Embed Size (px)
Citation preview
1
Site directed mutagenesis of the heterotrimeric killer toxin zymocin identifies residues 1
required for early steps in toxin action 2
3
4
Sabrina Wemhoff a, Roland Klassen a* and Friedhelm Meinhardt a# 5
6
Institut für Molekulare Mikrobiologie und Biotechnologie, Westfälische Wilhelms-Universität 7
Münster, Münster, Germanya 8
9
10
Running Head: site directed mutagenesis of the killer toxin zymocin 11
12
13
#Address correspondence to Friedhelm Meinhardt, [email protected] 14
*Present address: Roland Klassen, Institut für Biologie, Fachgebiet Mikrobiologie, Universität 15
Kassel, Kassel, Germany 16
17
18
19
20
21
22
23
24
25
26
27
28
AEM Accepts, published online ahead of print on 15 August 2014Appl. Environ. Microbiol. doi:10.1128/AEM.02197-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
2
ABSTRACT 29
Zymocin is a Kluyveromyces lactis protein toxin composed of αβγ subunits encoded by the 30
cytoplasmic virus like element k1 and functions by αβ assisted delivery of the anticodon 31
nuclease (ACNase) γ into target cells. The toxin binds to cells’ chitin and exhibits chitinase 32
activity in vitro that might be important during γ import. Saccharomyces cerevisiae strains 33
carrying k1-derived hybrid elements deficient in either αβ (k1ORF2) or γ (k1ORF4) were 34
generated. Loss of either gene abrogates toxicity and unexpectedly, Orf2 secretion depends on 35
Orf4 co-secretion. Functional zymocin assembly can be restored by nuclear expression of 36
k1ORF2 or k1ORF4, providing an opportunity to conduct site directed mutagenesis of holo-37
zymocin. Complementation required active site residues of α’s chitinase domain and the sole 38
cysteine residue of β (Cys250). Since βγ are reportedly disulfide linked, the requirement for 39
the conserved γ C231 was probed. Toxicity of intracellularly expressed γ C231A indicated no 40
major defect in ACNase activity; while complementation of k1ΔORF4 by γ C231A was lost, 41
consistent with a role of β C250 and γ C231 in zymocin assembly. To test the capability of αβ 42
to carry alternative cargos, the heterologous ACNase from Pichia acaciae (PaOrf2) was 43
expressed along with its immunity gene in k1ΔORF4. While efficient secretion of PaOrf2 was 44
detected, suppression of the k1ΔORF4-derived k1Orf2 secretion defect was not observed. 45
Thus, the dependency of k1Orf2 on k1Orf4 co-secretion needs to be overcome prior to 46
studying αβ’s capability to deliver other cargo proteins into target cells. 47
48
KEYWORDS 49
Killer yeast, virus like element, zymocin, ACNase, chitinase 50
51
52
53
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
3
INTRODUCTION 54
The protein toxin zymocin produced by the yeast Kluyveromyces lactis was identified as the 55
first known anticodon nuclease toxin from a eukaryote, selectively cleaving tRNA within the 56
anticodon loop due to a highly specific anticodon nuclease (ACNase) activity (1). Zymocin 57
production is correlated with the presence of a pair of linear cytoplasmic genetic dsDNA 58
elements, termed pGKL1 (k1 in short) and pGKL2 (k2 in short) (2). The larger k2 is required 59
for cytoplasmic maintenance of k1, which encodes the toxin as well as an immunity 60
determinant (2, 3). k2 provides essential functions for cytoplasmic replication, transcription 61
and transcript processing and several of these components show phylogenetic proximity to 62
viruses (4, 5). Since the proposed mode of replication via protein priming is typically found in 63
viruses, the cytoplasmic linear dsDNA elements were termed virus like elements (VLE) (6). 64
The zymocin toxin is a heterotrimeric αβγ complex, the smallest subunit of which (γ) exhibits 65
the cytotoxic ACNase activity (1, 7-9). The α and β subunits are generated from the 128 kDa 66
k1ORF2 gene product which is first translocated to the ER where it becomes glycosylated and 67
cleaved by signal peptidase and then travels to the Golgi apparatus, where it is processed by 68
the Kex1/2 endopeptidase internally at the N-terminal end to produce mature α (99 kDa) and 69
β (30 kDa) subunits (7, 9-11). In the active, secreted holotoxin, β appears to be linked via a 70
disulfide bond to the toxic γ subunit (7, 9). The latter is unable to act on target cells on its own 71
since it relies on the chitin binding α subunit and the hydrophobic β subunit to transit into the 72
target cell (8, 9). The process of ACNase cargo drop off by the αβ carrier is poorly 73
understood, but possibly involves chitin binding and degradation mediated by the chitinase 74
active site located within the α subunit (12, 13). The existence of conserved αβ-related carrier 75
subunits in other VLE encoded protein toxins, which shuttle cargo proteins that are dissimilar 76
in primary sequence and/or target RNA may suggest a general protein translocase ability of αβ 77
(14-16). However, mechanistic studies of zymocin action have been largely restricted to the 78
isolated γ subunit since no system to generate altered variants of holo-zymocin was available, 79
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
4
which is in part due to the complex genetic basis of cytoplasmic k1/k2 elements that cannot be 80
manipulated by standard approaches applicable to nuclear genes. To overcome this problem, 81
we have now generated k1/k2 carrying zymocin expression strains in which either the gene 82
encoding the αβ subunits (k1ORF2) or the gene encoding the γ subunit (k1ORF4) is deleted 83
and altered variants of the missing genes can be supplied from standard nuclear expression 84
vectors. As this system enables the rapid generation of holo-zymocin variants containing site 85
specific exchanges, functional studies can be conducted. We demonstrate the usefulness of 86
this mutagenesis system by analysing the interdependence of αβ and γ subunits for efficient 87
toxin secretion and the importance of chitinase active sites as well as potential disulfide bond 88
forming cysteine residues for holotoxin function. 89
90
MATERIAL AND METHODS 91
Strains and media 92
Yeast strains employed in this study are listed in Table 1. Strains were grown in YPD (2% 93
glucose, 2% peptone and 1% yeast extract) or YNB (0.67% YNB w/o AA, Carbohydrate & 94
w/AS and 2% glucose) supplemented with L-leucine (30 µg/ml), L-histidine (20 µg/ml), L-95
tryptophan (20 µg/ml) or uracil (20 µg/ml) at 30 °C. 96
97
Isolation of DNA and linear plasmids 98
Bulk DNA and linear plasmids were isolated as previously described (17) or by the mini-99
lysate method which includes a proteinase K treatment (18). 100
101
DNA manipulation, cloning and transformation 102
Restriction and DNA ligations were performed with enzymes obtained from New England 103
BioLabs GmbH (Frankfurt am Main, Germany) according to the supplier’s recommendations. 104
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
5
E. coli was transformed following standard procedures (19). Yeast transformation was 105
performed following the PEG/lithium-acetate method (20). 106
107
Curing 108
As yeast cells carrying linear cytoplasmic plasmids can efficiently be cured by UV irradiation 109
(21, 22); approximately 2x103 cells of S. cerevisiae 301 grown overnight in YPD at 30 °C 110
were plated on YPD agar and exposed to UV-light essentially as described previously (23, 111
