DNA Technology in Forensic Settings

http://learn.genetics.utah.edu/units/biotech/gel/

What is DNA?

• Deoxyribonucleic acid (DNA) is material that governs inheritance of eye color, hair color, stature, and many other traits

• Is unique for each individual except for identical twins

Just about every cell in our human body contains a complete DNA profile (exception red blood cells, egg and sperm cells)

Chemical Structure of DNA

What is DNA composed of?

AAdenine (A) adenine (A) is always matched with thymine (T) cytosine (C) is always matched with guanine (G)

These are called base pairs and they are the building blocks of DNA

The order these building blocks appear in a particular strand of DNA is always the same for an individual but is unique between individuals

The particular order of the DNA base pairs is what is capitalized on in order to identify an individual

AATTGCCTTTAAAAT

Way to describe a piece of DNA

The DNA code, or genetic code is passed through sperm and egg from the parents to the

offspring

Locus: Location in DNA strand

What are chromosomes?

• Bundled DNA when cells are getting ready to divide

• There are 23 pairs of chromosomes in human DNA including one pair of sex chromosomes

• Females two X chromosomesMale one X one Y

• Alleles variations on particular site on a chromosome

• If alleles are identical at a particular locus, person is homozygous for trait, if not person is heterozygous for trait

Quick Check

1. DNA is composed of nucleotides that are joined together by covalent bonds between which two portions of each nucleotide?a. between deoxyribose and a phosphate groupb. between the two deoxyribose groupsc. between the nitrogen containing groupsd. between a phosphate group and the nitrogen containing ringe. beween the phosphate groups of the two nucleotides

Quick Check continued

2. In the hydrogen bonds between nitrogen containing bases ___________.

a. A always pairs with C

b. A always pairs with G

c. C always pairs with T

d. G always pairs with T

e. G always pairs with C

What does this have to do with forensic DNA testing?

• All DNA testing makes use of these properties of DNA to work

• Two main types:– RFLP (Restriction fragment length polymorphism) – STR (short tandem repeats)

Both often make use of PCR (Polymerase chain reaction)

What is PCR?

• A way to increase the amount of DNA available for typing – does not actually type the DNA itself

• It amplifies the variable regions of DNA• Allows old, damaged, or miniscule quantities to be used

                                                                                                            

      

 

PCR Replicates like DNA does

• http://www.dnalc.org/ddnalc/resources/pcr.html Animation of PCR

PCR Contamination

• Can be a very serious problem• A single piece of DNA can be amplified to

billions of copies in 3 hours• Contamination will nullify the evidence• Proper quality control procedures must be

in place

Read Part 1 of the Case of the Druid Dracula

1. DNA differences can be used to identify people. For example, there is a gene found on both the X and Y chromosomes called amelogenin, but the version of the gene found on the X and Y chromosomes differs in length, so it can be used to tell if a blood stain, such as the one found on the windowsill inside Mable Lyshon’s house, was left by a man or woman. This stretch of nucleotides shows one strand of the DNA double helix for the amelogenin gene; what is the sequence of the other complementary strand?5′CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG3′

a.3′ACTGTTAGATTTCCCTTTTTAGGTCTAGGTCCGTCGGCCTTATTTCCGAGGAATAA5′

b.3′GGGACCCGAGACATTTCTTATCACACAACTAAGAAATAGGGTTTACAAAGATTCAC5′

c.5′GGGACCCGAGACATTTCTTATCACACAACTAAGAAATAGGGTTTACAAAGATTCAC3′

d.3′CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG5′

e.5′CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG3′

2. To assist the investigators with the crime, you will need to perform Polymerase Chain Reaction (PCR) to create copies of this gene so the sizes can be compared to determine if the blood was from a man or woman. During PCR it will be necessary to break the hydrogen bonds of the base pairs. Where are those hydrogen bonds normally found?

a.Between two nitrogen-containing bases in a single strand of DNA. b.Between the phosphate and sugar of the same nucleotide. c.Between the sugar of one nucleotide and the phosphate of a different

nucleotide. d.Between one nitrogen-containing base on a single strand of DNA and

another nitrogen-containing base on the complementary strand of DNA.

e.Between one phosphate on a single strand of DNA and a sugar on the complementary strand of DNA.

