Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
Infectious Pericarditis Due to B. holmesii Nei T, et al.
1
Infectious Pericarditis Due to Bordetella holmesii 1
in an Adult Patient with Malignant Lymphoma: 2
First Report of a Case 3
4
Authors 5
Takahito Nei1†), Hideya Hyodo1‡), Kazunari Sonobe2), Kazuo Dan1‡), Ryoichi Saito3) 6
7
1) Department of Internal Medicine,†Divisions of Respiratory Medicine, Infection and 8
Oncology, ‡ Divisions of Hematology, Gastroenterology and Endocrinology and 9
Metabolism, Nippon Medical School 10
2) Department of Clinical Laboratory, Nippon Medical School 11
3) Department of Moleculo-genetic Sciences, Microbiology and Immunology, Tokyo 12
Medical and Dental University 13
14
Corresponding author: Takahito Nei, MD, PhD 15
Department of Internal Medicine (Divisions of Respiratory 16
Medicine, Infection and Oncology), Nippon Medical School 17
FAX: +81-3-5685-3075 18
Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.06772-11 JCM Accepts, published online ahead of print on 29 February 2012
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
2
Phone: +81-3-5814-6266 19
E-mail address: [email protected] 20
E-mail address for each author: Takahito Nei, [email protected] 21
Hideya Hyodo, [email protected] 22
Kazunari Sonobe, [email protected] 23
Kazuo Dan, [email protected] 24
Ryoichi Saito, [email protected] 25
26
Conflict of interest Statement: None of the authors have financial relationships with any 27
commercial entity with an interest in the subject of this manuscript. 28
29
Key words: Bordetella holmesii, infectious pericarditis 30
31
Running title: Infectious Pericarditis Due to B. holmesii 32
33
34
Abstract 35
Bordetella holmesii is a fastidious Gram-negative rod first identified in 1995. Though 36
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
3
rare, it is isolated mainly in immunocompromised and asplenic hosts, and is associated with 37
bacteremia, pertussis-like respiratory tract infection and endocarditis. Herein, we describe a 38
unique B. holmesii infectious pericarditis patient with malignant lymphoma. (46 words) 39
Case Description 40
A 71-year-old male was hospitalized because of fever and dyspnea on effort. He had 41
received 8 cycles of chemotherapy for malignant lymphoma (diffuse large B-cell lymphoma) 42
over the prior year, but complete remission was not achieved. Because of a persistent lesion, 43
we initiated maintenance therapy including rituximab administration which was continued 44
until the present hospitalization. Approximately 2 weeks prior to presentation, he complained 45
of dyspnea on effort and a rising low-grade fever. Follow-up computed tomography 46
suggested pericardial effusion (Fig. 1A) and pleural change was suspected (Fig. 1B). He 47
was thus admitted under a diagnosis of possible pericarditis. Clinical examination findings 48
on presentation were unremarkable other than a temperature of 37.5°C. Initial laboratory 49
investigations revealed elevations of aspartate aminotransferase (AST) and alanine 50
aminotransaminase (ALT) to 30 and 59 IU/l, respectively (normal ranges: 10 to 28 and 5 to 51
33 IU/l, respectively), an alkaline phosphatase level of 392 IU/l (normal range: 104 to 338 52
IU/l), a hemoglobin level of 11.1 g/dl (normal range: 12 to 18 g/dl) and a C-reactive protein 53
(CRP) level of 22.99 mg/dl (normal value, less than 0.3 mg/dl). The white blood cell count 54
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
4
was 6,200/µl, i.e. within normal limits. However, the percentage of segmented neutrophils 55
was 86.5 % (normal range: 38 to 58 %). Serum electrolytes and creatinine were within 56
normal limits. Chest radiographs showed slight cardiomegaly, whereas abdominal 57
radiographs revealed no abnormalities. HBs antigen and anti-hepatitis C antibody were 58
negative. 59
In view of the possibility of pericarditis, he received pericardial drainage therapy and 60
empirical antimicrobial administration (ceftriaxone 2000mg/day) upon admission. The 61
pericardial effusion was bloody and contained neutrophil-rich inflammatory cells but no 62
malignant cells. Gram staining was negative. With empirical antimicrobial therapy, his 63
clinical symptoms disappeared and pericardial effusion did not re-accumulate after drain 64
removal. We ultimately removed more than 1,000ml of pericardial effusion, and culture of 65
approximately 20ml of this effusion was started. Forty-eight hours after starting the culture, 66
gray, smooth, round colonies less than 1mm in diameter, were isolated from blood agar 67
(Eiken Chemical Co., Tokyo, Japan) (Fig. 2). There was no colony growth at 24 h when 68