24). Following incubation for 24 h at 30 °C, arising colonies of S. cerevisiae 301 ΔpGKL 112
were analyzed for the presence of linear elements by gel electrophoresis and Southern 113
analysis. 114
115
Killer toxin assays 116
For eclipse assays (25), killer strains were point inoculated on YPD at pH 6.5. After 117
incubation for 16 h at room temperature, an overnight culture of a sensitive yeast strain was 118
diluted with sterile water to yield an OD600 of 0.1 from which a 10 µl sample was spotted onto 119
the medium directly at the rim of the colony of the putative killer strain. After incubation for 120
16 h at 30 °C, growth inhibition became evident by the formation of clear halos. 121
Microtiter assays, which are more sensitive than the eclipse assays, were performed as 122
described previously (26). Briefly, yeasts were cultured in 200 ml YPD at pH 6.5 and 30 °C. 123
Partial purification of toxins was done by ultrafiltration using concentrators (Vivaspin 20; 124
Sartorius Stedim Biotech GmbH, Göttingen, Germany). Since the calculated molecular weight 125
of the chitinases encoded by the VLEs is approx. 129 kDa, centrifugal units with a 30 kDa 126
cut-off membrane were used. In case of the P. acaciae toxin (PaT, ~180 kDa), centrifugal 127
concentrators with an exclusion size of 100 kDa were applied. Sterile toxin preparations were 128
stored at 4 °C prior to use. The concentrated samples were diluted in YPD medium to give 129
final concentrations ranging from 0.1 up to 10-fold with respect to the original supernatants. 130
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
6
Thus, the relative concentration factor (RCF) of 1 corresponds to the toxin amount in non-131
concentrated culture supernatants (27, 28). After incubation for 16 h at 30 °C, relative growth 132
was determined spectrometrically at 620 nm (Multiscan FC, Thermo Fisher Scientific Oy, 133
Vantaa, Finland) and refers to the OD value of strains incubated in toxin-free YPD medium. 134
135
Southern analysis 136
Bulk DNA preparations from S. cerevisiae 301, the k1ΔORF4 mutant and the VLE-cured 137
strain ΔpGKL were separated on 0.8% agarose gels. A probe was generated from k1ORF4 138
using primers k1ORF4-for and k1ORF4-rev (see Table 3). Labeling was performed using the 139
DIG-High Prime Kit (Roche Diagnostics, Mannheim, Germany) following the manufacturer’s 140
recommendations. 141
142
Generation of a γ toxin deficient k1ΔORF4 mutant 143
For disruption of k1ORF4 (γ subunit) in S. cerevisiae 301 (F102-2 ura3) (29), the vector 144
pARS was constructed, which harbors a recombination cassette consisting of a LEU2* 145
selectable marker gene (30) governed by a cytoplasmic promoter (UCS, upstream conserved 146
sequence) and flanked by sequences of k1ORF3’ and/or k1ORF4, respectively. The 147
recombination flank (k1ORF3’/k1ORF4) was amplified via PCR applying primers RKF-148
pARS-fw-SacI and RKF-pARS-rv-KpnI/NheI. The flank was subcloned by making use of 149
KpnI and SacI sites and ligated into the likewise cut vector pBluescript SK(-), resulting in 150
vector pSK-RKF. By site-directed mutagenesis (31)(31)(31)(31)(31)(31), a SacII restriction 151
site was generated in k1ORF4 with the primers pSK-RKF-SacII-fw and pSK-RKF-SacII-rv. 152
LEU2* was amplified from vector pAR3 (32) using the primers XbaI-stop-UCS-LEU2*-fw 153
and LEU2*-rev-MCS-XbaI, along with the upstream conserved sequence (UCS). The PCR 154
product was subcloned and ligated with the EcoRV-linearized pBluescript SK(-), resulting in 155
pSK-LEU2*. LEU2* was subsequently cloned by making use of SacII and XbaI-sites into 156
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
7
pSK-RKF, resulting in vector pARS (Table 2). Prior to transformation into S. cerevisiae 301 157
(2, 29), harboring the K. lactis killer plasmids k1 and k2, the in vivo recombination cassette 158
was cut out of the latter vector with SacI and NheI. Transformants were subcultivated on YNB 159
uracil agar lacking L-leucine. Linear elements of S. cerevisiae 301 k1ΔORF4 were verified by 160
gel electrophoresis and Southern analysis. 161
162
Construction of artificial linear elements 163
For complementation of the k1ΔORF4 defect with a heterologous ACNase, the P. acaciae 164
pPac1-2 ORF2 (PO2) and ORF4 (PO4) encoding the toxic γ subunit and immunity protein, 165
respectively, were co-expressed in S. cerevisiae 301 k1ΔORF4. Both genes were amplified by 166
PCR using primers PO4-fw and PO2-rv, along with their UCS, as well as the signal peptide 167
encoding region of ORF2. The PCR product was ligated into the SmaI linearized vector 168
pBluescript SK(-), yielding pSK-PO4PO2. PO4PO2 was subsequently subcloned via SpeI and 169
XhoI digests into pARS, resulting in pARS-PO4PO2 and finally cloned via PspXI and BamHI 170
into pGTIRUTIR (33), yielding pGT-PO4PO2. 171
In parallel, to analyze protein secretion, 3HA- and 3myc-epitopes were added to the C-172
terminus of the respective PaORF4 and PaORF2 genes, respectively. Firstly, single epitopes 173
were added to these genes by PCR amplifying from vector pSK-PO4PO2 using the primers 174
PO4-HAsc-fw and PO2-MYCsc-rev. The PCR product was cloned and ligated blunt end into 175
SmaI-linearized vector pBluescript SK(-), resulting in vector pSK-PO4::HA-PO2::myc. In a 176
second step, two further epitopes were added by PCR using primers PO4-3HA-extender-for 177
and PO2-3myc-extender-rev. The PCR product was again subcloned into a SmaI linearized 178
vector pBluescript SK(-), yielding pSK-PO4PO2*. The tagged genes were subsequently 179
cloned by PspXI and BamHI digestion into vector pGTIRUTIR (33), yielding pGT-180
PO4PO2*. 181
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
8
Prior to transformation into S. cerevisiae 301 k1ΔKORF4, the artificial linear elements TU-182
PO4PO2-T and TU-PO4PO2*-T were amplified from vector pGT-PO4PO2 and pGT-183
PO4PO2*, respectively, using the primer TIR2. Transformants were selected on YNB 184
medium lacking L-leucine and uracil. Linear elements were verified by gel electrophoresis 185
and Southern analysis. 186
187
Construction of nuclear expression vectors 188
For nuclear-based expression of k1ORF4, the ADH1 promoter from S. cerevisiae BY4741 189
was PCR-amplified using primers PADH1-fw and PADH1-NdeI-rv and subcloned blunt end 190
into SmaI linearized pBluescript SK(-), yielding pSK-PADH1. k1ORF4 was amplified by 191
PCR using primers k1ORF4-NdeI-for and k1ORF4-EcoRI-rev and subsequently subcloned 192
and ligated via NdeI and EcoRI restriction into the likewise cut vector pSK-PADH1. The 193
cassette PADH1::ORF4 was cloned and ligated via XmaI and EcoRI restrictions sites into the 194
yeast expression vector YEplac195, yielding p195-PADH1::ORF4. The vector was 195
transformed into S. cerevisiae 301 k1ΔORF4 and selected on YNB medium devoid of L-196
leucine and uracil. Transformants were verified by PCR analysis. 197
198
Site directed mutagenesis 199
Amino acid exchanges in the genes encoding the αβ (k1ORF2) or γ subunit (k1ORF4) of 200
zymocin were achieved by site directed mutagenesis using the Phusion Site-Directed 201
Mutagenesis Kit from Thermo Fisher Scientific GmbH (Dreieich, Germany). Plasmids p195-202
PADH1::ORF4, p195-PADH1::ORF2 or pKL-BX, respectively, were used as templates and 203
