biol Chem. 2000 Jun 9;275(23):17364-73, J Gastroenterol Hepatol. 2002 Oct;17(10):1084-6
ADCYAP1 0.60 0.17 1.35E-13 no adenylate cyclase activating polypeptide 1. Mediated by adenylate cyclase activating polypeptide 1 receptors, this polypeptide stimulates adenylate cyclase and subsequently increases the cAMP level in target cells. Adenylate cyclase activating polypeptide 1 is not only a hypophysiotropic hormone, but also functions as a neurotransmitter and neuromodulator. In addition, it plays a role in paracrine and autocrine regulation of certain types of cells
60% of the PACAP KO mice developed colorectal tumours with an aggressive-appearing pathology, PACAP is capable of increasing the number of viable cells and regulating Fas-R expression in a human colonic cancer cell line, suggesting that PACAP might play a role in the regulation of colon cancer growth and modulation of T lymphocyte anti-tumoural response via the Fas-R/Fas-L apoptotic pathway, Pituitary Adenylate-Cyclase Activating Polypeptide (PACAP), were expressed in 4 human colonic adenocarcinoma cell lines, HT29, SW403, DLD-1 and Caco-2, that spontaneously displayed variable phenotypic properties in culture
Int J Cancer. 2008 Apr 15;122(8):1803-9, Regul Pept. 2002 Nov 15;109(1-3):115-25, Cell Signal. 1998 Jan;10(1):13-26
SFRP1 0.52 0.14 1.45E-13 methylated in renal, breast, NSCLC, ovarian, esophageal, HCC, oral squamous cell carcinoma, CRC
a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. Members of this family act as soluble modulators of Wnt signaling; epigenetic silencing of SFRP genes leads to deregulated activation of the Wnt-pathway which is associated with cancer
methylated in CRC, associated with progression from inflammatory bowel disease (IBD) to IBD-related neoplasia, age-related methylation in normal colonic mucosa of CRC patients, 52% of syndromic hyperplastic polyps showed a reproducible and distinct staining pattern for secreted Frizzled receptor protein 1 that was not seen in control specimens and that was associated with larger polyp size and location in the proximal colon, the reduced activity or absence of sFRP1 allows the transduction of noncanonical Wnt signals, which contribute to tumour progression.
Cancer Res. 2004 Feb 1;64(3):883-8, Arch Pathol Lab Med. 2004 Sep;128(9):967-73, Br J Cancer. 2008 Jul 8;99(1):136-42, Hum Mol Genet. 2009 Apr 1;18(7):1332-42, Gynecol Oncol. 2009 Feb;112(2):301-6, Mol Cancer. 2008 Nov 6;7:83, Int J Cancer. 2009 Jan 15;124(2):387-93, Mol Cancer. 2008 Oct 2;7:75, Oncogene. 2007 Aug 16;26(38):5680-91, J Gastroenterol. 2008;43(5):378-89, Int J Oncol. 2008 Jun;32(6):1253-61, J Gastrointest Surg. 2008 Oct;12(10):1745-53
Appendices 138
VIM 0.46 0.11 3.00E-13 methylated in CRC a member of the intermediate filament family. Intermediate filamentents, along with microtubules and actin microfilaments, make up the cytoskeleton. The protein encoded by this gene is responsible for maintaining cell shape, integrity of the cytoplasm, and stabilizing cytoskeletal interactions. It is also involved in the immune response, and controls the transport of low-density lipoprotein (LDL)-derived cholesterol from a lysosome to the site of esterification. It functions as an organizer of a number of critical proteins involved in attachment, migration, and cell signaling
in HCT116 colon cancer cells treated with selenomethionine, VIM expression is increased
Clin Chem. 2006 Dec;52(12): Cancer Biol Ther. 2007 Apr;6(4):494-503
FLT4 0.62 0.22 3.29E-13 no a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium
VEGF-D is a mitogen for endothelial cells, VEGF-D is a ligand for VEGFR-3 (Flt4) and can activate these receptors
Proc Natl Acad Sci U S A. 1998 Jan 20;95(2):548-53
GALR1 0.43 0.11 3.80E-13 methylated in HNSCC GALR1 inhibits adenylyl cyclase via a G protein of the Gi/Go family. GALR1 is widely expressed in the brain and spinal cord, as well as in peripheral sites such as the small intestine and heart
Expressed at the highest level in the large intestine of mice
Clin Cancer Res. 2008 Dec 1;14(23):7604-13, Neuropeptides. 2005 Jun;39(3):349-52,
CDH11 0.45 0.05 4.50E-13 no a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion, Expression of this particular cadherin in osteoblastic cell lines, and its upregulation during differentiation, suggests a specific function in bone development and maintenance
Up-regulated in inflammatory bowel disease PLoS Med. 2005 Aug;2(8):e199
SRC 0.75 0.92 4.59E-13 no This proto-oncogene may play a role in the regulation of embryonic development and cell growth. The protein encoded by this gene is a tyrosine-protein kinase whose activity can be inhibited by phosphorylation by c-SRC kinase. Mutations in this gene could be involved in the malignant progression of colon cancer
dominant acting protooncogene in CRC, Induction of cyclooxygenase-2 overexpression in human gastric epithelial cells by Helicobacter pylori involves TLR2/TLR9 and c-Src-dependent nuclear factor-kappaB activation
Cancer. 1992 Sep 1;70(5 Suppl):1216-21, Mol Pharmacol. 2004 Dec;66(6):1465-77
MMP2 0.47 0.11 8.14E-13 methylated in CRC, lung, breast Ca,
This gene encodes an enzyme which degrades type IV collagen, the major structural component of basement membranes. The enzyme plays a role in endometrial menstrual breakdown, regulation of vascularization and the inflammatory response, MMP-2 protects against tissue damage and maintains gut barrier function
MMP2 activation may be required for tumour invasion in CRC
PLoS One. 2009 Sep 11;4(9):e7012, Am J Physiol Gastrointest Liver Physiol. 2009 Feb;296(2):G175-84, Mol Med. 2000 May;6(5):450-60
Appendices 139
WNT2 0.74 0.28 8.28E-13 no The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis
WNT2 is overexpressed in CRC & Barrett's esophagus, WNT2 abrogates Fz4 expression in some CRC cell lines
Oncogene. 2006 May 18;25(21):3084-92, Neoplasma. 2009;56(2):119-23
SCGB3A1 0.78 0.19 1.08E-12 methylated in nasopharyngeal, oral, esophageal, breast, lung, gastric, testicular germ cell, ovarian Ca and neuroblastoma, CRC
HIN-1 is a potent inhibitor of anchorage-dependent and anchorage-independent cell growth, cell migration, and invasion. Expression of HIN-1 in synchronized cells inhibits cell cycle reentry and the phosphorylation of the retinoblastoma protein (Rb), whereas in exponentially growing cells, HIN-1 induces apoptosis without apparent cell cycle arrest and effect on Rb phosphorylation
Methylated in CRC, correlate with MSI+, Mol Cancer. 2008 Dec 31;7:94, Clin Cancer Res. 2009 Jun 15;15(12):4174-80, Cancer Epidemiol Biomarkers Prev. 2009 Mar;18(3):901-14, Epigenetics. 2008 Nov;3(6):336-41, Lab Invest. 2008 Feb;88(2):161-70, APMIS. 2007 Oct;115(10):1147-60, Mol Cancer. 2007 Jul 10;6:45, Clin Cancer Res. 2007 Jun 1;13(11):3191-7, Cancer Res. 2005 Nov 1;65(21):9659-69
WT1 0.71 0.13 1.60E-12 methylated in CRC, cervical, ovarian, breast, astrocytoma, hypomethylated in renal cancer,
It has an essential role in the normal development of the urogenital system, and it is mutated in a small subset of patients with Wilm's tumours
Expression of WT1 in CRC is inconsistent in different studies - 1. WT1 is overexpressed in CRC, no mutation/deletion found. 2. The expression of WT1 gene, as revealed by in situ hybridization, showed no differences between normal colonic mucosa and malignant carcinoma. The transcriptional activity of WT1 proteins and their ability to function as tumour suppressors or oncogenes depends on the cellular status of p53.