bacteria were inoculated onto 5% sheep blood agar plates and incubated in 5% CO2 under 69
aerobic conditions, whereas they grew after 5 days on MacConkey agar (Oriental Yeast Co., 70
Tokyo, Japan). Isolates were small gram-negative coccobacilli on microscopic observation 71
and no motility was seen in sulfide-indole-motility medium. Furthermore, isolates were 72
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
5
oxidase test negative and showed neither nitrate reduction nor urease production. We finally 73
identified the strain with 16s ribosomal RNA genotyping, as previously described [7], as 74
being Bordetella holmesii and a similarity search was conducted using the BLAST program 75
(DDBJ, Shizuoka, Japan). The results (1,456 bp) showed 100% similarity to the reference 76
strain (GenBank accession no. DQ409136) [similarity to B. pertussis (GenBank accession 77
no. BX640420), 99.73%; similarity to B. parapertussis (GenBank accession no. BX640434), 78
99.52%, similarity to B. bronchiseptica (GenBank accession no. BX640449), 99.52%]. 79
Furthermore, the isolates were confirmed by PCR detection of bhoE [2], a gene not found in 80
B. pertussis but present in B. holmesii, using primers Bh-bhoE-F (tggggagcaaacaggattag) 81
and Bh-bhoE-R (agagtgccctttcgtagcaa). Agglutination testing (Denka Seiken, Co., Ltd., 82
Tokyo, Japan) for identification of B. pertussis was negative. Susceptibility to representative 83
antimicrobial agents was determined by Etest on Mueller-Hinton agar. The present isolate 84
was sensitive to ampicillin (MIC, 1 µg/ml), ceftriaxone (MIC, 1 µg/ml), clarithromycin (MIC, 85
less than 2 µg/ml) and ciprofloxacin (MIC, less than 0.12 µg/ml). The patient’s fever resolved 86
within 2 days of commencing intravenous ceftriaxone, and the pericardial fluid did not 87
reaccumulate after beginning antimicrobial therapy. He felt better, and CRP normalized. 88
Administration of ceftriaxone was continued for 4 weeks, but myelosuppression associated 89
with ceftriaxone administration developed. Ceftriaxone was thus switched to levofloxacin, in 90
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
6
response to the ongoing neutropenia. He was given granulocyte-colony stimulating factor, 91
and his neutrophil count normalized. On the 63rd hospital day, he was discharged in good 92
condition. 93
94
The genus Bordetella belongs to the Alcaligenaceae family which is currently 95
comprised of eight known species. Among representative species, B. pertussis is the 96
causative agent of whooping cough (pertussis), and B. parapertussis and B. bronchiseptica 97
have also been implicated in respiratory tract infections in humans. The present species, B. 98
holmesii, was also recently reported to have been detected in patients with pertussis-like 99
respiratory syndrome [6, 15]. The other species, B. avium, B. hinzii and B. petrii, are rarely 100
detected in respiratory samples from patients with chronic respiratory infectious diseases 101
including cystic fibrosis [4, 15, 18]. Moreover, B. trematum has also reportedly been 102
detected in ear and wound infections [1, 19]. Immunocompromised status is considered to 103
be strongly associated with the establishment of infection due to these rare Bordetella 104
species. 105
B. holmesii was first described in 1995 as a cause of sepsis in 15 patients [20], 106
including at least three asplenic children, but no specific clinical findings were described. 107
The first detailed clinical case report was published later that year. A 12-year-old male with a 108
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
7
history of splenectomy for idiopathic thrombocytopenic purpura was diagnosed with sepsis 109
due to B. holmesii. However, he complained only of low-grade fever, no other symptoms, 110
and his physical state was essentially normal [8]. Since then, B. holmesii has been reported 111
as a causative microorganism of bacteremia, endocarditis and community-acquired 112
pneumonia. In these previous reports, it is noteworthy that most patients were in 113
immunocompromised states, mainly the asplenic condition [2, 5, 10, 11, 12, 14, 16]. 114
Shepard and colleagues reported 26 patients with B. holmesii bacteremia and 85 % were in 115
an anatomical or functional asplenic state [14]. Moreover, the clinical courses were usually 116
uneventful and relatively mild. Most patients recovered without complications. 117
The present case is the first description, to our knowledge, of infectious pericarditis 118
due to B. holmesii. Bacterial pericarditis accounts for approximately 5% of all pericarditis 119