3. PCR creates copies of DNA using the exact same mechanism used by your cells to copy their own DNA (replication). Place the steps listed below in the order in which they occur during replication:A) two strands, one new and one original template, wind together to form the double helix.B) short stretch of primer (~20 nucleotides exactly complementary to the gene that is going to be copied) is made.C) separation of the double helix from two parental DNA strands.D) use of parental DNA as a template so that nucleotides are covalently bonded together to form a new chain that is complementary to the bases on the original template.

a.) A, B, C, D b.) B, C, A, D c.) D, B, C, A d.) C, B, D, A

RFLP uses

• Requires more sample and fresh sample if used alone

• It examines more base pairs that have a high probability of being unique to individual

• Used in DNA lab coming up

• The test takes anywhere from 3 weeks to three months to complete, also.

How is RFLP done?

1. DNA from crime-scene evidence is cut with a restriction enzyme

• Restriction enzyme recognizes a particular short sequence of DNA that is likely to occur many times in a given cell’s DNA such as AATT

• In order for RFLP to work, the analyst needs thousands of cells. If all are present from a single individual, they will be cut in the same place.

How is RFLP done? (cont.)

• Cut DNA is sorted on gel by electrophoresis

• Gel allows small fragments to travel faster than large ones

• Location of DNA is visualized by staining or blotting

• Sizes of fragments are compared between different samples

RFLP Problemshttp://

www.biology.arizona.edu/Human_bio/problem_sets/DNA_forensics_1/01Q.htmlAnother example

What is STR?

• STR (short tandem repeats): Region of a DNA molecule that contains short segments that repeat over and over again

• The STR strand is short, less than 400 base pairs in length

AGCTAGCTAGCTAGCT

• Short length makes the DNA less susceptible to degradation

• Their short length makes them ideal candidates for PCR, thereby overcoming the limited size of sample often encountered in crime scene samples

How is STR done?

• The particular sequence sought is extracted and amplified from sample

• Sample is separated on gel• The distance STR has migrated on gel

correlates with number of repeats• # of repeats individual has for particular

locus will vary• Frequency of STR sequences must be

known for given population

How are the results of an STR analysis used?

• What is the likelihood that two, otherwise unrelated African-Americans would have the same TH01 signature?

• Same TH01 and TPOX?• Same TH01, TPOX, and

vWA?• What certainty would you

like to see in these numbers before you convict?

STR African-American

U.S. Caucasian

S3s1358 0.094 0.075

vWA 0.063 0.062

FGA 0.033 0.036

TH01 0.109 0.081

TPOX 0.090 0.195

Must know frequency of STR sequence for given population

Which of the above (A or B) represents the profile of a man?

Back to the Case of the Druid Dracula

• Did suspect 1 or 2 commit the crime?

• suspect #1 • suspect #2

2. There are only a few different numbers of repeats that are seen in our population—only 5 different TPOX STRs for example. By testing thousands of DNA samples, researchers know the distribution of these different STRs in the general population; those allele frequencies are shown in the table below. Using these frequencies, one can determine the probability that someone else at random would have the same matching pattern. For example, what is the likelihood that someone else at random would have the same pattern of Matthew Hardman (a 5 and 7 repeat for the THO1 STR)?

A.1/200 B. 1/206 C. 1/1200 D. 1/2600 E. 1/20060

3. What is the probability that someone else at random would have that same pattern of THO1 5 & 7, TPOX 8 & 9, and CSF1PO 11 & 12?

a. 1/1600

b. 1/7200

c. 1/17600

d. 1/172800

e. 1/1555200

Mitochondrial DNA

• Found outside nucleus• Inherited solely from mother• Every cell contains hundreds to thousands of

mitochondria therefore there are hundreds to thousands of copies of mtDNA in every cell vs. just one copy of nuclear DNA in each cell

Useful in situations where nuclear DNA is degraded by age or fire, not present in large enough amounts (hair shafts), or when a reference sample cannot be obtained

Using DNA to Solve Crimes

• CODIS Combined DNA Index System: Allows investigators to compare DNA types recovered from crime scenes with DNA from convicted sex offenders and other criminals

• Has allowed thousands of crimes to be linked and solved

• Currently 13 STRs are encoded into CODIS

• Has allowed 373 case matches since its advent

Case study: Using mtDNA to establish identity in the case of Anastasia Romanov

Case Study: Two Peas in a Pod

The Case of Questionable Twins