Stem Cells. 2008 Jul;26(7):1808-17, Int J Cancer. 2008 Jul 1;123(1):161-7, Cancer. 2005 Nov 1;104(9):1924-30, World J Gastroenterol. 2004 Dec 1;10(23):3441-54, BMC Cancer. 2004 Sep 14;4:65, Br J Cancer. 1997;76(9):1124-30, Cancer Sci. 2003 Aug;94(8):712-7, J Biol Chem. 2003 Jan 31;278(5):3474-82, Br J Cancer. 1997;76(9):1124-30
TFPI2 0.35 0.07 1.60E-12 methylated in CRC, esophageal, gastric, melanoma, cervical, hepatocellular Ca
the expression of TFPI-2 diminishes with an increasing degree of malignancy, which may suggest a role for TFPI-2 in the maintenance of tumour stability and inhibition of the growth of neoplasms
TFPI2 methylation was detected in stool DNA from stage I to III CRC patients
Cancer Res. 2009 Jun 1;69(11):4691-9, Oncol Rep. 2009 Apr;21(4):1067-73, Clin Cancer Res. 2009 Mar 1;15(5):1801-7, Eur J Cancer. 2009 May;45(7):1282-93, Cancer Epidemiol Biomarkers Prev. 2006 Jan;15(1):114-23, Hepatology. 2007 May;45(5):1129-38, Thromb Haemost. 2003 Jul;90(1):140-6
IGFBP3 0.69 0.30 1.87E-12 methylated in hepatocellular, prostate, renal, gastric, colorectal Ca
a member of the insulin-like growth factor binding protein (IGFBP) family, circulates in the plasma, prolonging the half-life of IGFs and altering their interaction with cell surface
Methylated in CIMP-low CRC at low level, IGFBP3 methylation is inversely associated with MSI in CIMP-high colorectal cancers, and this relationship is limited to p53-negative
Neoplasia. 2007 Dec;9(12):1091-8, Cancer Sci. 2006 Jan;97(1):64-71, Mod Pathol. 2008 Mar;21(3):245-55, J Clin Invest.
Appendices 140
receptors. induced by wild-type p53, regulates IGF and interacts with the TGF-beta pathway
tumours 2007 Sep;117(9):2713-22, Br J Cancer. 2007 May 21;96(10):1587-94, Cancer Res. 2006 May 15;66(10):5021-8,
GLI3 0.51 0.15 1.90E-12 no DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling
expression of wild-type SMO is required for expression of GLI3 by a mechanism that is independent of conventional Hedgehog signalling, the repressive form of Gli3, characteristic of an inactive pathway, was detected in SW480 and Colo320 cells,
Cancer Lett. 2004 Apr 30;207(2):205-14, Int J Cancer. 2007 Dec 15;121(12):2622-7
CCKBR 0.58 0.08 1.91E-12 no a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract.
CCKBR was present in 96% of polyps. Expression of gastrin and CCKBR was seen in all histological types and sizes of polyps. Activation of cholecystokinin-2 receptor (CCK2R) by gastrin stimulates a rapid activation of focal adhesion kinase (FAK) pathway in human colon cancer cells. CCK2R regulating invasion and motility of colon cancer cells, and support a role of CCK2R in the progression of colon cancer. FAK play a critical role in this CCK2R-mediated effect
Gut. 2000 Dec;47(6):820-4, Int J Cancer. 2006 Dec 15;119(12):2724-32
TBX1 0.77 0.24 2.12E-12 no regulation of developmental processes unknown na
MME 0.65 0.11 2.55E-12 no a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL, It is a glycoprotein that is particularly abundant in kidney.
CD10 expression is an integral part of colorectal carcinogenesis and seems to contribute to the invasion and thus probably facilitates metastasis, CD10 expression was detected in more than half of the cases of non-polypoid growth colorectal neoplasms
Hum Pathol. 2002 Aug;33(8):806-11, Histopathology. 2008 Apr;52(5):569-77
DBC1 0.71 0.25 3.23E-12 methylated in hematological malignancies, non-small cell lung cancer, oral squamous cell carcinoma, bladder cancer
unknown lost in many cancer cell lines and promotes TP53-mediated apoptosis through specific inhibition of SIRT1
PLoS One. 2009 Sep 11;4(9):e6986, Mod Pathol. 2008 May;21(5):632-8, Hum Mol Genet. 2005 Apr 15;14(8):997-1007, Br J Cancer. 2004 Aug 16;91(4):760-4, Oncogene. 2001 Jan 25;20(4):531-7, Genes Chromosomes Cancer. 2009 Aug 11;48(11):953-962
DES 0.42 0.25 3.80E-12 no a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane
DES and ENO1 act as the central elements in colon cancer susceptibility, and protein biosynthesis and the ribosome-associated function categories largely account for the colon cancer tumuorigenesis
BMC Syst Biol. 2008 Aug 10;2:72
SLIT2 0.78 0.29 4.10E-12 methylated in leukemia, breast, liver, lung,
a group of secreted glycoproteins that play a role in the regulation of cell migration
SLIT2 axon guidance molecule is frequently inactivated in colorectal cancer and suppresses
Neoplasia. 2008 Dec;10(12):1411-20, Cancer Res.
