Supplemental Information

USP49 deubiquitinates histone H2B and regulates co-transcriptional pre-mRNA

splicing

Zhuo Zhang, Amanda Jones, Heui-Yun Joo, Dewang Zhou, Ying Cao, Shaoxia Chen,

Hediye Erdjument-Bromage, Matthew Renfrow, Hang He, Paul Tempst, Tim M.

Townes, Keith E Giles, Ligeng Ma, and Hengbin Wang

Supplemental Experimental Procedures

Purification of USP49 as a putative H2B deubiquitinase.

For conventional purification of USP49, Hela nuclear proteins were separated into

nuclear extracts and nuclear pellets using a previously described procedure (Dignam et al.

1983; Joo et al. 2007). Nuclear extract (6 g) was loaded onto a 700 ml P11 column

equilibrated with buffer C (20 mM Tris-HCl, pH 7.9, 0.2 mM EDTA, 1 mM DTT, 0.1

mM PMSF, 0.025 % NP-40, 10 % glycerol) containing 100 mM KCl (BC100). Proteins

that bound to the column were step eluted with BC300, BC500, and BC1000. The BC500

fraction was dialyzed against Buffer D (40 mM Hepes-KOH, pH 7.9, 0.2 mM EDTA, 1

mM DTT, 0.1 mM PMSF, 0.025 % NP-40, 10 % glycerol) containing 20 mM ammonium

sulfate (BD20) and then loaded onto a 200 ml DE52 column. Bound proteins were

stepwise eluted with BD350 and BD500. The BD350 fraction was then dialyzed against

BD20 and loaded onto a 45 ml HPLC-DEAE-5PW column (TOSOH Bioscience). Bound

proteins were eluted with an 8 column volume (cv) linear gradient from BD20 to BD500.

Fractions that contained H2B-deubiquitination activity were adjusted to BD600 with

saturated ammonium sulfate and loaded onto a 22 ml FPLC Phenyl Sepharose column

(Amersham Biosciences). Bound proteins were eluted with a 12 cv linear gradient from

1

BD600 to BD0. The active fractions were dialyzed against buffer P (5 mM Hepes-KOH,

pH 7.5, 0.04 M KCl, 0.01 mM CaCl2, 10 % glycerol, 1 mM DTT, 0.1 mM PMSF)

containing 10 mM potassium phosphate and loaded onto a 5 ml hydroxyapatite column

(Bio-rad). The column was eluted with a 20 cv linear gradient from BP10 to BP600.

Fractions that contained H2B-deubiquitination activity were dialyzed against BC100 and

loaded onto a MonoS column. The column was eluted with a 20 cv linear gradient from

BC100 to BC1000. Activity containing fractions were loaded onto a Superose 6 column

(Amersham Biosciences) that was equilibrated with BC500. The H2B deubiquitination

activity eluted between fraction # 60 to #63, corresponding to a molecular weight of 443

kDa.

Purification of USP49 from sf9 cells and USP49 complex from HeLa stable cell line.

To purify USP49 from sf9 cells, full-length cDNA of USP49 was cloned into a

baculovirus vector with a Flag tag at the N-terminus and a 2 x Myc tag at the C-terminus.

USP49 was purified from sf9 cells infected with this baculovirus by sequential affinity

purification, first by anti-Flag immunoprecipitation and then by anti-Myc

immunoprecipitation (Joo et al. 2007). To reconstitute the recombinant USP49 complex

in vitro, baculovirus vectors encoding FLAG tagged USP49 orUSP49 catalytic mutant

and HA tagged RVB1 and SUG1 were individually transfected into sf9 cells and purified

by anti-Flag or anti-HA immunoprecipitation. Complex containing wild type USP49,

RVB1 and SUG1 or USP49 mutant, RVB1 and SUG1 were reconstituted in vitro by

dialyzing against BC50. To purify the USP49 complex, nuclear extracts (1.5 g) from

HeLa S3 stable cell lines expressing Flag-HA-USP49 were loaded onto a 220 ml P11

2

column and step eluted with BC100, BC300, BC500, and BC1000. BC500 fraction was

then loaded onto a 120 ml DE52 column and stepwise eluted with BD350 and BD500.