the corresponding primers are listed in Table 3. Sequencing of the mutated vectors (Table 2) 204
was done with fluorescence labelled ddNTPs using the Big Dye® Terminator v3.1 cycle 205
sequencing kit and an ABI Prism 3730 capillary sequencer (Applied Biosystems, Foster City, 206
USA). 207
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
9
Western analysis 208
For analysis of protein secretion, cells grown in liquid YPD at 30°C were harvested and toxin 209
containing supernatants were concentrated 200-fold using ultrafiltration units with 30 kDa 210
cut-off membranes (Sartorius Stedim Biotech GmbH, Göttingen, Germany). Concentrated 211
supernatants were separated by discontinuous SDS-PAGE using 4% stacking and 10% 212
polyacrylamide gels and proteins were blotted onto polyvinylidene difluoride (PVDF) 213
membranes. Immunological detection of the α and γ subunits of zymocin were achieved by 214
applying rabbit polyclonal anti-α and anti-γ specific antibodies (13), followed by an anti-215
rabbit IgG-AP secondary antibody (Sigma, München, Germany). Detection of the γ subunit of 216
PaT (ORF2::3myc) was carried out using mouse monoclonal anti-c-myc (clone 9E10, Roche 217
Diagnostics Deutschland GmbH, Mannheim, Germany) goat anti-mouse IgG-AP secondary 218
antibody (Sigma, München, Germany). 219
220
RT-PCR 221
Transcription of k1ORF2 in the parental strain S. cerevisiae 301, the mutant k1ΔORF4 and the 222
PADH1::ORF4 complemented strain was verified by RT-PCR. Total RNA was isolated 223
according to (34) and DNase I digestion was achieved employing the RNase-Free DNase I Set 224
(New England Biolabs GmbH, Frankfurt am Main, Germany). Reverse transcription was 225
accomplished using the RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas, 226
St. Leon-Rot, Germany), following the manufacturer’s recommendations. For this purpose, 227
1 µg RNA and random hexamer primers were used. As control, identical reactions were 228
carried out without adding reverse transcriptase or with DNA. The cDNA of the 5’-end of 229
k1ORF2 was detected by PCR using primers k1ORF2s1-fw and k1ORF2s1-rv (Table 3). 230
231
232
233
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
10
RESULTS AND DISCUSSION 234
Disruption of k1ORF4 prevents zymocin production and αβ secretion 235
To generate a platform allowing for systematic mutagenesis of αβγ holo-zymocin, we 236
generated a S. cerevisiae 301 strain carrying the cytoplasmic k1/k2 pair with a disruption in 237
k1ORF4 (encoding the ACNase subunit γ toxin). Disruption was facilitated by the use of an in 238
vivo recombination vector (pARS) carrying a cytoplasmic expressible LEU2 gene (LEU2*) 239
nested between long recombination flanks (500 to 550 bp) targeting the selection marker to 240
k1ORF4 (Fig. 1A and B). The recombination cassette was removed from pARS and 241
transformed into the k1/k2 carrying S. cerevisiae 301 strain (29). Correct integration and 242
elimination of native k1 was verified by Southern analysis (Fig. 1C). 243
To investigate the consequence of k1ORF4 disruption for zymocin production, we partially 244
purified and concentrated culture supernatants from the k1/k2 S. cerevisiae parental strain, 245
from the k1ΔORF4 mutant and a VLE cured strain by ultrafiltration and analyzed these 246
preparations for zymocin killer activity using the micro dilution method. The supernatant of 247
the parental strain proved growth inhibitory to the S. cerevisiae tester strain at dilutions 248
equivalent to ~1% of the original culture fluid (relative concentration factor 0.01). Consistent 249
with the notion that zymocin toxicity relies on the cytotoxic ACNase Orf4, we found that 250
deletion of k1ORF4 results in a complete loss of toxin activity in the strains’ supernatant (Fig. 251
1D). 252
To analyze whether removal of k1ORF4 from the zymocin encoding plasmid system affects 253
secretion or processing of k1Orf2 (encoding α and β subunits of zymocin), we checked 254
supernatants from the k1/k2 parental strain and the k1ΔORF4 strain for the presence of 255
protein bands detectable by a polyclonal antibody raised against the α subunit (13). The 129 256
kDa k1Orf2 protein is processed in the original host K. lactis by the KEX protease during 257
secretion, which generates the 99 kDa α and the 30 kDa β subunit from the precursor (7, 9-258
11). The size of the protein species detectable with anti-α sera therefore allows conclusions 259
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
11
about whether or not Orf2 is processed correctly. We detected a ~100 kDa signal in the 260
supernatant of the k1/k2 carrying S. cerevisiae strain showing that Orf2 secretion and 261
processing occurs similarly as for K. lactis, which is consistent with earlier reports (9). 262
However, upon removal of k1ORF4 not only the ACNase dependent killer activity is lost, but 263
also the k1Orf2 gene product either unprocessed (129 kDa) or processed (99 kDa) is 264
undetectable (Fig. 2A). This suggests that k1Orf2 secretion itself or the stability of the protein 265
in the supernatant is severely compromised in the absence of k1Orf4. To check whether the 266
obtained results are due to a possible co-regulation of k1Orf2 and k1Orf4 expression, 267
transcription of k1ORF2 was analyzed by RT-PCR. As depicted in Fig. 2B, transcription of 268
the 5’-end of k1ORF2 takes place in the k1/k2 parental S. cerevisiae strain as well as in the 269
k1ΔORF4 strain. Such results suggest a co-secretion dependency of k1Orf2 on k1Orf4, rather 270
than a co-regulation to ensure the equimolecular production of αβ and γ subunits. 271
272
In trans complementation of k1ΔORF4 requires Orf4C231 273
We utilized the established k1ΔORF4 strain to check if (i) functional zymocin production can 274
be restored by providing wild type k1ORF4 in trans and (ii) whether this can be exploited to 275
identify functional regions of γ toxin that are essential for αβγ holotoxin assembly but 276
dispensable for the primary ACNase function. First, k1ORF4 was uncoupled from the 277
cytoplasmic promoter and fused to the constitutive ADH1 promoter and subsequently 278
expressed from a standard nuclear vector (YEplac195). Since transcription of k1ORF2 from 279
the cytoplasm was verified by RT-PCR (Fig. 2B), we then analyzed whether the k1Orf2 280
secretion defect could be restored by nuclear expression of k1ORF4. Indeed, a band of ~100 281
kDa is detected by the anti α antibody in the k1ΔORF4 strain carrying nuclear PADH1::ORF4 282
construct (Fig. 2A). Thus, the secretion or stability defect of k1Orf2 associated with the loss 283
of k1Orf4 could be restored by introduction of a nuclear expression construct for k1Orf4. In 284
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
12
parallel, microtiter assays indicated an efficient restoration of zymocin presence in the 285
supernatant (Fig. 2C). Hence, Orf4 can be provided in trans by nuclear expression of the 286
corresponding gene which efficiently restores functional zymocin production and therefore, 287
such system can be utilized to identify residues in γ toxin that are essential for holotoxin 288
function. 289
Multiple sequence alignments of VLE encoded yeast killer toxins PaT, PiT and DrT which 290
use a similar cargo import complex as for zymocin (14-16, 29) revealed the presence of a 291
single conserved Cys residue close to the C-terminus of the cargo subunit (Fig. 3A). Since it 292
was shown previously, that βγ are disulfide linked and treatment of zymocin preparations with 293
disulfide reducing agents abolishes activity, we chose to analyze the importance of this 294
residue for both, ACNase- and holotoxin function. We created a k1ORF4C231A allele 295
including the signal peptide coding region and expressed it under the control of the ADH1 296
promoter in the nucleus of the k1ΔORF4 strain. As controls, we included the empty vector, 297
unmodified PADH1::ORF4 and also a backmutation of PADH1::ORF4A231C. Culture 298
supernatants were partially purified and analyzed for the presence of killer activity. While the 299
wild type Orf4 provided in trans again restored zymocin production, Orf4C231A completely 300
lost this ability (Fig. 3B). Since zymocin production could also be restored by backmutation 301
of A231 to C, loss of activity in Orf4C231A is only due to the exchange of C231 (Fig. 3B). 302
To check whether the same exchange affects the killing efficiency of the intracellular form of 303
γ toxin, we expressed k1ORF4 and its variant constructed by replacing its promoter by the 304
conditional GAL1 promoter of S. cerevisiae and by excluding the signal peptide coding region 305
to achieve intracellular accumulation in order to mimic the γ toxin imported from outside the 306
cell. Induced intracellular expression of k1ORF4, k1ORF4C231A or k1ORF4A231C 307
indistinguishably induced full growth arrest (Fig. 3C), in agreement with a previous study 308
(35), thereby proving that the mutated variant of Orf4 is indeed translated. Thus, C231 is 309
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
13
essential for functional zymocin secretion but it does not affect the growth inhibitory 310
competency of the intracellular form of γ toxin (Fig 3). 311
312
Role of the sole cysteine residue in zymocin’s β subunit 313
To test whether, similar to k1ORF4, k1ORF2 (encoding α and β subunits of zymocin) can also 314
be deleted in the cytoplasmic k1 and subsequently provided in trans from the nucleus, we 315
utilized a strain carrying k1ΔORF2 unable to form active zymocin (29). For complementation, 316
we removed the cytoplasmic promoter from the k1ORF2 gene, replaced it with the ADH1 317
promoter and introduced the PADH1::ORF2 fusion in the nuclear vector YEplac195. The 318
k1ΔORF2 strain carrying the nuclear PADH1::ORF2 regained the ability to secrete zymocin 319
(Fig. 4), demonstrating the usefulness of such system to analyze the requirement of individual 320
sites of the k1ORF2 encoding α and β subunits for holotoxin function. It should be noted, 321
however, that the complementation efficiency of PADH1::ORF2 is reduced compared to 322
PADH1::ORF4 (Fig. 4), which is due to transcript instability in the former case and 323
accompanied by the lack of detection of alpha when expressed from the nucleus in k1ΔORF2 324
complemented with PADH1::ORF2 (data not shown). 325
Our above results revealed an essential function of the conserved γ C231 in the holotoxin 326
context, but not for the intracellular active form of the tRNAse, suggesting C231 could be 327
involved in the formation of the disulfide bridge reported to exist between β and γ (7, 9). 328
Interestingly, β contains only one cysteine residue, located at the very C-terminus of the 329
protein (Orf2C250) which is also conserved among other VLE encoded killer toxins (Fig. 330
5A). Assuming a general requirement for covalent attachment of the cargo subunit (γ) to one 331
of the carrier subunits (β), we predicted an absolute requirement for Orf2C250 to form active 332
zymocin. To test this, we exchanged Orf2C250 to Orf2C250A and expressed a 333
PADH1::ORF2C250A gene in parallel to PADH1::ORF2 from the nucleus of the k1ΔORF2 334
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
14
strain and analyzed supernatants for the presence of functional zymocin. As shown in Fig. 5B, 335
the PADH1::ORF2 wild type and the A250C backmutant, but not the C250A mutant could 336
restore zymocin production in k1ΔORF2, indeed revealing an essential role of C250, the sole 337
cysteine in the β subunit. These data underscore the assumption that the covalent attachment 338
of the cargo subunit γ to the carrier subunit β is essential for functionality of the complex. 339
This assumption is further supported by previous evidence that treatment of purified zymocin 340
with disulfide reducing agents completely abolishes its activity (9, 13). In the C250A mutant, 341
no such disulfide bridge can be formed as β becomes entirely devoid of cysteine and 342
consistently, loss of zymocin function is observed (Fig. 5B). Since γ C231 is similar to β C250 343
in locating at the very C-terminus of the protein, conserved among other VLE encoded toxins 344
and required for holotoxin function (Fig. 4), it appears likely that the cargo subunit is linked to 345
the β C250 via γ C231 (Fig. 5C) and such covalent junction is key for secretion and/or 346
toxicity. 347
348
The chitinase active site is essential for zymocin function 349
The α subunit of zymocin carries a chitinase domain equipped with a chitinase family 18 350
active site (Fig. 6A). It was shown previously, that the α subunit exhibits chitinase activity 351
which can be inhibited by allosamidin (12). Since increased allosamidin dose in bioassays 352
with zymocin led to a decreased toxin activity, the involvement of chitin degradation in the 353
process of cargo (γ) import was assumed (12). However, even at the highest concentration of 354
allosamidin, which led to the complete inhibition of the chitinase activity in vitro, some 355
growth inhibitory activity in vivo was observed, leaving some doubt on the essentiality of the 356
chitinase activity for toxin function. Since our in trans complementation system for k1ΔORF2 357
provides a very sensitive read out for the functionality of mutated variants of α and β, and 358
since the chitinase family 18 active site is well characterized, we checked the relevance of 359
chitinase catalytic residues within the α subunit for functionality of the complex. Thus, the 360
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
15
three highly conserved residues of the chitinase active site motif (DXDXE) of the α subunit 361
were converted to alanine (D462A, D464A, E466A, D464A-E466A) and the genes were 362
expressed by fusion to the ADH1 promoter in the k1ΔORF2 mutant. Supernatants from the 363
strain complemented with the wild type k1ORF2 gene and all active site substitutions were 364
concentrated and analyzed for zymocin activity. Only the wild type control displayed 365
detectable zymocin activity in the supernatant whereas all substitutions analyzed were unable 366
to produce functional zymocin, as also verified by eclipse assays (Fig 6B). Thus, rather than 367
contributing to the toxin’s efficiency, the chitinase active site of the α subunit is essential for 368
toxin function. Since zymocin activity could be restored by backmutations, loss of activity is 369
only due to the exchange of the corresponding residues (data not shown). However, it cannot 370
be excluded that the chitinase active site mutations may affect the stability of the protein. The 371
results support the assumption that chitin degradation is a prerequisite for import of the toxic γ 372