cases [9, 13, 17] and occurs via direct infection during trauma, thoracic surgery, or catheter 120
drainage, by spread from an intrathoracic, myocardial, or subdiaphragmatic focus, and by 121
hematogenous dissemination. The frequent causative organisms are Staphylococcus spp. 122
and Streptococcus spp, which often cause rheumatic pancarditis, Haemophilus spp, and 123
Mycobacterium tuberculosis. M. tuberculosis is considered to be the most common 124
microorganism causing bacterial pericarditis, because the pericardium can be reached via 125
hematogenous spead or extension from adjacent organs, particularly the lungs or pleural 126
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
8
space [13]. In the present case, chest CT showed slight changes of the pleura and adjacent 127
lung parenchyma (Fig. 1B, 1C). However, we were not able to obtain pleura or lung samples 128
from the indicated regions, and can only speculate that B. holmesii had migrated to the 129
pericardium from the lung or pleural space. 130
We advocate that B. holmesii be considered among the possible causative microbes 131
of infectious pericarditis. A recent report [15] showed B. holmesii to be strongly associated 132
with pertussis-like respiratory syndrome caused by B. pertussis and B. parapertussis. 133
Furthermore, B. holmesii was identified as a causative microbe of bacterial pneumonia [3]. 134
Hence, we consider B. holmesii to be not only a cause of sepsis or septicemia in 135
immunocompromised or asplenic individuals but also a common cause of infectious 136
respiratory system diseases associated with involvement of adjacent organs or tissues 137
including the pericardium. Future development of a rapid and specific technique to detect B. 138
holmesii might have a major diagnostic impact. 139
In conclusion, B. holmesii is a rare but important cause of pericarditis. In view of the 140
possibility of this microbe causing respiratory system disease, awareness of B. holmesii is 141
warranted. 142
Acknowledgements 143
The authors thank Bierta Barfod, MD. for editing the manuscript and Toshie Sekine for 144
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
9
secretarial assistance. 145
146
References 147
[1] Daxboeck, F., E. Goerzer, P. Apfalter, M. Nehr, and R. Krause. 2004. Isolation of 148
Bordetella trematum from a diabetic leg ulcer. Diabet. Med. 21:1247-1248. 149
[2] Diavatopoulos, D. A., C. A. Cummings, H. G. van der Heide, M. van Gent, S. Liew, 150
D. A. Relman, and F. R. Mooi. 2006. Characterization of a highly conserved island in 151
the otherwise divergent Bordetella holmesii and Bordetella pertussis genomes. J. 152
Bacteriol. 188: 8385–8394. 153
[3] Dörbecker, C., C. Licht, F. Korber, G. Plum, C. Haefs, B. Hoppe, and H. Seifert. 154
2007. Community-acquired pneumonia due to Bordetella holmesii in a patient with 155
frequently relapsing nephrotic syndrome. J. Infect. 54:e203-e205. 156
[4] Fry, N. K., J. Duncan, M. T. Edwards, R. E. Tilley, D. Chitnavis, R. Harman, H. 157
Hammerton, and L. Dainton. 2007. A UK clinical isolate of Bordetella hinzii from a 158
patient with myelodysplastic syndrome. J. Med. Microbiol. 56:1700-1703 159
[5] Greig, J. R., S. S. Gunda, and J. T. C. Kwan. 2001. Bordetella holmesii bacteraemia in 160
an individual on haemodialysis. Scand. J. Infect. Dis. 33:716-717. 161
[6] Harrington, A. T., J. A. Castellanos, T. M. Ziedalski, J. E. Clarridge III, and B. T. 162
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
10
Cookson. 2009. Isolation of Bordetella avium and novel Bordetella strain from patients 163
with respiratory disease. Emerg. Infect. Dis. 15:72-74. 164
[7] Kageyama, A., K. Torikoe, M. Iwamoto, J. Masuyama, Y. Shibuya, H. Okazaki, 165
K .Yazawa, S. Minota, R. M. Kroppenstedt, and Y. Mikami. 2004. Nocardia arthritidis 166
sp. nov., a new pathogen isolated from a patient with rheumatoid arthritis in Japan. J. 167
Clin. Microbiol. 42: 2366-2371. 168
[8] Lindquist, S. W., D. J. Weber, M. E. Mangum, D. G. Hollis, and J. Jordan. 1995. 169
Bordetella holmesii sepsis in an asplenic adolescent. Pediatr. Infect. Dis. J. 14:813-815. 170
[9] Maisch B., and A. D. Ristić. 2002. The classification of pericardial disease in the age 171
of modern medicine. Curr. Cardiol. Rep. 4:13-21. 172
[10] McCavit, T. L., S. Grube, P. Revell, and C. T. Quinn. 2008. Bordetella holmesii 173
bacteremia in sickle cell disease. Pediatr. Blood Cancer 51:814-816. 174
[11] Morris, J. T., and M. Myers. 1998. Bacteremia due to Bordetella holmesii. Clin. Infect. 175
Dis. 27:912-913. 176
[12] Njamkepo, E., F. Delisle, I. