17
DNA Profiling Used to be called DNAfingerprinting, but this was confusing http://www.5min.com/Video/DNA-G enetic-Fingerprinting-1354231 (genetic fingerprinting, 2 min)

DNA Profiling Used to be called DNAfingerprinting, but this was confusing Fingerprinting-1354231

Embed Size (px)

Citation preview

Page 1: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

DNA Profiling

Used to be called DNAfingerprinting, but this was

confusing

http://www.5min.com/Video/DNA-Genetic-Fingerprinting-1354231

(genetic fingerprinting, 2 min)

Page 2: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

DNA profiling is the process where a specific DNA pattern, called a profile, is obtained from an

individual or tissue sample

?

Page 3: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

Uses of DNA Profiling:

To identify the probable origin of a body fluid sample associated with a crime or crime scene.

Page 4: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

Uses of DNA Profiling:

To reveal family relationshipse.g. checking on pedigree in stock breeding

programs.e.g. checking that captive populations of

endangered species are not inbred.

Page 5: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

Uses of DNA Profiling:

To identify disaster victims. For example, ESR scientists traveled to Thailand to help identify victims of the Boxing Day tsunami

Page 6: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

Uses of DNA Profiling:

Genetic screening: the presence of a particular gene, such as cystic fibrosis) in a family.

Page 7: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

Polymorphisms (differences)Most of our DNA is identical to other people’s

DNA

Alleles usually differ by only a base or two

Non-coding regions vary greatly between people

Differences called polymorphisms.

Unique combination of polymorphisms Unique DNA profile

Page 8: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

Short Tandem Repeats (STRs)

Eg CATGATCATGGATCATGCATGCATGCATGCATGCATGT

TCCATGATA

Found at specific loci Number of repeats varies greatlyHomologous chromosomes have different

numbers of repeats.

Page 9: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

Profile is unique

DNA profile - ten specific STRs

No two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs.

Page 10: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231
Page 11: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

Microsatellite containing 4 repeat units

Homologous pair of chromosomes

Microsatellite containing 7 repeat units

Flanking regions to which PCR primers can be attached

centromerestelomeres

Page 12: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

1 Get a sample

DNA found in most cells (eg white blood cells, semen, hair roots) and body fluids, such as saliva and perspiration.

Forensic scientists and police officers collect samples of DNA from crime scenes.

Page 13: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

Mouth swab collects inner cheek cells.

Page 14: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

2. Extract the DNA

DNA is contained within the nucleus of cells. Chemicals are added to break open the cells, extract the DNA, and isolate it from other cell components.

Page 15: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

Magnify the DNA

PCR used to magnify the DNA sample for profiling.

Specific primers are used during PCR, which attach a fluorescent tag to the copied STRs.

Page 16: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

4. Determine the size of the STRs

Gel electrophoresis separates the STRs and can detect the fluorescent dye on each

STR.

More repeats Larger STRs

Page 17: DNA Profiling Used to be called DNAfingerprinting, but this was confusing  Fingerprinting-1354231

Useful links for DNA profiling

DNA profiling at ESRESR is a Crown Research Institute and is New Zealand’s leading organization working in forensic science.

www.esr.cri.nz/competencies/forensicscience/dna/Pages/currenttechniques.aspx

Forensic success storiesNew Zealand examples of DNA profiling helping to solve real crimes.

www.esr.cri.nz/competencies/forensicscience/Pages/ForensicSuccessStories.aspx

DNA profiling to test for parentageA presentation on DNA profiling made by a New Zealand High school teacher. Please click on ‘DNA profiling’ to access.

www.sbs.auckland.ac.nz/uoa/science/about/departments/sbs/student_information/....cfm

DNA profiling interactiveA student-friendly interactive demonstration developed by Biotechnology Online Australia. Try using DNA profiling to investigate a crime or work out who is entitled to inheritance.

www.biotechnologyonline.gov.au/biotechnologyonline/popups/int_dnaprofiling.html

Human identification made simpleA student-friendly description of DNA profiling and how it is used in a variety of international court cases. Go to ‘human identification’ to access.

www.dnai.org/d/index.html

http://www.5min.com/Video/Restriction-Fragment-Length-Polymorphisms-Genetic-Markers-151426148

(Wolfe, genetic markers, 11 min)

http://www.5min.com/Video/Genetic-Screening-151018455 (Wolfe, screening, 11 min)