Appendices 141
cervical, renal Ca, glioma, CRC
growth of colorectal carcinoma cells. 2003 Mar 1;63(5):1054-8, Epigenetics. 2009 May;4(4):265-9, J Histochem Cytochem. 2009 May;57(5):477-89, Biochem Biophys Res Commun. 2009 Jan 30;379(1):86-91, Br J Cancer. 2004 Dec 13;91(12):2071-8, Oncogene. 2003 Jul 17;22(29):4611-6., Int J Cancer. 2003 Jan 20;103(3):306-15,
PDE1B 0.60 0.12 5.69E-12 no PDE1B2 regulates cGMP and a subset of the phenotypic characteristics acquired upon macrophage differentiation from a monocyte, likely to regulate cGMP in macrophages
unknown Proc Natl Acad Sci U S A. 2005 Jan 11;102(2):497-502, Proc Natl Acad Sci U S A. 2006 Jan 10;103(2):460-5
GABRB3 0.88 0.62 1.01E-11 no receptor for gamma-aminobutyric acid, the major inhibitory transmitter of the nervous system. This gene is located on the long arm of chromosome 15 in a cluster with two genes encoding related subunits of the family. Mutations in this gene may be associated with the pathogenesis of Angelman syndrome, Prader-Willi syndrome, and autism
unknown na
TMEFF2 0.75 0.19 1.62E-11 methylated in cholangiocarcinoma, gastric, esophageal, lung Ca, CRC
TMEFF2 contributes to cell proliferation in an ADAM17-dependent autocrine fashion in cells expressing this protein
HPP1 demonstrates tumour suppressive and pro-apoptotic activity, both in vitro and in vivo, activation of the STAT1 pathway likely represents the principal mediator of HPP1's tumour suppressive properties; frequent TPEF methylation in primary colorectal cancers and liver metastases, indicating that epigenetic alterations are not only present in the early phases of carcinogenesis, but are also common in metastatic lesions; methylation of HPP1 is a relatively common early event in UC-associated carcinogenesis;
J Biol Chem. 2007 Dec 28;282(52):37378-88, Virchows Arch. 2009 Sep 10, Mol Cancer. 2008 Oct 2;7:75, Dig Liver Dis. 2008 Dec;40(12):920-6, Lung Cancer. 2009 May;64(2):155-9, Clin Chem. 2008 Feb;54(2):414-23, Int J Cancer. 2006 Sep 15;119(6):1298-302, Neoplasia. 2005 Aug;7(8):771-8, Gastroenterology. 2005 Jul;129(1):74-85, Proc Natl Acad Sci U S A. 2001 Jan 2;98(1):265-70, Int J Cancer. 2008 Apr 1;122(7):1567-72, Cancer Res. 2002 Dec 1;62(23):6820-2
KDR 0.77 0.26 1.63E-11 methylated in stomach cancer, colon cancer and hepatocellular carcinoma
a type III receptor tyrosine kinase, VEGF receptor, mediates VEGF-induced endothelial proliferation, survival, migration, tubular morphogenesis and sprouting.
Expression of VEGF and KDR was higher in metastatic than in nonmetastatic neoplasms and directly correlated with the extent of neovascularization and the degree of proliferation
Epigenetics. 2009 Jul;4(5):313-21, Cancer Res. 1995 Sep 15;55(18):3964-8
FLI1 0.82 0.22 1.82E-11 no unknown presence of EWS-FLI1 chimeric mRNA in tumour arising in the mesentery helps distinguish pPNET fm other tumours
J Gastroenterol. 2002;37(7):543-9, Surg Today. 2006;36(2):193-7
Appendices 142
(Peripheral primitive neuroectodermal tumours (pPNETs - usually found in the soft tissue of the extremities, paravertebral region).
SPI1 0.62 0.77 3.49E-11 methylated in diffuse large B-cell lymphoma
an ETS-domain transcription factor that activates gene expression during myeloid and B-lymphoid cell development
unknown Int J Biochem Cell Biol. 2007;39(7-8):1523-38
WNT8B 0.74 0.93 5.28E-11 no Secreted signaling protein implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis, The expression patterns of the human and mouse genes appear identical and are restricted to the developing brain
unknown na
PALM2-AKAP2
0.59 0.17 6.39E-11 no a naturally occurring co-transcribed product of the neighboring PALM2 and AKAP2 genes. The significance of this co-transcribed mRNA and the function of its protein product have not yet been determined
unknown na
CHGA 0.67 0.19 9.34E-11 no a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. It is found in secretory vesicles of neurons and endocrine cells. This gene product is a precursor to three biologically active peptides; vasostatin, pancreastatin, and parastatin. These peptides act as autocrine or paracrine negative modulators of the neuroendocrine system
chromogranin A expression in some colon carcinomas suggests that a previously unrecognized subgroup of these tumours has neuroendocrine features, NE cell component, either diffusely scattered or occasional, occurs in about 15% of gastric and colorectal tumours; (2) there is no correlation between the presence of CgA-positive neuroendocrine (NE) cells and degree of tumour differentiation, Elevated serum chromogranin A is detectable in patients with carcinomas at advanced disease stages, CGA overexpression could reflect a more aggressive tumour
J Clin Invest. 1988 Aug;82(2):686-90, Int J Cancer. 1992 May 8;51(2):189-94, Ann Clin Lab Sci. 2000 Apr;30(2):175-8, Anticancer Res. 2002 Jan-Feb;22(1A):395-8, Hepatogastroenterology. 2005 May-Jun;52(63):731-41
SGCE 0.28 0.09 1.09E-10 no Sarcoglycans are transmembrane components in the dystrophin-glycoprotein complex which help stabilize the muscle fiber membranes and link the muscle cytoskeleton to the extracellular matrix.
unknown na
COL1A2 0.52 0.26 1.44E-10 methylated in melanoma, bladder Ca, medulloblastoma, hepatoma
Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon
Pro-inflammatory gene COL1A2 was at the active/chronic inflammatory stages in a mouse model of chronic colitis, & in murine model of chronic inflammation-induced intestinal fibrosis
Genome Res. 2009 Aug;19(8):1462-70, Int J Oncol. 2009 Jun;34(6):1593-602, Neuro Oncol. 2008 Dec;10(6):981-94, Eur J Cancer. 2005 May;41(8):1185-94, J Immunol. 2007 Nov 15;179(10):6988-7000, Gastroenterology. 2003 Dec;125(6):1750-61
TCF4 0.81 0.32 2.08E-10 methylated in Gastric The encoded protein recognizes an Ephrussi- Frameshift mutation found in 46% of MSI+ Neoplasia. 2005 Feb;7(2):99-108;
Appendices 143
Ca box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is expressed predominantly in pre-B-cells, although it is found in other tissues as well
CRC, rs6983267 on 8q24 affects a binding site for the Wnt-regulated transcription factor TCF4, c-jun is a direct target of the TCF4/beta-catenin complex, the control of tcf4 expression by JNK/c-Jun leads to a positive feedback loop that connects JNK and Wnt signalling, beta-catenin/TCF4 regulates cell cycle promoting (c-MYC, CYCLIN D(1)) and inhibiting genes (p16(INK4A)) at the same time in the mesenchymally differentiated tumour cells at the front of invasion, expression of a Paneth gene programme is critically dependent on TCF4 in embryonic intestine; In colorectal cancer, mutations in Wnt cascade genes such as APC lead to the inappropriate formation of beta-catenin/Tcf4 complexes; disruption of beta-catenin/TCF4 activity in CRC cells by the overexpression of dominant-negative TCF induces rapid G1 arrest and differentiation
Carcinogenesis. 2008 Aug;29(8):1623-31, Nat Genet. 2009 Aug;41(8):885-90, EMBO J. 2009 Jul 8;28(13):1843-54, Gastroenterology. 2009 Jan;136(1):196-205.e2, Oncogene. 2006 Dec 4;25(57):7531-7, Nat Cell Biol. 2005 Apr;7(4):381-6, Cancer Cell. 2004 Jan;5(1):5-6, EMBO Rep. 2003 Jun;4(6):609-15,
DCC 0.76 0.32 2.12E-10 methylated in CRC, esophageal squamous cell carcinoma, head & neck SCC, hematological malignancies,
unknown methylated in CRC with repressive histone marks, Decreased expression of DCC may be caused by LOH or hypermethylation
Carcinogenesis. 2009 Jun;30(6):1041-8, Int J Cancer. 2008 Jun 1;122(11), Gastroenterology. 2007 Dec;133(6):1849-57, Cancer Res. 2006 Oct 1;66(19):9401-7, J Nippon Med Sch. 2005 Oct;72(5):270-7,
KRT1 0.72 0.88 2.75E-10 no The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma
carcinogen 4-nitroquinoline 1-oxide (4-NQO) changed the expression patterns of the intermediate filament proteins K1 in the oral cavity of carcinogen-treated mice thus may play a role in esophageal carcinogenesis
Clin Cancer Res. 2004 Jan 1;10(1 Pt 1):301-13
MYOD1 0.75 0.29 2.92E-10 methylated in CRC, leukemia, breast, bladder, astrocytoma, cervical, liver, glioma (hypo), lung, prostate, esophageal, rhabdomyosarcoma, ovarian
regulates muscle cell differentiation by inducing cell cycle arrest, a prerequisite for myogenic initiation. The protein is also involved in muscle regeneration. It activates its own transcription which may stabilize commitment to myogenesis
The methylation of MYOD1 in the normal mucosa was significantly correlated with K-ras mutation in neoplastic tissue; Normal mucosa was more highly methylated in the distal than in the proximal colon in MYOD1; Significantly increased levels of Myf-3 methylation were observed in tumours which were more invasive, located in the proximal colon or from older patients, Patients without
Hum Pathol. 2009 Sep 4, Clin Biochem. 2008 Dec;41(18):1440-8, Int J Cancer. 1999 Apr 20;84(2):109-13, Int J Mol Med. 2004 Mar;13(3):413-7, PLoS One. 2009 Sep 11;4(9):e6986, Leukemia. 2008 May;22(5):1035-43, Clin Cancer Res. 2007 Dec 15;13(24):7296-
Appendices 144
MYOD1 hypermethylation showed significantly longer survival than those with hypermethylation (p=0.0077).
304, BMC Cancer. 2004 Sep 14;4:65, Clin Cancer Res. 2004 Jan 15;10(2):565-71, Int J Cancer. 2003 Aug 10;106(1):52-9., Cancer Epidemiol Biomarkers Prev. 2002 Mar;11(3):291-7, J Natl Cancer Inst. 2001 Nov 21;93(22):1747-52, Cancer Res. 2001 Apr 15;61(8):3410-8, Am J Pathol. 1998 Apr;152(4):1071-9, Br J Cancer. 1997;75(3):396-402
THY1 0.68 0.34 4.57E-10 methylated in nasopharyngeal Ca
the function of 'adhesion molecules' in particular of Thy-1, may not only be to provide mechanical support but also regulate neutrophil functions such as extravasation and recruitment of additional neutrophils
Up-regulation of THY1 and PHLAD1 was associated with the presence of anemia in colon cancer patients
Eur J Immunol. 2008 May;38(5):1391-403, Cancer Epidemiol Biomarkers Prev. 2005 Feb;14(2):437-43, Oncogene. 2005 Sep 29;24(43):6525-32
SOX17 0.83 0.35 5.08E-10 methylated in breast Ca & CRC
a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate
Sox17 plays a tumour suppressor role through suppression of Wnt signaling. However, Sox17 is induced by Wnt activation in the early stage of gastrointestinal tumourigenesis, and Sox17 is down-regulated by methylation during malignant progression. It is therefore conceivable that Sox17 protects benign tumours from malignant progression at an early stage of tumourigenesis, and down-regulation of Sox17 contributes to malignant progression through promotion of Wnt activity; SOX17 is a negative modulator of canonical Wnt signaling, and that SOX17 silencing due to promoter hypermethylation is an early event during tumourigenesis and may contribute to aberrant activation of Wnt signaling in CRC, SOX17 expression is upregulated in the inflamed mucosa of inflammatory bowel disease pts. Sox17 is antagonistic to WNT signalling, Sox17 promotes the degradation of both beta-catenin and TCF proteins via a noncanonical, glycogen synthase kinase 3beta-independent mechanism,
Gastroenterology. 2009 Jun 21, Breast Cancer Res Treat. 2009 Mar 20, Cancer Res. 2008 Apr 15;68(8):2764-72, Dig Dis Sci. 2008 Apr;53(4):1013-9; Mol Cell Biol. 2007 Nov;27(22):7802-15
FGF5 0.75 0.19 6.87E-10 no involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumour growth and invasion. This gene was identified as an oncogene, which confers transforming potential when transfected into mammalian
unknown na
Appendices 145
cells. Targeted disruption of the homolog of this gene in mouse resulted in the phenotype of abnormally long hair, which suggested a function as an inhibitor of hair elongation.
PRSS1 0.45 0.67 8.47E-10 no encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is secreted by the pancreas and cleaved to its active form in the small intestine. It is active on peptide linkages involving the carboxyl group of lysine or arginine. Mutations in this gene are associated with hereditary pancreatitis
unknown na
CCNA1 0.71 0.25 8.90E-10 methylated in colon, lung, breast, prostate
The cyclin encoded by this gene is expressed in testis and brain, & several leukemic cell lines - primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins
unknown PLoS Med. 2006 Dec;3(12):e486
TPEF 0.75 0.31 1.00E-09 methylated in cholangiocarcinoma, gastric, esophageal, lung Ca, CRC
TMEFF2 contributes to cell proliferation in an ADAM17-dependent autocrine fashion in cells expressing this protein
HPP1 demonstrates tumour suppressive and pro-apoptotic activity, both in vitro and in vivo, activation of the STAT1 pathway likely represents the principal mediator of HPP1's tumour suppressive properties; frequent TPEF methylation in primary colorectal cancers and liver metastases, indicating that epigenetic alterations are not only present in the early phases of carcinogenesis, but are also common in metastatic lesions; methylation of HPP1 is a relatively common early event in UC-associated carcinogenesis;
J Biol Chem. 2007 Dec 28;282(52):37378-88, Virchows Arch. 2009 Sep 10, Mol Cancer. 2008 Oct 2;7:75, Dig Liver Dis. 2008 Dec;40(12):920-6, Lung Cancer. 2009 May;64(2):155-9, Clin Chem. 2008 Feb;54(2):414-23, Int J Cancer. 2006 Sep 15;119(6):1298-302, Neoplasia. 2005 Aug;7(8):771-8, Gastroenterology. 2005 Jul;129(1):74-85, Proc Natl Acad Sci U S A. 2001 Jan 2;98(1):265-70, Int J Cancer. 2008 Apr 1;122(7):1567-72, Cancer Res. 2002 Dec 1;62(23):6820-2
CYP1B1 0.69 0.12 1.22E-09 methylated in CRC, gastric, melanoma, breast Ca, hypomethylated in prostate Ca
The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids
The increase in expression of CYP1B1 occurred not only in colorectal carcinoma and but also in adenoma, Levels of CYP1B1 mRNA were elevated in the bronchial mucosa of human tobacco smokers versus never smokers; Cytochrome P450 1B1 (CYP1B1) is
Int J Oncol. 2009 Apr;34(4):1085-91, Lab Invest. 2008 Feb;88(2):161-70, Cancer Res. 2006 Dec 1;66(23):11187-93, Clin Cancer Res. 2005 Aug 15;11(16), Cancer Res. 2004 Jun
Appendices 146
overexpressed in human colon adenocarcinomas relative to normal colon, CYP1B1 is constitutively expressed in most human tissues, including colon and breast, and can activate numerous chemically diverse carcinogens - the formation of N2-OH-PhIP, a potent mutagen implicated in the etiology of human colon and breast cancer, indicates that CYP1B1 may play an important role in PhIP-mediated carcinogenesis,
1;64(11):3807-13, Cancer Detect Prev. 2005;29(6):562-9, Carcinogenesis. 2004 Nov;25(11):2275-81, Mol Cancer Ther. 2003 Jun;2(6):527-34, Carcinogenesis. 1997 Sep;18(9):1793-8
ER 0.60 0.27 1.31E-09 methylated in CRC, breast, prostate, gastric, lung Ca, acute myeloid leukemia,
estrogen receptor, a ligand-activated transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription
The methylation status of the ER promoter in lymph nodes of UICC stage I and II CRC patients may be a useful marker for the identification of patients at a high risk for local recurrence, Methylation of estrogen receptor 1 in colorectal adenomas is not age-dependent, but is correlated with K-ras mutation; Serum vitamin B-12 but not folate status may be associated with ERalpha promoter methylation in normal-appearing colorectal mucosa; the 'all or none' mechanism for methylation of this gene, and shows how age-dependent methylation of the ESR1 CGI leads rapidly to silencing of the gene within the cells, and hence the colonic crypt within which it occurs. Preliminary studies with a rodent model suggest the rate of age-dependent methylation of ESR1 is modifiable by dietary folate.
Br J Cancer. 2009 Jan 27;100(2):360-5, Cancer Sci. 2009 Jun;100(6):1005-11, Oncol Rep. 2008 Nov;20(5):1137-42, Leuk Lymphoma. 2008 Jun;49(6):1132-41, Int J Surg Pathol. 2007 Jul;15(3):242-51, Biochem Soc Trans. 2005 Aug;33(Pt 4):709-11
DAB2IP 0.57 0.23 1.39E-09 methylated in endometrial, liver, bladder, prostate, colorectal, lung, breast Ca
a Ras GTPase-activating protein (GAP) that acts as a tumour suppressor gene and is inactivated by methylation in prostate and breast cancers
methylation in the m2b region of DAB2IP promoter was associated with location of the tumour in the stomach. In summary, our results demonstrated that hDAB2IP methylation is frequently present in gastrointestinal tumours and that the resulting gene silencing plays an important role in gastrointestinal carcinogenesis.
Int J Cancer. 2008 Jul 15;123(2):296-302, J Hepatol. 2007 Apr;46(4):655-63, Int J Mol Med. 2006 Jan;17(1):3-13, J Biol Chem. 2005 Jun 10;280(23), Br J Cancer. 2005 Mar 28;92(6):1117-25, Int J Cancer. 2005 Jan 1;113(1):59-66, Clin Cancer Res. 2004 Mar 15;10(6):2082-9
MMP9 0.72 0.96 1.88E-09 methylated in MLL rearrangement leukaemia
degrades type IV and V collagens, a role in tumour-associated tissue remodeling
Upregulated in inflammatory bowel disease, Matrix metalloproteinase-9-mediated tissue injury overrides the protective effect of matrix metalloproteinase-2 during colitis, protein expression is upregulated in primary CRC than normal adjacent tissues, and was characteristic of colorectal cancer with high invasive metastatic potential, significantly higher expression of MMP-9 in adenoma with high grade dysplasia-colorectal cancer sequence as
Cancer Res. 2009 Feb 1;69(3):1109-16, Am J Physiol Gastrointest Liver Physiol. 2009 Feb;296(2):G175-84, Mol Med. 2000 May;6(5):450-60, Bull Exp Biol Med. 2008 Nov;146(5):616-9, Pathol Oncol Res. 2008 Mar;14(1):31-7, Oncol Rep. 2008 May;19(5):1285-91, Bull Exp Biol Med. 2007 Apr;143(4):455-
Appendices 147
compared to normal tissue; over-expression of MMP-9 strongly suggests its association with colorectal carcinogenesis; in CRC MMP-9 expression correlates with venous invasion; increased expression of MMP9 was associated significantly with low histological differentiation of the tumour, deeper tumour invasion, and was more often observed in tumours of colorectal cancer patients with unfavorable prognosis. Increased levels of MMP9 in serum predicts CRC in symptomatic patients, 1562C>T polymorphism may increase the risk of lymphatic metastasis of colorectal cancer.
8, Hum Pathol. 2007 Nov;38(11):1603-10, Br J Cancer. 2007 Oct 8;97(7):971-7, World J Gastroenterol. 2007 Sep 14;13(34):4626-9
ESR1 0.67 0.28 2.52E-09 methylated in CRC, breast, prostate, gastric, lung Ca, acute myeloid leukemia,
estrogen receptor, a ligand-activated transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription
The methylation status of the ER promoter in lymph nodes of UICC stage I and II CRC patients may be a useful marker for the identification of patients at a high risk for local recurrence, Methylation of estrogen receptor 1 in colorectal adenomas is not age-dependent, but is correlated with K-ras mutation; Serum vitamin B-12 but not folate status may be associated with ERalpha promoter methylation in normal-appearing colorectal mucosa; the 'all or none' mechanism for methylation of this gene, and shows how age-dependent methylation of the ESR1 CGI leads rapidly to silencing of the gene within the cells, and hence the colonic crypt within which it occurs. Preliminary studies with a rodent model suggest the rate of age-dependent methylation of ESR1 is modifiable by dietary folate.
Br J Cancer. 2009 Jan 27;100(2):360-5, Cancer Sci. 2009 Jun;100(6):1005-11, Oncol Rep. 2008 Nov;20(5):1137-42, Leuk Lymphoma. 2008 Jun;49(6):1132-41, Int J Surg Pathol. 2007 Jul;15(3):242-51, Biochem Soc Trans. 2005 Aug;33(Pt 4):709-11
TUSC3 0.71 0.22 2.71E-09 no a candidate tumour suppressor gene. It is located within a homozygously deleted region of a metastatic prostate cancer. The gene is expressed in most nonlymphoid human tissues including prostate, lung, liver, and colon. Expression was also detected in many epithelial tumour cell lines.
unknown na
EPO 0.52 0.08 5.51E-09 methylated in astrocytoma
encodes a secreted, glycosylated cytokine, The protein is found in the plasma and regulates red cell production by promoting erythroid differentiation and initiating hemoglobin synthesis. This protein also has neuroprotective activity against a variety of potential brain injuries and antiapoptotic functions in several tissue types
unknown BMC Cancer. 2004 Sep 14;4:65
Appendices 148
NEFL 0.84 0.34 5.75E-09 no maintain the neuronal caliber. They may also play a role in intracellular transport to axons and dendrites.
unknown na
VAMP8 0.47 0.80 9.75E-09 no The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. It is associated with the perinuclear vesicular structures of the early endocytic compartment.
unknown na
OPCML 0.77 0.29 2.24E-08 methylated in nasopharyngeal, esophageal, lung, gastric, colon, liver, breast, cervix, prostate), lymphoma cell lines (non-Hodgkin and Hodgkin lymphoma, nasal NK/T-cell lymphoma), neuroblastoma, ovarian,
a member of the IgLON subfamily in the immunoglobulin protein superfamily. The encoded protein is localized in the plasma membrane and may have an accessory role in opioid receptor function
unknown PLoS One. 2008 Aug 20;3(8):e2990, Mol Cancer. 2008 Jul 10;7:62, Cancer Invest. 2008 Jul;26(6):569-74, Endocr Relat Cancer. 2008 Sep;15(3):777-86, Eur J Gynaecol Oncol. 2007;28(6):464-7, Mol Cancer. 2007 Oct 29;6:70, Nat Genet. 2003 Jul;34(3):337-43
EMR3 0.68 0.91 2.43E-08 no encodes a member of the class B seven-span transmembrane (TM7) receptor family expressed predominantly by cells of the immune system, This protein may play a role in myeloid-myeloid interactions during immune and inflammatory responses
unknown na
CTLA4 0.76 0.85 2.53E-08 no a member of the immunoglobulin superfamily and encodes a protein which transmits an inhibitory signal to T cells
unknown na
GSTM2 0.70 0.24 4.93E-08 methylated in Barrett's adenocarcinoma
detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione
butyrate, an important luminal component produced from fermentation of dietary fibers, is an efficient inducer of GSTs and especially of GSTM2, to activate defence against oxidative stress in human colon cells
Carcinogenesis. 2005 Jun;26(6):1064-76, Carcinogenesis. 2003 Oct;24(10):1637-44
PGR 0.52 0.79 5.22E-08 methylated in melanoma, leukemia, liver, ovarian, colorectal, prostate, beast, cervical Ca
a member of the steroid receptor superfamily. The encoded protein mediates the physiological effects of progesterone, which plays a central role in reproductive events associated with the establishment and maintenance of pregnancy
Methylated at a very low frequency in colorectal adenoma, Overexpression of progesterone receptor B increases sensitivity of human colon muscle cells to progesterone
Melanoma Res. 2009 Jun;19(3):146-55, Blood. 2008 Aug 15;112(4):1366-73, Hepatol Res. 2007 Nov;37(11):974-83, Oncogene. 2006 Apr 27;25(18):2636-45, Cancer Res. 2006 Jan 1;66(1):29-33, Methods Inf Med. 2005;44(4):516-9, Neoplasia. 2005 Aug;7(8):748-60, Cancer Res. 2004 Jun 1;64(11):3807-13, Cancer Epidemiol Biomarkers Prev. 2005 May;14(5):1219-23, Am J
Appendices 149
Physiol Gastrointest Liver Physiol. 2008 Sep;295(3):G493-502
FGFR1 0.57 0.24 6.16E-08 hypomethylated in rhabdomyosarcoma,
binds both acidic and basic fibroblast growth factors and is involved in limb induction
Hirschsprung's disease (HD) is characterised by the absence of ganglion cells and the presence of hypertrophic nerve trunks in the distal bowel - lack of FGFRI expression in neuronal tissue of both ganglionic and aganglionic bowel; mRNA for FGF receptors 1 and 2 were expressed in both the adenoma and carcinoma cells whereas immunocytochemistry showed that the expression of the FGF R1 was reduced significantly in the carcinoma cells
Genes Chromosomes Cancer. 2007 Nov;46(11):1028-38, Pediatr Surg Int. 2001 May;17(4):299-303, Int J Cancer. 1999 Jul 19;82(2):298-304
PENK 0.74 0.38 7.81E-08 no Enkephalins and other peptide products from the precursor protein proenkephalin (PENK) act as neurotransmitters, autocrine and paracrine factors, and hormones that modulate pain, behavior, cardiac function, organogenesis, and immunity
unknown Peptides. 2008 Jan;29(1):83-92
NTSR1 0.73 0.25 1.05E-07 methylated in pancreatic Ca
mediates the multiple functions of neurotensin, such as hypotension, hyperglycemia, hypothermia, antinociception, and regulation of intestinal motility and secretion
increased NTSR1 expression may be an early event during colonic tumourigenesis and also contribute to tumour progression and aggressive behavior in colonic adenocarcinomas.
Oncogene. 2004 Nov 11;23(53):8705-10, Peptides. 2008 Sep;29(9):1609-15.
HTR1B 0.64 0.20 1.28E-07 methylated in lung Ca The neurotransmitter serotonin (5-hydroxytryptamine; 5-HT) exerts a wide variety of physiologic functions through a multiplicity of receptors and may be involved in human neuropsychiatric disorders such as anxiety, depression, or migraine.
unknown Oncogene. 2001 Nov 8;20(51):7505-13
CHFR 0.68 0.17 1.41E-07 methylated in gastric, liver, nasopharyngeal Ca, leukemia, colon Ca
activate cell cycle checkpoint when cells are treated with microtubule depolymerizing agents. Furthermore, CHFR was reported to have E3 ligase activity and promote ubiquitination and degradation of oncogenic proteins such as Aurora A and polo-like kinase 1. the FHA domain of CHFR plays an important role in initiating a cell cycle arrest at G2/M, indicating a functional link exists between the anti-proliferative effects and checkpoint function of this tumour suppressor protein via this domain
polymorphisms in the CHFR gene are associated with colorectal cancer susceptibility; promoter methylation of CHFR, as well as a high methylation index (MI), was positively related to chromosomal gain at 8q23-qter, in early colorectal cancer the CHFR gene was more frequently methylated than in advanced cases; CHFR promoter hypermethylation in colon cancer correlates with the microsatellite instability phenotype, Methylation was associated with loss of Chfr mRNA and protein expression in cancer cell lines; CpG methylation and thus silencing of CHFR depended on the activities of two DNA methyltransferases, DNMT1 and DNMT3b, as
Cancer Res. 2008 Jun 15;68(12):4597-605, PLoS One. 2008 Mar 12;3(3):e1776, Cancer Lett. 2008 Feb 18;260(1-2):170-9, Carcinogenesis. 2008 Feb;29(2):434-9, Mod Pathol. 2008 Mar;21(3):245-55, Anticancer Res. 2006 May-Jun;26(3A):1791-5, Carcinogenesis. 2005 Jun;26(6):1152-6, Proc Natl Acad Sci U S A. 2003 Jun 24;100(13):7818-23, Mol Carcinog. 2005 Aug;43(4):237-45, J Huazhong Univ Sci
Appendices 150
their genetic inactivation restored CHFR expression; low level methylation of CHFR was not persistently more prevalent in CIMP-low tumours
Technolog Med Sci. 2005;25(3):240-2., Hepatogastroenterology. 2005 Nov-Dec;52(66):1854-7, World J Gastroenterol. 2008 Aug 28;14(32):5000-7
HCK 0.81 0.46 2.18E-07 methylated in acute lymphocytic leukaemia
a protein-tyrosine kinase that is predominantly expressed in hemopoietic cell types. The encoded protein may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils
not expressed in colon Ca cell line Leukemia. 2007 May;21(5):906-11, Oncogene. 1993 Oct;8(10):2627-35
CEACAM1 0.23 0.56 3.45E-07 no a member of the carcinoembryonic antigen (CEA) gene family, The encoded protein mediates cell adhesion via homophilic as well as heterophilic binding to other proteins of the subgroup. Multiple cellular activities have been attributed to the encoded protein, including roles in the differentiation and arrangement of tissue three-dimensional structure, angiogenesis, apoptosis, tumour suppression, metastasis, and the modulation of innate and adaptive immune responses
CEACAM1 acts as a regulator of apoptosis in the colonic epithelium. Thus, failure of the maturing colon cell to express CEACAM1 is likely to contribute to the development of hyperplastic lesions, which may eventually pave the way to neoplastic transformation and colon cancer development; CEACAM1 is down-regulated in colon; loss or reduced expression of the adhesion molecule BGP is a major event in colorectal carcinogenesis.
Oncogene. 2004 Dec 16;23(58):9306-13, Oncogene. 1999 Sep 30;18(40):5563-72, Proc Natl Acad Sci U S A. 1993 Nov 15;90(22):10744-8
DLK1 0.88 0.41 4.96E-07 methylated in multiple myeloma, upregulation by imprinting (hypermeth) in hepatocellular Ca,
unknown Pref-1 inhibits colonocyte differentiation and proliferation and is expressed in a subset of human colon cancer cell lines
Carcinogenesis. 2007 May;28(5):1094-103, Hum Mol Genet. 2006 Mar 15;15(6):821-30, Carcinogenesis. 2004 Nov;25(11):2239-46
SPP1 0.40 0.70 5.99E-07 no a glyco-phosphoprotein that is expressed and secreted by numerous human cancers. Opn has pivotal role in cell adhesion, chemotaxis, prevention of apoptosis, invasion, migration and anchorage-independent growth of tumour cells
OPN, a downstream effector of PI3K, protects transformed intestinal epithelial cells from programmed cell death and stimulates their anchorage-independent growth, tumour-derived OPN may enhance tumour survival by down regulating expression of NO in the local microenvironment, Ets-1 and Runx2 are critical transcriptional regulators of OPN expression in CT26 colorectal cancer cells. Suppression of these transcription factors results in significant down-regulation of the OPN metastasis protein; RNA interference stably reduces CT26 tumour expression of OPN and significantly attenuates CT26 colon cancer metastasis by diminishing tumor cell motility and invasiveness,
Front Biosci. 2008 May 1;13:4276-84, Carcinogenesis. 2007 Dec;28(12):2476-83, Surgery. 2006 Aug;140(2):132-40, J Biol Chem. 2006 Jul 14;281(28):18973-82, Carcinogenesis. 2005 Apr;26(4):741-51,
GLI2 0.84 0.93 7.28E-07 no transcription factors which bind DNA through GLI2 not expressed in CRC cell lines, Int J Cancer. 2007 Dec
Appendices 151
zinc finger motifs, mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell, play a role during embryogenesis
suggeting aberrant activation of the Hh signaling pathway is not common in colorectal cancer cell lines; In normal colon, GLI2 expression was detected along the whole crypts, suggesting Hedgehog signaling is involved in differentiation of normal colonic tissue rather than in tumour proliferation
15;121(12):2622-7, Virchows Arch. 2009 Apr;454(4):369-79
IGF2AS 0.48 0.30 7.69E-07 no a paternally imprinted antisense transcript of the insulin-like growth factor 2 gene. The transcript is overexpressed in Wilms' tumour. This gene is predicted to be non-coding because the predicted protein is not conserved in any other species and the majority of transcripts would be candidates for non-sense mediated decay (NMD) if a protein were expressed
unknown na
PI3 0.75 0.91 1.15E-06 no elastase-specific inhibitor that functions as an antimicrobial peptide against Gram-positive and Gram-negative bacteria
unknown na
CARD15 0.34 0.64 1.61E-06 no The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome
Mutation and/or polymorphism inconsistently linked to CRC risk, NOD2 promotes epithelial cell growth,
Int J Cancer. 2005 Apr 10;114(3):433-5, Cancer Res. 2006 Mar 1;66(5):2532-5, BMC Cancer. 2007 Mar 27;7:54, BMC Cancer. 2008 Apr 23;8:112, World J Gastroenterol. 2008 Oct 14;14(38):5834-41,
MOS 0.80 0.42 1.61E-06 methylated in hematological cancer,
a serine/threonine kinase that activates the MAP kinase cascade through direct phosphorylation of the MAP kinase activator MEK
unknown
AIM2 0.64 0.86 4.20E-06 methylated in CRC a member of the IFI20X /IFI16 family. It plays a putative role in tumourigenic reversion and may control cell proliferation. Interferon-gamma induces expression of AIM2
demonstrate that inactivation of AIM2 by genetic and epigenetic mechanisms is frequent in MMR-deficient colorectal cancers, thus suggesting that AIM2 is a mutational target relevant for the progression of MSI-H colorectal cancers
Genes Chromosomes Cancer. 2007 Dec;46(12):1080-9
ABCB4 0.83 0.94 6.71E-06 methylated in breast the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes, function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile; Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen
Upregulated in S1 colon cancer cell line with acquired resistance against five cytostatic drugs
Epigenetics. 2008 Sep;3(5):270-80; Anticancer Res. 2005 Jul-Aug;25(4):2661-8
Appendices 152
presentation
TGFB2 0.88 0.36 8.43E-06 methylated in breast Ca, melanoma
regulates key mechanisms of tumour development, namely immunosuppression, metastasis, angiogenesis, and proliferation
TGFB2 is overexpressed in poorly differentiated CRC, TGFB2 expression is upregulated in cancer-associated fibroblasts in metastatic colon cancer, moderate energy restriction attenuated TGF-beta and COX protein expression and the carcinogenic process in Zucker obese rats, Steady state levels of transforming growth factor-beta1 and -beta2 mRNA and protein expression are elevated in colonic tumours in vivo irrespective of dietary lipids intervention, colon carcinoma progression is associated with gradual and significant increases in expression of TGF-beta1 and TGF-beta2 mRNA and proteins, plasma levels of both TGF-beta1 and TGF-beta2 were significantly higher in cancer patients when compared with unaffected individuals
Cancer Res. 2007 Dec 15;67(24):11517-27, Cancer Res. 2006 Jun 15;66(12):6080-6, Anticancer Res. 2006 Jul-Aug;26(4B):2901-7, Oncogene. 2004 Sep 23;23(44):7366-77, Cancer Res. 2003 Oct 15;63(20):6595-601, Int J Cancer. 2002 Aug 20;100(6):635-41, Eur J Cancer. 2001 Jan;37(2):224-33
MEST 0.11 0.37 9.32E-06 LOI in breast, lung CRC a member of the [alpha]/[beta] hydrolase fold family and has isoform specific imprinting. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development
Loss of imprinting (LOI) of PEG1/MEST was 35% CRC, Putative loss of imprinting (LOI) of PEG1/MEST has been implicated in the aetiology of colon cancer
Int J Oncol. 2000 Aug;17(2):317-22, Hum Mol Genet. 2002 Jun 1;11(12):1449-53