The BD350 fraction, which contains USP49, was loaded on a 45 ml DEAE5PW column

(TOSOH Bioscience) and bound proteins were eluted with an 8 cv gradient from BD20 to

BD500. Fractions that contain USP49 were pooled, dialyzed against BC-50 and used as

input for a 5 ml HiTrapQ column (GE Amersham). USP49 containing HiTrapQ fractions

were dialyzed against BC50 and used as input for anti-Flag immunoprecipitation. The

eluate from anti-Flag immunoprecipitation was subjected to a second

immunoprecipitation with anti-HA antibody. Elute from anti-HA immunoprecipitation

was dialyzed and used for silver staining, mass spectrometry identification, and histone

deubiquitination assays.

Mass spectrometry identification.

To identify all polypeptides in lane # 60 (Figure 1D, top panel), the entire gel lane was

divided into 27 pieces and subjected to mass spectrometry analysis with a high resolution

linear quadrupole ion trap Fourier transform ion cyclotron resonance mass spectrometer

(LTQ3 FT-ICR MS, ICR, Thermo Fisher Scientific). Briefly, individual gel slices

were reduced with 10 mm DTT at 37 °C for 45 min, alkylated with 50 mm iodoacetamide

at 37 °C for 45 min, and digested with trypsin overnight at 37 °C. Peptides were extracted

from the gel using 50% acetonitrile and concentrated in a speed vacuum. Tryptic digests

were loaded onto a 100-μm diameter, 11-cm pulled tip packed column with Jupiter 5-μm

C18 reversed-phase beads (Phenomenex) using a Micro AS autosampler and LC

nanopump (Eksigent). An acetonitrile gradient in 0.1% formic acid was run from 5 to

3

40% over 50 min at a flow rate of 650 nl/min. The eluting peptides were analyzed by

collision-induced dissociation fragmentation on a LTQ FT-ICR. The LTQ FT-ICR

parameters were set as described previously (Renfrow et al. 2007). Fully tryptic human

peptides were identified using TurboSequest version 27 (revision 12, Thermo Fisher

Scientific) (Eng et al. 1994) with a parent ion mass accuracy of 10.0 ppm from the

UniRef100 data base (06/2009). 

To identify USP49 complex, purified protein complexes were resolved using

SDS-PAGE, followed by brief staining with Coomassie Blue and excision of the

separated protein bands. In gel trypsin digestion of polypeptides in each gel slice was

performed as described (Sebastiaan Winkler et al. 2002). The tryptic peptides were

purified using a 2-µl bed volume of Poros 50 R2 (Applied Biosystems, CA) reversed-

phase beads packed in Eppendorf gel-loading tips (Erdjument-Bromage et al. 1983). The

purified peptides were diluted to 0.1% formic acid and then subjected to nano-liquid

chromatography coupled to tandem mass spectrometry (nanoLC-MS/MS) analysis as

follows. Peptide mixtures (in 20 µl) were loaded onto a trapping guard column (0.3x5mm

Acclaim PepMap 100 C18 cartridge from LC Packings, Sunnyvale, CA) using an

Eksigent nano MDLC system (Eksigent Technologies, Inc. Dublin, CA) at a flow rate of

20 µl/min. After washing, the flow was reversed through the guard column and the

peptides eluted with a 5-45% acetonitrile gradient over 85 min at a flow rate of 200

nl/min, onto and over a 75-micron x 15-cm fused silica capillary PepMap 100 C18

column (LC Packings, Sunnyvale, CA). The eluent was directed to a 75-micron (with 10-

micron orifice) fused silica nano-electrospray needle (New Objective, Woburn, MA). The

4

electrospray ionization needle was set at 1800 V. A linear ion quadrupole trap-Orbitrap

hybrid analyzer (LTQ-Orbitrap, ThermoFisher, San Jose, CA) was operated in automatic,

data-dependent MS/MS acquisition mode with one MS full scan (450-2000 m/z) in the

Orbitrap analyzer at 60,000 mass resolution and up to five concurrent MS/MS scans in

the LTQ for the five most intense peaks selected from each survey scan. Survey scans

were acquired in profile mode and MS/MS scans were acquired in centroid mode. The

collision energy was automatically adjusted in accordance with the experimental mass

(m/z) value of the precursor ions selected for MS/MS. Minimum ion intensity of 2000

counts was required to trigger an MS/MS spectrum; dynamic exclusion duration was set

at 60 s.

