22
Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a score from 1-9)?

Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

Embed Size (px)

Citation preview

Page 1: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

Do Now—6.4.15

Turn your Do Now into the front

What grade do you think you earned on your final? Why?

Why grade do you think you earned on the EOC (on a score from 1-9)?

Page 2: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

Ms. C’s Absence

Hi, I’ve been admitted to the hospital. My wound hasn’t healed and the doctor saw the hardware this morning (not good). I’m going to have surgery to have the hardware removed and get IV antibiotics.

I’ll be back when I can.Grades are as up to date as possible.

Page 3: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

Objective

SWBAT analyze DNA profiles created by gel electrophoresis.

SWBAT practice micropipetting and loading gels.

Page 4: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a
Page 5: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

DNA Profiling / DNA Fingerprinting

http://learn.genetics.utah.edu/content/labs/gel/

Page 6: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

PCR

The polymerase chain reaction (PCR) is used to amplify specific regions of the DNA. The process uses the same enzymes used by cells to replicate DNA and short sections of DNA that act as primers

Page 7: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

PCR

Forensic Investigation: Suspect DNA should be a complete match with the sample taken from a crime scene if a conviction is to occur

Page 8: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

Restriction Fragment Length Polymorphism

Restriction enzymes cut DNA at specific spots that are nucleotide sequence-specific. The different cutting pattern will lead to differently sized products that can be separated in gel electrophoresis.

Page 9: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

Gel Electrophoresis

Page 10: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

Gel Electrophoresis

Page 11: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

Gel Electrophoresis

Page 12: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

Gel Electrophoresis

DNA is negatively charged

Smaller DNA fragments travel further during electrophoresis.

Page 13: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

DNA Profiling

Paternity Testing: Children inherit half of their alleles from each parent and thus should possess a combination of their parents alleles

Page 14: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

DNA Profiling

Paternity Testing: Children inherit half of their alleles from each parent and thus should possess a combination of their parents alleles

Page 15: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

DNA Profiling

Forensic Investigation: Suspect DNA should be a complete match with the sample taken from a crime scene if a conviction is to occur

Page 16: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

DNA Profiling

Forensic Investigation: Suspect DNA should be a complete match with the sample taken from a crime scene if a conviction is to occur

Page 17: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a
Page 18: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

DNA Profiling

Forensic Investigation: Suspect DNA should be a complete match with the sample taken from a crime scene if a conviction is to occur

Page 19: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

Classwork

Complete the worksheet to the best of your ability…

*This worksheet shows single stranded DNA

*This restriction enzyme makes a blunt cut

Page 20: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

WorksheetStandard

CCATCCAAGACATTATGCAGG/CCTAGACTATT

ACGGCCATACCAAGG/CCCACTGG/CCAAACAC

ACCCATCAGG/CCATGG/CC

CCATCCAAGACATTATGCAGGCCTAGACTATTA

CGGCCATACCAAGGCCCACTGGCCAAACAC

ACCCATCAGGCCATGGCC

21/26/8/18/6/2Then color the boxes on the sheet that correspond

*This worksheet shows single stranded DNA

*This restriction enzyme makes a blunt cut

Page 21: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

Classwork

*This worksheet shows double stranded DNA as it should be

*This restriction enzyme makes a sticky cut

Page 22: Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a

WorksheetEar Phone DNA

6/23/15/3Then color the boxes on the sheet that correspond

GTCGACCGGTGACCGTGCGTACAGTGCTATCAGCTGGCCACTGGCACGCATGTCACGATA

CCGGATAGCTAATAGCTCCGGTG GGCCTATCGATTATCGAGGCCAC

*This worksheet shows double stranded DNA as it should be

*This restriction enzyme makes a sticky cut

GTCGAC CGGTGACCGTGCGTACAGTGCTATCAGCTGGC CACTGGCACGCATGTCACGATA

C CGGATAGCTAATAGCTC CGGTG GGC CTATCGATTATCGAGGC CAC

*You count the pairs