BMP4 0.27 0.49 1.35E-05 no important role in the onset of endochondral bone formation in humans, and a reduction in expression has been associated with a variety of bone diseases
Bone morphogenetic protein-4 is overexpressed in colonic adenocarcinomas and promotes migration and invasion of HCT116 cells, BMP4 mRNAs was detected in peripheral blood of patients with colon cancer by RT-PCR, Modulation of Wnt gene expression by BMP4 had several functional consequences--BMP4 treatment led to activation of TCF reporters; complete activation of at least one BMP4-responsive gene required TCF sites; and treatment with a Wnt ligand was sufficient to mimic several of the phenotypic effects of BMP4 treatment. These data demonstrate the tumour suppressive properties of BMP4 signaling, show that colon cancer cells are resistant to BMP4-induced differentiation and growth suppression, BMP4 is overexpressed and secreted by human colon cancer cells with mutant adenomatous polyposis coli genes
Exp Cell Res. 2007 Mar 10;313(5):1033-44, Int J Oncol. 2004 Oct;25(4):1049-56, Cancer Biol Ther. 2004 Jul;3(7):667-75, Cancer Res. 2002 May 15;62(10):2744-8
Appendices 153
LMTK2 0.45 0.55 1.40E-05 no Cprk is expressed in a number of tissues but is enriched in brain and muscle and within the brain is found in a wide range of neuronal populations
unknown J Neurosci. 2003 Jun 15;23(12):4975-83
RIPK3 0.13 0.46 1.67E-05 methylated in lung Ca receptor-interacting protein (RIP) family of serine/threonine protein kinases, a component of the tumour necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor
Overexpressed in CRC, RIP3 beta and RIP3 gamma, two novel splice variants of receptor-interacting protein 3 (RIP3), downregulate RIP3-induced apoptosis.
J Hum Genet. 2006;51(4):368-74, Biochem Biophys Res Commun. 2005 Jun 24;332(1):181-7
BDNF 0.88 0.55 1.95E-05 no Endogenous BDNF enhances the peristaltic reflex by augmenting the release of serotonin and calcitonin gene-related peptide that mediate the sensory limb of the peristaltic reflex induced by mucosal stimulation
unknown Gastroenterology. 2006 Mar;130(3):771-80
DLC1 0.45 0.69 2.80E-05 methylated in liver, breast, colon, and prostate cancers
a RhoGTPase-activating protein (RhoGAP) domain containing tumour suppressor that is often down-regulated in various cancer types
One exonic missense mutation and three intronic insertions/deletions were identified in primary colorectal tumours, knocking down of DLC-1 gene expression promotes LoVo cell migration. Our observations suggest that the DLC-1 gene is associated with LoVo cell proliferation, migration and cell cycle distribution. DLC-1 is a potential suppressor gene in the colon cancer LoVo cell line, mutations in DLC-1 may lead to loss of function and contribute to the tumourigenesis
Cancer Genet Cytogenet. 2003 Jan 15;140(2):113-7, Hum Mutat. 2000;15(2):156-65, Oncol Rep. 2008 Mar;19(3):669-74, Cancer Res. 2008 Oct 1;68(19):7718-22
EPHB6 0.38 0.14 5.16E-05 methylated in prostate, breast, neuroblastoma
Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system
unknown Biochem Biophys Res Commun. 2006 Apr 21;342(4):1263-72, Biochem Biophys Res Commun. 2006 Feb 3;340(1):268-76, Clin Cancer Res. 2004 Sep 1;10(17):5837-44
ALOX12 0.80 0.55 7.16E-05 no encodes an enzyme in the eicosanoid pathway in the skin that plays an essential role in the establishment and/or maintenance of the epidermal barrier function
In the human colon, arachidonic acid is metabolized primarily by cyclooxygenase (COX) and arachidonate lipoxygenase (ALOX) to bioactive lipids, which are implicated in colon cancer risk. Gln261Arg in ALOX12 was not associated with colon cancer risk in Caucasians
Carcinogenesis. 2004 Dec;25(12):2467-72
MEG3 0.76 0.55 1.04E-04 methylated in multiple myeloma, pituitary adenomas, neuroblastoma,
a maternally expressed imprinted gene which appears to function as a non-coding RNA molecule, MEG3 may interact with the cAMP-dependent signaling pathway to be involved in the control of cell proliferation and other cAMP-related physiological functions.
unknown Int J Biochem Cell Biol. 2006;38(10):1808-20, Clin Lymphoma Myeloma. 2008 Jun;8(3):171-5, J Clin Endocrinol Metab. 2008 Oct;93(10):4119-25, Br J Cancer. 2005 Apr 25;92(8):1574-80
Appendices 154
IFNG 0.44 0.75 1.11E-04 no a cytokine critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumour control
In tumour-infiltrating CD4(+) T lymphocytes from patients with colon cancer, tumour-infiltrating lymphocytes cells are inappropriately hypermethylated at IFNG, and thus not confined to the Th1 lineage. In contrast, IFNG in CD4(+) T cells from the tumour draining lymph node were significantly more demethylated than tumour-infiltrating lymphocytes --> methylation of IFNG as an epigenetic mechanism of tumor-induced immunosuppression, LIGHT sensitizes IFN-gamma-mediated apoptosis of HT-29 human carcinoma cells
J Immunol. 2008 Aug 15;181(4):2878-86, Cell Res. 2004 Apr;14(2):117-24,
ERN1 0.39 0.50 1.12E-04 no This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals
unknown na
CPA4 0.29 0.45 1.17E-04 no Carboxypeptidases are zinc-containing exopeptidases that catalyze the release of carboxy-terminal amino acids, and are synthesized as zymogens that are activated by proteolytic cleavage. This gene could be involved in the histone hyperacetylation pathway. It is imprinted and may be a strong candidate gene for prostate cancer aggressiveness
unknown na
CCR5 0.28 0.49 1.30E-04 no This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance, Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation
CCR5, receptor for CCL5 (chemotactic for monocytes/macrophages and T cells) is upregulated in CRC, active recruitment of T cells expressing CCR5 or CXCR3 into the invasive margin of colorectal cancer,
Methods Enzymol. 2009;460:105-21, Int J Cancer. 2005 Oct 10;116(6):949-56