Initial protein/peptide identifications from the LC-MS/MS data were performed

using the Mascot search engine (Matrix Science, version 2.3.02;

www.matrixscience.com) with the human segment of International Protein Index (IPI)

protein database (89,952 sequences; European Bioinformatics Institute, Hinxton, UK).

The search parameters were as follows: (i) two missed cleavage tryptic sites were

allowed; (ii) precursor ion mass tolerance = 10 ppm; (iii) fragment ion mass tolerance =

0.8Da; and (iv) variable protein modifications were allowed for methionine oxidation,

cysteine acrylamide derivatization and protein N-terminal acetylation. MudPit scoring

was typically applied using significance threshold score p<0.01. Decoy database search

was always activated and, in general, for merged LS-MS/MS analysis of a gel lane with

p<0.01, false discovery rate averaged around 1%.

5

Scaffold (Proteome Software Inc., Portland, OR), version 3_3_2 was used to

further validate and cross-tabulate the MS/MS-based peptide and protein identifications.

Protein and peptide probability was set at 95% with a minimum peptide requirement of 1.

RNA and ChIP sequencing and bioinformatics analysis.

mRNA samples were prepared as described in the Illumina mRNA sequencing sample

preparation guide. Briefly, mRNA was specifically enriched from total RNA using

oligo(dT) beads and sheared into small pieces. The fragments were then reverse-

transcribed into first-strand cDNA using random hexamer primers, followed by second

strand synthesis using DNA polymerase I. The short cDNA strands were ligated with 3’-

and 5’-adapters for amplification and sequencing. Chromatin immunoprecipitation was

prepared following a protocol provided by Dr. Zhibin Wang (Johns Hopkins University)

(Wang et al. 2009). Briefly, cells were cross-linked with 1% formaldehyde and chromatin

was disrupted into 100-250 bp fragments by sonication and precipitated using antibody as

indicated in the text and protein A beads. After elution from the beads and reverse cross-

linking, the DNA fragments in immunoprecipitates were extracted with

phenol/chloroform and recovered by ethanol precipitation. Immunoprecipitated DNA was

ligated with 3’- and 5’-adapters for amplification and sequencing by Illumina II.

The ChIP-seq reads were mapped to hg18 using Bowtie, and the RNA-seq reads

were mapped using TopHat (Langmead et al. 2009; Trapnell et al. 2009). Both

algorithms were run using the default parameters within Galaxy. PCR duplicates were

removed using Picard (http://picard.sourceforge.net). For visualization, the mapped reads

6

were converted into bedgraph format using BEDTools ‘genomeCoverageBed’ with the –

bg parameter and –split option as appropriate (Quinlan and Hall 2010). These datasets

were also normalized in the bedgraph format as reads per million total unique mapped

reads using the –scale parameter.

The mapped RNA-seq data (BAM format) was input into Cufflinks to assemble

transcripts (Roberts et al. 2011). Differentially expressed genes were identified with

Cuffdiff. The log2 fold change (Figure 4A) is a direct output from Cuffdiff. Exon

inclusion level was calculated for all internal exons with more than 10 spliced aligned

tags. We first calculated the A = number of spliced tags joining a single internal exon to

an upstream or downstream exon. We next calculated B = the number of spliced tags

linking an upstream exon to a downstream exon. Exon inclusion level was calculated as

A/(A+B), with a value of 0 representing complete skipping of the exon and a value of 1

indicative of complete inclusion. Splicing efficiency for each internal intron was

calculated as X/(X+.5(Y+Z) where X=RPKM of exon aligning tags, Y= RPKM of

upstream intron aligning tags and Z= RPKM of downstream intron aligning tags. The

uH2B, H3, H2B and USP49 ChIP-seq tags that aligned within these exons, genes, and 3’

and 5’ intron-exon junctions were calculated tags and the RPM for USP49KD and

Control cells were then compared. The meta-analyses were performed on intervals 500

base pairs downstream and 500 base pairs upstream of the 5’ and 3’ end of each

identified exon. The tag density at each position within the resulting 1000 base pairs per

exon were quantified using coverageBed –d . The average coverage at each position was

7

then calculated using groupBy –g 7 – c 8 – o mean option, all using BEDTools. The raw

data have been deposited in the NCBI database under GEO number GSE38101.