subunit. Interestingly, chitin is localized as a thin layer on top of the plasma membrane, 373
suggesting that its degradation could be intimately linked to membrane perforation and 374
passage of γ into the cytoplasm. The complementation system established in this work will 375
provide a valuable tool to further study early steps in zymocin action, for example by 376
generating immunologically detectable or fluorescently tagged versions of individual zymocin 377
subunit. 378
379
The k1Orf2 secretion defect in k1∆ORF4 cannot be restored by a heterologous ACNase 380
Since the αβ like subunits of the known killer VLEs are highly conserved with respect to their 381
chitin binding and chitinase domains (Fig. 6A), as well as the conserved cysteine residues at 382
the C-terminus of the interacting β and γ subunits (Fig. 3A and 5A), we wondered if the αβ 383
subunits carry and deliver not only their cognate cargo protein but a heterologous subunit of 384
another known killer system. We utilized the k1∆ORF4 strain to introduce the toxic ACNase 385
subunit (PaOrf2) from the related Pichia acaciae killer system along with its immunity gene 386
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
16
(PaOrf4) (15, 36). The latter two were expressed cytoplasmically using the in vitro 387
constructed element TU-PO4PO2-T (see materials and methods) and the presence of the 388
linear elements was verified by gel electrophoresis (Fig. 7A). In addition, PaOrf2 was 389
expressed as a C-terminal 3myc-tagged variant to follow secretion of the protein in the 390
k1ΔORF4 and k1ΔORF2 strain. Western analysis of concentrated supernatants revealed that 391
PaOrf2-Myc was efficiently secreted in the k1∆ORF4 strain (Fig. 7D); however, no toxin 392
activity could be detected (Fig. 7B), while PaOrf4 provided immunity towards exogenously 393
applied PaT (Fig. 7C). Since we have shown that k1Orf2 normally requires k1Orf4 for 394
efficient secretion, lack of toxicity might be attributed to an inability to form an active hybrid 395
toxin complex or to the absence of k1Orf2 secretion. To test these two alternatives, we 396
analyzed whether PaOrf2-Myc is capable of restoring k1Orf2 secretion in the k1∆ORF4 397
strain. As a control, we introduced the PADH1::ORF4 construct shown before to restore 398
k1Orf2 secretion. As shown in Fig. 7D, k1Orf4, but not PaOrf2-Myc is capable of restoring 399
k1Orf2 secretion. Thus, absence of functional hybrid toxin activity is likely attributed to the 400
complete absence of k1Orf2 secretion and not necessarily due to a general inability to form 401
such hybrid toxin. However, it cannot be excluded that the lack of proper assembly renders 402
secretion interdependent. 403
Future work will be required to define the dependency of k1Orf2 secretion on k1Orf4 co-404
secretion. It was also shown that also k1Orf4 secretion is severely impaired in the absence of 405
k1Orf2 (10), which might suggest that an interaction between k1Orf2 and k1Orf4 is required 406
at a specific step during the secretory pathway for efficient secretion of either protein. Final 407
zymocin assembly, however, is apparently dispensable for subunit secretion as kex1/2 408
mutations inhibit k1Orf2 processing in the Golgi and secretion of αβ, but do not affect the 409
secretion of the γ subunit (8). The ACNase subunit PaOrf2 apparently differs from k1Orf4 in 410
that it is secreted efficiently in the k1ΔORF2 strain without the need for an αβ precursor (Fig. 411
7D). It remains to be studied, however, whether the αβ like PaOrf1 depends on PaOrf2 for co-412
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
17
secretion. Interestingly, fusion of the α mating factor pre-pro sequence which harbours a 413
Kex1/2 processing site to the N-terminus of k1Orf4 enabled secretion of the γ toxin 414
independently of k1Orf2 co-secretion (8). Thus, modification of the k1Orf2 N-terminus may 415
represent an analogous strategy to overcome the secretion blockade of k1Orf2 in absence of 416
k1Orf4. Restoring k1Orf4 independent secretion of the αβ subunits will likely be a 417
requirement to further investigate the specificity of the carrier subunit for cognate or 418
alternative cargo proteins. 419
420
REFERENCES 421
422
1. Lu J, Huang B, Esberg A, Johansson MJ, Byström AS. 2005. The Kluyveromyces 423
lactis γ-toxin targets tRNA anticodons. RNA 11:1648-1654. 424
2. Gunge N, Sakaguchi K. 1981. Intergeneric transfer of deoxyribonucleic acid killer 425
plasmids, pGKl1 and pGKl2, from Kluyveromyces lactis into Saccharomyces 426
cerevisiae by cell fusion. J Bacteriol 147:155-160. 427
3. Tokunaga M, Wada N, Hishinuma F. 1987. A novel yeast secretion vector utilizing 428
secretion signal of killer toxin encoded on the yeast linear DNA plasmid pGKL1. 429
Biochem Biophys Res Commun 144:613-619. 430
4. Meinhardt F, Klassen R. 2007. Microbial Linear Plasmids. In Meinhardt F, Klassen 431
R (ed.), Microbiology Monographs, vol. 7. Springer-Verlag Berlin Heidelberg. 432
5. Satwika D, Klassen R, Meinhardt F. 2012. Anticodon nuclease encoding virus-like 433
elements in yeast. Appl Microbiol Biotechnol 96:345-356. 434
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
18
6. Jeske S, Meinhardt F, Klassen R. 2007. Extranuclear Inheritance: Virus-Like DNA-435
Elements in Yeast, p. 98-129. In Esser K, Lüttge U, Beyschlag W, Murata J (ed.), 436
Progress in Botany vol. 68. Springer, Berlin Heidelberg. 437
7. Stark MJR, Boyd A. 1986. The killer toxin of Kluyveromyces lactis - characterization 438
of the toxin subunits and identification of the genes which encode them. Embo J 439
5:1995-2002. 440
8. Tokunaga M, Kawamura A, Hishinuma F. 1989. Expression of pGKL killer 28K 441
subunit in Saccharomyces cerevisiae: identification of 28K subunit as a killer protein. 442
Nucleic Acids Res 17:3435-3446. 443
9. Stark MJ, Boyd A, Mileham AJ, Romanos MA. 1990. The plasmid-encoded killer 444
system of Kluyveromyces lactis: a review. Yeast 6:1-29. 445
10. Tokunaga M, Kawamura A, Kitada K, Hishinuma F. 1990. Secretion of killer 446
toxin encoded on the linear DNA plasmid pGKL1 from Saccharomyces cerevisiae. J 447
Biol Chem 265:17274-17280. 448
11. Wesolowski-Louvel M, Tanguy-Rougeau C, Fukuhara H. 1988. A nuclear gene 449
required for the expression of the linear DNA-associated killer system in the yeast 450
Kluyveromyces lactis. Yeast 4:71-81. 451
12. Butler AR, O'Donnell RW, Martin VJ, Gooday GW, Stark MJ. 1991. 452
Kluyveromyces lactis toxin has an essential chitinase activity. Eur J Biochem 199:483-453
488. 454
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
19
13. Jablonowski D, Fichtner L, Martin VJ, Klassen R, Meinhardt F, Stark MJ, 455
Schaffrath R. 2001. Saccharomyces cerevisiae cell wall chitin, the Kluyveromyces 456
lactis zymocin receptor. Yeast 18:1285-1299. 457
14. Kast A, Klassen R, Meinhardt F. 2014. rRNA fragmentation induced by a yeast 458
killer toxin. Mol Microbiol 91:606-617. 459
15. Klassen R, Paluszynski JP, Wemhoff S, Pfeiffer A, Fricke J, Meinhardt F. 2008. 460
The primary target of the killer toxin from Pichia acaciae is tRNA(Gln). Mol 461
Microbiol 69:681-697. 462
16. Klassen R, Teichert S, Meinhardt F. 2004. Novel yeast killer toxins provoke S-463
phase arrest and DNA damage checkpoint activation. Mol Microbiol 53:263-273. 464
17. Stam JC, Kwakman J, Meijer M, Stuitje AR. 1986. Efficient isolation of the linear 465
DNA killer plasmid of Kluyveromyces lactis: evidence for location and expression in 466
the cytoplasm and characterization of their terminally bound proteins. Nucleic Acids 467
Res 14:6871-6884. 468
18. Schaffrath R, Stark MJ, Gunge N, Meinhardt F. 1992. Kluyveromyces lactis killer 469
system: ORF1 of pGKL2 has no function in immunity expression and is dispensable 470
for killer plasmid replication and maintenance. Curr Genet 21:357-363. 471
19. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning: A Laboratory 472
Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 473
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
20
20. Gietz RD, Schiestl RH, Willems AR, Woods RA. 1995. Studies on the 474
transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 475
11:355-360. 476
21. Gunge N, Takahashi S, Fukuda K, Ohnishi T, Meinhardt F. 1994. UV 477
hypersensitivity of yeast linear plasmids. Curr Genet 26:369-373. 478
22. Niwa O, Sakaguchi K, Gunge N. 1981. Curing of the killer deoxyribonucleic acid 479
plasmids of Kluyveromyces lactis. J Bacteriol 148:988-990. 480
23. Klassen R, Jablonowski D, Schaffrath R, Meinhardt F. 2002. Genome organization 481
of the linear Pichia etchellsii plasmid pPE1A: evidence for expression of an 482
extracellular chitin-binding protein homologous to the α-subunit of the 483
Kluyveromyces lactis killer toxin. Plasmid 47:224-233. 484
24. Klassen R, Meinhardt F. 2002. Linear plasmids pWR1A and pWR1B of the yeast 485
Wingea robertsiae are associated with a killer phenotype. Plasmid 48:142-148. 486
25. Kishida M, Tokunaga M, Katayose Y, Yajima H, Kawamura-Watabe A, 487
Hishinuma F. 1996. Isolation and genetic characterization of pGKL killer-insensitive 488
mutants (iki) from Saccharomyces cerevisiae. Biosci Biotechnol Biochem 60:798-801. 489
26. Klassen R, Meinhardt F. 2007. Linear Protein-Primed Replicating Plasmids in 490
Eukaryotic Microbes p. 187-226. In Meinhardt F, Klassen R (ed.), Microbiology 491
Monographs, vol. 7. Springer, Berlin Heidelberg. 492
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
21
27. Muccilli S, Wemhoff S, Restuccia C, Meinhardt F. 2013. Exoglucanase encoding 493
genes from three Wickerhamomyces anomalus killer strains isolated from olive brine. 494
Yeast 30:33-43. 495
28. Klassen R, Wemhoff S, Krause J, Meinhardt F. 2011. DNA repair defects sensitize 496
cells to anticodon nuclease yeast killer toxins. Mol Genet Genomics 285:185-195. 497
29. Paluszynski JP, Klassen R, Meinhardt F. 2007. Pichia acaciae killer system: 498
genetic analysis of toxin immunity. Appl Environ Microbiol 73:4373-4378. 499
30. Kämper J, Meinhardt F, Gunge N, Esser K. 1989. New recombinant linear DNA-500
elements derived from Kluyveromyces lactis killer plasmids. Nucleic Acids Res 501
17:1781. 502
31. Weiner MP, Costa GL, Schoettlin W, Cline J, Mathur E, Bauer JC. 1994. Site-503
directed mutagenesis of double-stranded DNA by the polymerase chain reaction. Gene 504
151:119-123. 505
32. Schickel J, Helmig C, Meinhardt F. 1996. Kluyveromyces lactis killer system: 506
analysis of cytoplasmic promoters of the linear plasmids. Nucleic Acids Res 24:1879-507
1886. 508
33. Bennett AM, Norris AR, Limnander de Nieuwenhove A, Russell PJ. 2002. 509
Replication of a linear mini-chromosome with terminal inverted repeats from the 510
Kluyveromyces lactis linear DNA plasmid k2 in the cytoplasm of Saccharomyces 511
cerevisiae. Plasmid 48:13-23. 512
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
22
34. Klassen R, Fricke J, Pfeiffer A, Meinhardt F. 2008. A modified DNA isolation 513
protocol for obtaining pure RT-PCR grade RNA. Biotechnol Lett 30:1041-1044. 514
35. Keppetipola N, Jain R, Meineke B, Diver M, Shuman S. 2009. Structure-activity 515
relationships in Kluyveromyces lactis gamma-toxin, a eukaryal tRNA anticodon 516
nuclease. Rna 15:1036-1044. 517
36. Klassen R, Kast A, Wunsche G, Paluszynski JP, Wemhoff S, Meinhardt F. 2014. 518
Immunity factors for two related tRNA(Gln) targeting killer toxins distinguish cognate 519
and non-cognate toxic subunits. Curr Genet 60:213-222. 520
37. Kämper J, Esser K, Gunge N, Meinhardt F. 1991. Heterologous gene expression on 521
the linear DNA killer plasmid from Kluyveromyces lactis. Curr Genet 19:109-118. 522
38. Worsham PL, Bolen PL. 1990. Killer toxin production in Pichia acaciae is 523
associated with linear DNA plasmids. Curr Genet 18:77-80. 524
39. van Dijken JP, Bauer J, Brambilla L, Duboc P, Francois JM, Gancedo C, 525
Giuseppin ML, Heijnen JJ, Hoare M, Lange HC, Madden EA, Niederberger P, 526
Nielsen J, Parrou JL, Petit T, Porro D, Reuss M, van Riel N, Rizzi M, Steensma 527
HY, Verrips CT, Vindelov J, Pronk JT. 2000. An interlaboratory comparison of 528
physiological and genetic properties of four Saccharomyces cerevisiae strains. 529
Enzyme Microb Technol 26:706-714. 530
40. Gietz RD, Sugino A. 1988. New yeast-Escherichia coli shuttle vectors constructed 531
with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 532
74:527-534. 533
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
23
FIGURE LEGENDS 534
FIG. 1 Disruption of k1ORF4 prevents zymocin activity. A Recombination vector pARS for 535
k1ORF4 disruption: ampR - ampicillin resistance gene, ColE1 ori - E. coli origin of 536
replication, ORF3 - immunity gene of k1, ORF4 - γ toxin gene of k1, LEU2* - cytoplasmic 537
expressible LEU2 gene of S. cerevisiae. B Scheme for targeted gene disruption of k1ORF4 by 538
in vivo recombination. The genetic organisation of k1 is represented prior to and after 539
integration of the respective recombination cassette harboring the cytoplasmic LEU2* gene 540
flanked by ORF3 and/or ORF4, ultimately yielding k1ΔORF4. C Agarose gel electrophoresis 541
and Southern analysis performed with DNA from the parental strain (wt), the k1ΔORF4 542
mutant and the VLE-cured strain (cured) using a k1ORF4 probe. The linear elements k1 (8.9 543
kb), k2 (13.8 kb) and k1ΔORF4 (10.3 kb), hmw (high molecular weight DNA) and dsRNA-L 544
(4.6 kb) are indicated. M: GeneRulerTM 1 kb DNA ladder (Thermo Fisher Scientific, Dreieich, 545
Germany). D Zymocin killer assay with partially purified and concentrated culture 546
supernatants of the above strains against the susceptible S. cerevisiae CEN.PK2-1c. 547
548
FIG. 2 Compromised secretion of k1Orf2 in the absence of k1Orf4. A Concentrated 549
supernatants of the parental strain S. cerevisiae 301 (wt), the k1ΔORF4 mutant and the 550
PADH1::ORF4 complemented strain (k1ΔORF4 ORF4) were tested by Western analysis 551
using polyclonal antibodies raised against the α subunit and anti-rabbit secondary antibodies. 552
Loading control: Coomassie stained supernatants used for detection of anti α. B RT-PCR 553
analysis of k1ORF2 transcription. Reverse transcription of the 5’-end of k1ORF2-mRNA and 554
detection of cDNA by PCR. DNA: genomic DNA used as template, -/+RT: reaction with 555
DNA-free RNA and without or with reverse transcriptase. C Microtiter assay with partially 556
purified and concentrated supernatants of the above strains tested against S. cerevisiae 557
CEN.PK2-1c. 558
559
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
24
FIG. 3 Cys231 mutational effects on holotoxin and primary ACNase function. A Multiple 560
sequence alignments of VLE encoded γ toxin subunits. Black shading with reverse lettering 561
(100% conserved), gray shading with reverse lettering (80% or more conserved), gray shading 562
with black lettering (60% or more conserved), and no shading (less than 60% conserved). 563
GenBank accession numbers: Kluyveromyces lactis pGKL1 ORF4 (YP_001648060), 564
Pichia inositovora pPin1-3 ORF4 (CAD91887.1), Pichia acaciae pPac1-2 ORF2 565
(CAE84960.1), Debaryomyces robertsiae pWR1A ORF3 (CAE84956.1). The conserved 566
Cys231 is boxed. B Effects of Cys231 mutations on holotoxin function. Microtiter assays 567
were performed with partially purified and concentrated supernatants of k1ΔORF4, the 568
PADH1::ORF4 complemented strain (PADH1::ORF4) and the PADH1::ORF4C231A 569
(C231A) or PADH1::ORF4A231C (A231C) mutants. Killer assays were executed against 570
S. cerevisiae CEN.PK2-1c. C Effects of Cys231 mutations on intracellular γ toxin activity. 10-571
fold serial dilutions of S. cerevisiae CEN.PK2-1c cells expressing intracellularly the wild type 572
γ toxin (PGAL1::ORF4) or the toxin mutants C231A and A231C under a galactose-inducible 573
promoter were tested on YNB supplemented with glucose or galactose for induction. As 574
control, a strain harboring an empty vector (control) was used. 575
576
FIG. 4 Functional complementation of k1ΔORF2 and k1ΔORF4 mutations. Microtiter assays 577
were done in YPD with partially purified and concentrated supernatants of the k1/k2 parental 578
strain S. cerevisiae 301 (wt), the k1ΔORF4 mutant, the PADH1::ORF4 complemented strain 579
(k1ΔORF4 ORF4), the k1ΔORF2 mutant and the PADH1::ORF2 complemented strain 580
(k1ΔORF2 ORF2). Eclipse assays were performed on YPD with the above strains against 581
S. cerevisiae CEN.PK2-1c. 582
583
FIG. 5 Cys250 mutational effects on holotoxin function. A Multiple sequence alignments of 584
VLE encoded β like subunits. Black shading with reverse lettering (100% conserved), gray 585
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
25
shading with reverse lettering (80% or more conserved), gray shading with black lettering 586
(60% or more conserved), and no shading (less than 60% conserved). GenBank accession 587
numbers: K. lactis pGKL1 ORF2 (YP_001648058), P. inositovora pPin1-3 ORF3 588
(CAD91890.1), P. acaciae pPac1-2 ORF1 (CAE84958.1) and D. robertsiae pWR1A ORF2 589
(CAE84954.1). The conserved Cys250 is boxed. B Effects of Cys250 mutations on holotoxin 590
function. Microtiter assays were performed with partially purified and concentrated 591
supernatants of k1ΔORF2, the PADH1::ORF2 complemented strain (PADH1::ORF2) and the 592
PADH1::ORF4C250A (C250A) or PADH1::ORF4A250C (A250C) mutants. Killer assays 593
were executed against S. cerevisiae CEN.PK2-1c. C Scheme of the heterotrimeric killer toxin 594
zymocin. Structural integrity is maintained by intramolecular disulfide bonds within the α 595
subunit and intermolecular disulfide bonds between β C250 and γ C231. The active center of 596
the chitinase is indicated. LysM-, chitin binding and glycosyl hydrolase family 18 motifs are 597
differently grey shaded. Transmembrane domains are depicted as hatched boxes. 598
599
FIG. 6 Chitinase active site residues are essential for zymocin function. A Multiple sequence 600
alignments of VLE encoded chitinase like subunits. Black shading with reverse lettering 601
(100% conserved), gray shading with reverse lettering (80% or more conserved), gray shading 602
with black lettering (60% or more conserved), and no shading (less than 60% conserved). 603
GenBank accession numbers: K. lactis pGKL1 ORF2 (YP_001648058), P. inositovora pPin1-604
3 ORF3 (CAD91890.1), P. acaciae pPac1-2 ORF1 (CAE84958.1) and D. robertsiae pWR1A 605
ORF2 (CAE84954.1). Family 18 chitinase active sites (DXXDXDXE; [DN]-G-[LIVMF]-606
[DN]-[LIVMF]-[DN]-X-E) are highlighted by boxes and shown above in bold letters. B 607
Microtiter assays were performed in YPD with partially purified and concentrated 608
supernatants of the k1ΔORF2 mutant, the PADH1::ORF2 complemented strain and the toxin 609
mutants D462A, D464A, E466A and D464A-E466A. Eclipse assays were done on YPD agar. 610
Killer assays were executed against S. cerevisiae CEN.PK2-1c. Mutations of D462, D464 and 611
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
26
E466 in the chitinase active site (DXDXE motif, α subunit) completely abolished killing 612
activities. 613
614
FIG. 7 The k1∆ORF4 defect cannot be restored by a heterologous ACNase from P. acaciae. 615
A Schematic diagram of the in vitro constructed TU-PO4PO2-T element encoding the γ toxin 616
and immunity factor from P. acaciae. ScURA3*: cytoplasmic expressible URA3 gene of 617
S. cerevisiae, TIR: terminal inverted repeats, ●: 5’-terminal protein. Agarose gel 618
electrophoresis showing different genetic materials in the k1/k2 parental strain S. cerevisiae 619
301 (wt), the k1ΔORF4 mutant and the k1ΔORF4 PO4PO2 strain expressing the αβ subunits 620
from K. lactis and the γ toxin and immunity protein from P. acaciae. hmw: high molecular 621
weight DNA. B Microtiter assays were performed in YPD with partially purified and 622
concentrated supernatants of the above strains. As sensitive test strain S. cerevisiae CEN.PK2-623
1c was applied. C In parallel, the strains were tested against the P. acaciae toxin (PaT). D 624
Concentrated supernatants of k1ΔORF4, the PADH1::ORF4 complemented mutant, the 625
k1ΔORF4 PO4PO2* strain, the k1ΔORF2 mutant and the k1ΔORF2 PO4PO2* strain were 626
tested by Western analysis using antibodies raised against the α subunit of zymocin or the 627
3myc epitope of the tagged γ toxin of PaT (γ PaT-Myc). Anti-rabbit or anti-mouse secondary 628
antibodies were used. Loading control: Coomassie stained concentrated supernatants. 629
630
631
632
633
634
635
636
637
638
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
27
TABLE 1 Strains used in this study. 639
Strain Genotype Reference
Kluyveromyces lactis AWJ137 pGKL1+ (k1) , pGKL2+ (k2) (37)
Pichia acaciae NRRL Y-18665 pPac1-1+, pPac1-2+ (38)
Saccharomyces cerevisiae BY4741 MATa, his3Δ1, leu2Δ0, met15Δ0, ura3Δ0 EUROSCARF
Saccharomyces cerevisiae CEN.PK2-1c MATa, ura 3-52, leu2-3,112, his3Δ1, trp1-289, MAL-2-8c, SUC2
(39)
Saccharomyces cerevisiae CEN.PK2-1c pYEX-BX as S. cerevisiae CEN.PK2-1c with pYEX-BX This work
Saccharomyces cerevisiae CEN.PK2-1c PGAL1::ORF4 as S. cerevisiae CEN.PK2-1c with pKL-BX This work
Saccharomyces cerevisiae CEN.PK2-1c PGAL1::ORF4C231A
as S. cerevisiae CEN.PK2-1c with pKL-BX-C231A This work
Saccharomyces cerevisiae CEN.PK2-1c PGAL1::ORF4A231C
as S. cerevisiae CEN.PK2-1c with pKL-BX-A231C This work
Saccharomyces cerevisiae 301 (F102-2 ura3) MATα, his4-519, leu2-3,112, can1, ura3, k1 (pGKL1+), k2 (pGKL2+)
(29)
Saccharomyces cerevisiae 301 ΔpGKL as S. cerevisiae 301, plasmid cured, k1-, k2- (29)
Saccharomyces cerevisiae 301 k1ΔORF4 as S. cerevisiae 301, k1ΔORF4, k2 This work
Saccharomyces cerevisiae 301 k1ΔORF4 YEplac195 as S. cerevisiae 301 k1ΔORF4 with YEplac195 This work
Saccharomyces cerevisiae 301 k1ΔORF4 PADH1::ORF4
as S. cerevisiae 301 k1ΔORF4 with p195-PADH1::ORF4
This work
Saccharomyces cerevisiae 301 k1ΔORF4 PADH1::ORF4C231A
as S. cerevisiae 301 k1ΔORF4 with p195-PADH1::ORF4-C231A
This work
Saccharomyces cerevisiae 301 k1ΔORF4 PADH1::ORF4A231C
as S. cerevisiae 301 k1ΔORF4 with p195-PADH1::ORF4-A231C
This work
Saccharomyces cerevisiae 301 k1ΔORF4 PO4PO2 as S. cerevisiae 301 k1ΔORF4 with TU-PO4PO2-T This work
Saccharomyces cerevisiae 301 k1ΔORF4 PO4PO2* as S. cerevisiae 301 k1ΔORF4 with TU-PO4PO2*-T This work
Saccharomyces cerevisiae 301 k1ΔORF2 (MS1608) as S. cerevisiae 301, k1ΔORF2, k2 (29)
Saccharomyces cerevisiae 301 k1ΔORF2 YEplac195 as S. cerevisiae 301 k1ΔORF2 with YEplac195 This work
Saccharomyces cerevisiae 301 k1ΔORF2 PADH1::ORF2
as S. cerevisiae 301 k1ΔORF2 with p195-PADH1::ORF2
This work
Saccharomyces cerevisiae 301 k1ΔORF2 PADH1::ORF2D462A
as S. cerevisiae 301 k1ΔORF2 with p195-PADH1::ORF2-D462A
This work
Saccharomyces cerevisiae 301 k1ΔORF2 PADH1::ORF2A462D
as S. cerevisiae 301 k1ΔORF2 with p195-PADH1::ORF2-A462D
This work
Saccharomyces cerevisiae 301 k1ΔORF2 PADH1::ORF2D464A
as S. cerevisiae 301 k1ΔORF2 with p195-PADH1::ORF2-D464A
This work
Saccharomyces cerevisiae 301 k1ΔORF2 PADH1::ORF2A464D
as S. cerevisiae 301 k1ΔORF2 with p195-PADH1::ORF2-A464D
This work
Saccharomyces cerevisiae 301 k1ΔORF2 PADH1::ORF2E466A
as S. cerevisiae 301 k1ΔORF2 with p195-PADH1::ORF2-E466A
This work
Saccharomyces cerevisiae 301 k1ΔORF2 PADH1::ORF2A466E
as S. cerevisiae 301 k1ΔORF2 with p195-PADH1::ORF2-A466E
This work
Saccharomyces cerevisiae 301 k1ΔORF2 PADH1::ORF2D464AE466A
as S. cerevisiae 301 k1ΔORF2 with p195-PADH1::ORF2-D464A-E466A
This work
Saccharomyces cerevisiae 301 k1ΔORF2 PADH1::ORF2A464D-A466E
as S. cerevisiae 301 k1ΔORF2 with p195-PADH1::ORF2-A464D-A466E
This work
Saccharomyces cerevisiae 301 k1ΔORF2 PADH1::ORF2C250A
as S. cerevisiae 301 ΔKO2 with p195-PADH1::ORF2-C250A
This work
Saccharomyces cerevisiae 301 k1ΔORF2 PADH1::ORF2A250C
as S. cerevisiae 301 ΔKO2 with p195-PADH1::ORF2-A250C
This work
640
641
642
643
644
645
646
647
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
28
TABLE 2 Plasmids used in this study. 648
Plasmid Genotype Reference
pYEX-BX E. coli ori, 2 µ, AmpR, leu2-d, URA3 (15)
pKL-BX pYEX-BX with PGAL1::ORF4 (15)
pKL-BX-C231A pKL-BX with PGAL1::ORF4C231A this work
pKL-BX-A231A pKL-BX with PGAL1::ORF4A231C this work
pGTIRUTIR E. coli ori, TIR, URA3 from S. cerevisiae, TIR, ampR (33)
pGT-PO4PO2 pGTIRUTIR with P. acaciae pPac1-2 ORF2 and ORF4 this work
pGT-PO4PO2* pGTIRUTIR with P. acaciae pPac1-2 ORF4::3HA and ORF2::3myc
this work
pBluescript SK(-) ColE1ori, ampR, lacZ Stratagene, Heidelberg, Germany
pSK-RKF pBluescript SK(-) with recombination flank k1ORF3/k1ORF4 this work
pSK-LEU2* pBluescript SK(-) with UCS::LEU2 from S. cerevisiae this work
pSK-PADH1 pBluescript SK(-) with S. cerevisiae ADH1 promoter this work
pSK-PO4PO2 pBluescript SK(-) with P. acaciae pPac1-2 ORF2 and ORF4 this work
pSK-PO4::HA-PO2::myc pBluescript SK(-) with P. acaciae pPac1-2 ORF4::HA and ORF2::myc
this work
pSK-PO4PO2* pBluescript SK(-) with P. acaciae pPac1-2 ORF4::3HA and ORF2::3myc
this work
pSK-PADH1::ORF2 pBluescript SK(-) with PADH1::ORF2 this work
pSK-PADH1::ORF4 pBluescript SK(-) with PADH1::ORF4 this work
YEplac195 2µ, URA3, ampR, E. coli ori (40)
p195-PADH1::ORF4 YEplac195 with PADH1::ORF4 this work
p195-PADH1::ORF4C231A YEplac195 with PADH1::ORF4C231A this work
p195-PADH1::ORF4A231C YEplac195 with PADH1::ORF4A231C this work
p195-PADH1::ORF2 YEplac195 with PADH1::ORF2 this work
p195-PADH1::ORF2D462A YEplac195 with PADH1::ORF2D462A this work
p195-PADH1::ORF2A462D YEplac195 with PADH1::ORF2A462D this work
p195-PADH1::ORF2E464A YEplac195 with PADH1::ORF2E464A this work
p195-PADH1::ORF2A464E YEplac195 with PADH1::ORF2A464E this work
p195-PADH1::ORF2E466A YEplac195 with PADH1::ORF2E466A this work
p195-PADH1::ORF2A466E YEplac195 with PADH1::ORF2A466E this work
p195-PADH1::ORF2D464-E466A YEplac195 with PADH1::ORF2D464-E466A this work
p195-PADH1::ORF2A464D-A466E YEplac195 with PADH1::ORF2A464D-A466E this work
p195-PADH1::ORF2C250A YEplac195 with PADH1::ORF2C250A this work
p195-PADH1::ORF2A250C YEplac195 with PADH1::ORF2A250C this work
pARS ColE1 ori, ampR, k1ORF4-LEU2*-k1ORF4 this work
pARS-PO4PO2 pARS with P. acaciae pPac1-2 ORF2 and ORF4 this work
pAR3 k1ORF2’-LEU2*-k1ORF2’’, ampR, E. coli ori (32)
649
650
651
652
653
654
655
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
29
TABLE 3 Primers used in this study. 656
Primer Sequence (5’-3’)
Southern analysis
k1ORF4-for TATATTTAGTGTTTGTTATC
k1ORF4-rev AATTAAATCATCATGACCTTTATC
Construction of vector pARS
RKF-pARS-fw-SacI GCTAGCATGTGAGCTCGGATCTTTTTCTAATAAATATATAC
RKF-pARS-rv-KpnI/NheI CGTACGATCGGGTACCGCTAGCCTGTAGATTATTCATACTATC
pSK-RKF-SacII-fw GTATATAACAAAATAGCACCGCGGTCCAATGAAAGAAATAAATTTG
pSK-RKF-SacII-rv CTTTCATTGGACCGCGGTGCTATTTTGTTATATACAAGTTCCATATAC
XbaI-stop-UCS-LEU2*-fw GCATGCTACGTCTAGATAAATATGATATTTTTATTTTAAATAATAATGCATGCCCCTAAGAAGATCGTCG
LEU2*-rev-MCS-XbaI CGATCGTAATTCTAGACCGCGGGCGGCCGCACTAGTGGATCCCCCG GGCTGCAGAAGCTTATCGATCTCGAGGGCCCGTGGTGCCCTCCTCCTTGTC
Expression of γ subunits and immunity protein
TIR2 AAAGTTGGGTTTTTAAGCTAATAAAAGTTG
PADH1-fw CCGGGTGTACAATATGGAC
PADH1-NdeI-rv GGGATAGACATATGATATGAGATAGTTGATTGTATGC
PO4-fw GACCTTAGTGATGTATCAAAATTGAATGG
PO2-rv TCCAGGATTAACCGAACAAG
k1ORF4-NdeI-for GAATTCATATGAAGATATATCATATATTTAG
k1ORF4-EcoRI-rev TAAGTCGAATTCTTATACACATTTTCCATTCTGTAGATTATTC
PO4-HAsc-fw CTAAGCATAATCTGGAACATCATAAGGATAAATATTGTTAAAATAAGGATTAAGCTCATCCCPO2-MYCsc-rev CTACAAATCTTCTTCAGAAATCAACTTTTGTTCAACCTTACATGTAATACTTTTGATTTTACTGTCPO4-3HA Extender for CTAGCCAGCATAATCAGGAACATCATAAGGATAGCCAGCATAATCTGGAACATCATAAGGATAAGCATAATCTGGAACATC
PO2-3myc-Extender rev CTAGTTCAAGTCTTCTTCTGAGATTAATTTTTGTTCACCGTTCAAGTCTTCCTCGGAGATTAGCTTTTGTTCACCGTTCAAATCTTCTTCAGAAAT
HA-extender TTAAGAAGCGTAATCTGGAACGTCATACGGATAGGATGCATAGTCCGGGACGTCATAGGGATACAAAGCATAATCTGGAAC
PO4-rev CCCCAACAGAGGGCAATCAAG
Expression of αβ-like subunits
k1ORF2-NdeI-fw GCATCATATGAATATATTTTACATATTTTTGTTTTTGCTGTCATTC
k1ORF2-PstI-rv ATACTGCAGAAAAAGAAGGAGGTATGTGTCAAC
Site directed mutagenesis
k1ORF2-D462A-for AATCTTGATGGTATAGCTTTAGATTGGGAATATC
k1ORF2-D462A-rev CCAATCTAAAGCTATACCATCAAGATTATATTTA
k1ORF2-E464A-for GATTTAGCTTGGGAATATCCAGGTGCTCCTGATATTC
k1ORF2-E464A-rev CTGGATATTCCCAAGCTAAATCTATACCATCAAG
k1ORF2-E466A-for GATTGGGCATATCCAGGTGCTCCTGATATTC
k1ORF2-E466A-rev CTGGATATGCCCAATCTAAATCTATACCATCAAG
k1ORF2-D464A-E466A-for GATTTAGCTTGGGCATATCCAGGTGCTCCTGATATTC
k1ORF2-D464A-E466A-rev CTGGATATGCCCAAGCTAAATCTATACCATCAAG
k1ORF2-A462D-A464D-A466E-for GATTTAGATTGGGAATATCCAGGTGCTCCTGATATTC
k1ORF2-A462D-A464D-A466E-rev CTGGATATTCCCAATCTAAATCTATACCATCAAG
k1ORF2-C250A-for GTTAAGATGGCTGGCTCTTAAAAGTAATGG
k1ORF2-C250A-rev CTTTTAAGAGCCAGCCATCTTAACTTTCCC
k1ORF2-A250C-for GTTAAGATGTGTGGCTCTTAAAAGTAATGG
k1ORF2-A250C-rev CTTTTAAGAGCCACACATCTTAACTTTCCC
k1ORF4-C231A-for GAATGGAAAAGCTGTATAAGAATTCACTGG
k1ORF4-C231A-rev CTTATACAGCTTTTCCATTCTGTAGATTATTC
k1ORF4-A231C-for GAATGGAAAATGTGTATAAGAATTCACTGG
k1ORF4-A231C-rev CTTATACACATTTTCCATTCTGTAGATTATTC
RT-PCR
k1ORF2s1-fw AAGGTTTGGAGCATACTCATC
k1ORF2s1-rv ACATCCTTTCCATCCATAATTAC
657
on Septem
ber 14, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![repub.eur.nl · Mbol digest of human DNA ligated to the vector pTCF [29]. Approximately 7 105 recombinants were screened and one clone was isolated that hybridized strongly to the](https://img.pdfslide.net/doc/110x75/5e158bfe1c197601fe00417e/repubeurnl-mbol-digest-of-human-dna-ligated-to-the-vector-ptcf-29-approximately.jpg)