RNA immunoprecipitation

RNA immunoprecipitation was performed according to a previously published protocol

(Luco et al. 2010). Briefly, approximately 5X106 cells per IP were crosslinked with 1%

formaldehyde for 15 min at room temperature. After quick PBS-washing, cells were

harvested in 3 ml of ice-cold Lysis buffer (50 mM Tris-HCl pH 8, 100 mM NaCl, 5 mM

MgCl 2, 0.5% NP-40). Nuclei were pelleted at 2,000xg for 4 min at 4 °C. Pellets were

resuspended in 500 μl of IP buffer (50mM Tris-HCl pH 8, 140 mM NaCl, 1 mM EDTA,

1% Triton X-100, 0.1% Na-deoxycholate) for sonication (Fisher Scientific Sonic

Dismembrator Model 500, 14% Output for 21 times plus 21% output for 7 times with 10

seconds for each sonication and each interval). After spinning at 13200 rpm for 25

minutes to remove cell debris, the supernatants were incubated with 30 μl of protein A

beads for preclearing followed by incubation with U1A antibody (USbiological,

Swampscott, MA, Cat# U0005-60) for 2 hr and incubation with 35 μl protein A beads for

overnight at 4°C. Then the protein A beads were pelleted and washed sequentially in

RIPA buffer (50mM Tris-HCl pH 8, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100,

0.1% SDS and 0.1% Na-deoxycholate) and high-salt RIPA (RIPA at 500 mM NaCl) for 5

min in a rotation wheel at 4 °C and then twice in TE buffer at room temperature for 2

min. Beads were eluted for 15 min at 65 °C in 200 µl of elution buffer (1% SDS and

100mM NaHCO3). Cross-linking was reversed by incubation of elution with 200 mM

NaCl (final concentration) for 4.5 h at 65 °C. 1 ml of Trizol (Invitrogen) and 200 µl of

8

chloroform were added and spun for 15 min at 12,000 g for separation of the phases. 1 ml

of cold isopropanol was added to precipitate the RNA which was then washed by 1 ml of

RNAse-free 75% ethanol. Then RNA pellet was dissolved in DEPC H2O and treated

with DNAse I (Invitrogen, Cat# AM1906M) to avoid DNA contamination. Then

immunoprecipitated and input RNA were reverse transcribed to cDNA using MMLV

reverse transcriptase (Promega, Cat# M1701) and random primer (Promega, Cat#

C1181). The cDNAs were analyzed by SYBR-Green real-time qPCR.

Chromatin bound and unbound fractionation

Fractionation of chromatin bound and unbound cell lysates were performed following a

published protocol (Fuchs et al. 2012) . Briefly, cells were lysed by Dounce

homogenizer on ice after being incubated with lysis buffer A (5mM HEPES pH7.9,

0.75mM MgCl2, 5mM KCl, 0.25mM dithiothreitol [DTT]) on ice for 30 min. After

centrifuging for 15 min at 3,300g at 4 °C, supernatant (S1) was collected, and the

pellet was resuspend in buffer B (buffer A supplemented with 0.34M sucrose, 10%

glycerol, 10mM NaF and 1mM Na3VO4) plus 0.5% NP40. Next, samples were incubated

on ice for another 30 min and centrifuged for 10 min at 3300g at 4 °C. Supernatant (S2)

was added to (S1) to make the “unbound” fraction. The pellet was resuspended in buffer

B to make the “bound” fraction.

Nucleoplasmic and chromatin bound RNA

The fractionation of nucleoplasmic and chromatin bound RNA was adapted from

Khodor, et al (Khodor et al. 2011). Inducible USP49 knockdown cell lines were grown

9

in 10 cm plates to confluence either with or without doxycycline. Cells were harvested

by scraping and washed twice in ice-cold PBS. Cells were resuspeneded in buffer (15

mM HEPESKOH at pH 7.6, 10 mM KCl, 5 mM MgOAc, 3 mM CaCl2, 300 mM sucrose,

0.1% Triton X-100, 1 mM DTT, and protease inhibitors) and lysed with a dounce

homogenizer (30 strokes, tight pestle). 0.5 mL aliquots of the cell lysate were layered

onto buffer B (15 mM HEPES-KOH at pH 7.6, 10 mM KCl, 5 mM MgOAc,3 mM

CaCl2, 1 M sucrose, 1 mM DTT, protease inhibitors), and centrifuged at 8000 rpm for 15

minutes at 4°C. The supernatant , containing nucleoplasmic RNA’s, was collected and

mRNA purified with TRIzol (Invitrogen) according to the manufacturer’s instructions.

The pellet, containing chromatin bound RNA’s, was resuspended with two strokes in a

dounce homogenizer in 5 volumes of nuclear lysis buffer (10 mM HEPES-KOH at pH

7.6, 100 mM KCl, 0.1 mM EDTA, 10% glycerol, 0.15 mM spermine, 0.5 mM

spermidine, 0.1 M NaF, 0.1 M Na3VO4, 0.1 mM ZnCl2,1 mM DTT, 13 Complete

protease inhibitors, 1 U/mL RNasin Plus [Promega]) . NUN buffer (25 mM HEPES-

KOH at pH 7.6, 300 mM NaCl, 1 M Urea, 1%NP-40, protease inhibitors) was added to

the nuclear suspension dropwise in a 1:1 ratio. After a 20 minute incubation on ice, the

sample was spun down at 14,000 rpm for 30 minutes at 4°C. The supernatant was RNA

was purified with TRIzol.

Sequences for primers and RNAi

The sequences of the primers for amplifying mRNAs are the following: HDM2: F:

TGTTGTGAAAGAAGCAGTAGCA, R: CCTGATCCAACCAATCACCT; PUMA: F:

GACGACCTCAACGCACAGTA, R: GTAAGGGCAGGAGTCCCAT; GAPDH: F:

10

GGTGGTCTCCTCTGACTTCAACA, R: GTTGCTGTAGCCAAATTCGTTGT. The

sequences of the primers for amplifying the introns are the following: RPS3 Intron 4: F:

TGTTTGCACACATTGAAGCA, R: CTCCAGGCCCTTTCACATTA; RPS6 Intron 4:

F: CTGAAAAGGCCTATGCTCCA, R: TGACAATTCCTGCCAATTCA; PUMA intron

3: F: TGTCCTGGATGAGGATGTGA, R: GCAGTTAGCAGGGGACTGAG;

HDM2 intron 8: F: AGGGAGAAGGCAGAAGGAAG, R:

GGCTAAATGACATGCCTGGT. Myc region 1: -287 to -179, F:

GAGATCCGGAGCGAATAGG, R: GCTGCTATGGGCAAAGTTTC; region 2: -115 to

+70, F: GAGGCTATTCTGCCCATTTG, R: GCATTCGACTCATCTCAGCA; region 3:

+51 to +185, F: TGCTGAGATGAGTCGAATGC, R: AGTCACTTTACCCCGATCCA.

GATAD2A Junction of Exon 4 and Intron 4: F: AAGTTGCGGCAGAGTCAAAT, R:

TGACATTGATGAGGGGATCA; SLMO2 Junction of Exon 2 and Intron 2 F:

GAAAGTTGCACAGCCACAGA, R: GGCTCCCACAACCTATTTGA; MAD2L1-

Junction of Exon 2 and Intron 2 F: CGGACTCACCTTGCTTGTAA, R:

GAGCGGAAAAATGACTGCTT; MAD2L1-Exon 2 F:

TCGGCATCAACAGCATTTTA, R: GAGTCCGTATTTCTGCACTCG; MAD2L1

Intron 2 F: ACTCTTCCCCCACCCACTAC, R: TGGCCACATTTACTGCAAAA

siRNAs for transient knockdown of endogenous USP49 in human cells and the scrambled

control siRNAs were purchased from Invitrogen (Grand Island, NY). The sequences of

the USP49 siRNAs are: #1: UAUACAUGUGACCUGACUGAGCAGC; #2:

UUAUCAUUGAGCACGUAGUCCUUGC; #3:

UUCCCGUGAUGCAUGACCACUGCGG. USP49 siRNA and scrambled control

11

siRNA were transfected into human cells using Lipofectamine2000 (Invitrogen, Grand

Island, NY) according to the manufacturer’s protocol.

The sequences of the oligonulaotides cloned into pBabe-U6 for transcription of shRNAs

against USP49 in human cells are: #1: GGTCATGCATCACGGGAAA; #2:

GGACTACGTGCTCAATGAT.

ReferencesDignam J, Martin P, Shastry B, Roeder R. 1983. Eukaryotic gene transcription with

purified components. Methods Enzymol 101: 582-598.Eng J, McCormack A, Yates J. 1994. An approach to correlate tandem mass spectral data

of peptides with amino acid sequences in a protein database. Journal of The American Society for Mass Spectrometry 5: 976-989.

Erdjument-Bromage H, Lui M, Lacomis L, Grewal A, Annan R, McNulty\ D, Carr S, Tempst P. 1983. Examination of micro-tip reversed-phase liquid chromatographic extraction of peptide pools for mass spectrometric analysis. J Chromatogr A 826: 167-181.

Fuchs G, Shema E, Vesterman R, Kotler E, Wolchinsky Z, Wilder S, Golomb L, Pribluda A, Zhang F, Haj-Yahya M et al. 2012. RNF20 and USP44 Regulate Stem Cell Differentiation by Modulating H2B Monoubiquitylation. Mol Cell 46: 662-673.

Joo H-Y, Zhai L, Yang C, Nie S, Erdjument-Bromage H, Tempst P, Chang C, Wang H. 2007. Regulation of cell cycle progression and gene expression by H2A deubiquitination. Nature 449: 1068-1072.

Khodor YL, Rodriguez J, Abruzzi KC, Tang CH, Marr MT, 2nd, Rosbash M. 2011. Nascent-seq indicates widespread cotranscriptional pre-mRNA splicing in Drosophila. Genes Dev 25: 2502-2512.

Langmead B, Trapnell C, Pop M, Salzberg SL. 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10: R25.

Luco RF, Pan Q, Tominaga K, Blencowe BJ, Pereira-Smith OM, Misteli T. 2010. Regulation of Alternative Splicing by Histone Modifications. Science 327: 996-1000.

Quinlan AR, Hall IM. 2010. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26: 841-842.

Renfrow MB, MacKay CL, Chalmers MJ, Julian BA, Mestecky J, Kilian M, Poulsen K, Emmett MR, Marshall AG, Novak J. 2007. Analysis of O-glycan heterogeneity in

12

IgA1 Myeloma Proteins by Fourier Transform Ion Cyclotron resonance Mass Spectrometry: Implications for IgA Nephropathy. Analytical and Bioanalytical Chemistry 389: 1397-1407.

Roberts A, Trapnell C, Donaghey J, Rinn JL, Pachter L. 2011. Improving RNA-Seq expression estimates by correcting for fragment bias. Genome Biol 12: R22.

Sebastiaan Winkler G, Lacomis L, Philip J, Erdjument-Bromage H, Svejstrup JQ, Tempst P. 2002. Isolation and mass spectrometry of transcription factor complexes. Methods 26: 260-269.

Trapnell C, Pachter L, Salzberg SL. 2009. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25: 1105-1111.

Wang Z, Zang C, Cui K, Schones DE, Barski A, Peng W, Zhao K. 2009. Genome-wide Mapping of HATs and HDACs Reveals Distinct Functions in Active and Inactive Genes. Cell 138: 1019-1031.

Supplemental Experimental data

13

Figure S1. Mass spectrometry analysis of the USP49 complex. The identified peptides

corresponding to USP49, RVB1, and SUG1 are highlighted. Numbers represent amino

acid position.

14

Figure S2. USP49 co-immunoprecipitates with RVB1 and SUG1. Western blot

analysis of immunoprecipitates from USP49 antibody and control IgG with nuclear

extracts as input. Antibodies used are indicated on the left side of the panel.

Figure S3. USP49 inducible knockdown cell lines established with different shRNA.

USP49 knockdown results in a specific increase of uH2B levels with no effects on uH2A

levels.

15

Figure S4. Scatter plot of splicing completion values for control and USP49

knockdown cells. Most exons are completely spliced in control and USP49 knockdown

cells (see box and whisker plot insert).

Figure S5. A box and whisker plot of splicing completion values for up- and down-

regulated exons before and after USP49 knockdown. Control and USP49 knockdown

cell splicing completion values are lower for exons down-regulated in USP49 knockdown

cells.

16

Figure S6. A box and whisker plot of the change in splicing completion values in

control and USP49 knockdown cells. In USP49 knockdown cells, down-regulated

exons show a decrease in splicing completion compared to the splicing completion for

these exons in control cells.

Figure S7. USP49 knockdown caused defects in splicing of chromatin associated

pre-mRNA. Regions corresponding to intron-exon junctions were amplified.

17

Figure S8 USP49 knockdown does not affect mRNA decay. Intron containing

transcripts are elevated in USP49 knockdown cells (compare 0 time point for filled or

empty boxes), but intron containing transcripts are degraded at similar rates in control

and USP49 knockdown cells.

Figure S9. Exons from genes with USP49 bound transcription start sites (TSS) show

greater changes in alternative splicing. Exon inclusion levels for down-regulated exons

from genes whose TSS were bound by USP49 are lower than up-regulated USP49 TSS

bound exons (p-value=4.32 x 10-46) or than exon inclusion levels for up-regulated (p-

18

value=1.66 x 10-55) or down-regulated (p-value=.004125) exons whose TSS were not

bound by USP49.

Figure S10. Exons from genes with USP49 bound transcription start sites (TSS)

show greater changes in splicing completion. Splicing completion levels for down-

regulated exons from genes with TSS bound by USP49 are lower than up-regulated

USP49 TSS bound exons (p-value=6.03 x 10-4) or than exon inclusion levels for up-

regulated (p-value=7.88 x 10-5) or down-regulated (p-value=.015757) exons whose TSS

were not bound by USP49.

19

Figure S11. USP49 binds exons down-regulated in USP49 knockdown cells. USP49 is

relatively enriched at exons as well as 3’ (p-value=9.45 x 10-20) and 5’ (p-value=1.43 x

10-19) splice junctions of exons (p-value=.021686) down-regulated but not up-regulated in

USP49 knockdown cells.

Figure S12. Increase of unspliced transcripts for exons down-regulated in USP49

knockdown cells. The median level of unspliced transcripts is increased for down-

regulated exons but not up-regulated exons (p-value=1.03 x 10-50) in USP49 knockdown

cells.

20

Figure S13. Knockdown of USP22 and USP12 does not affect pre-mRNA splicing. A. Western blot assay of H2A and H2B ubiquitination in control and USP22 and USP12 knockdown cells. Antibodies used are labeled on the left side of the panels. B. RT-qPCR analysis of selected genes in control and USP22 knockdown cells. C. RT-qPCR analysis of selected genes in control and USP12 knockdown cells.

21

Figure S14. 3’ splice site strength is elevated at down-regulated exons. The median strength of 3’ splice sites (p-value=0.00102) is increased for down-regulated exons but not up-regulated exons in USP49 knockdown cells. 5’ splice site (p-value=0.453562) strength is not significantly different for exons down-regulated and up-regulated in USP49 knockdown cells. Splice site strength was calculated using MaxEnt.

Figure S15. USP49 binding and H2B ubiquitination are highly correlated.

22

Figure S16. Genes bound by USP49 show greater uH2B levels in response to USP49 knockdown. A box and whisker plot of uH2B RPKM normalized tags for genes, exons and introns.

Figure S17. Chow-Ruskey plot of the overlaps between decreased splicing completion, elevated USP49 binding, and fold change in uH2B levels.

23

Figure S18. Fold change in H3 levels for exons down-regulated or up-regulated in USP49 knockdown cells. H3 levels are relatively stable in response to USP49 knockdown.

Figure S19. RPM normalized H3 tag counts are relatively stable across exons and 5’ and 3’ splice junctions.

24

Figure S20. Normalized H2B tag counts RPM is increased at exons as well as 5’ and 3’ splice junctions for exons down-regulated in USP49 knockdown cells.

Figure S21. U1A immunoprecipitation and RT-qPCR assay on -actin transcripts. A. RT-qPCR analysis of input. B. RT-qPCR analysis of U1A immunoprecipitate. Regions for real time PCR amplification, corresponding to exon-intron junctions, are shown at bottom.

25

Figure S22. ChIP assay of U1A (A) and U2B (B) binding to the 5’ and 3’ splice site of MAD2L1 gene. Regions for real time PCR amplification, corresponding to exon-intron junctions, are shown at bottom.

26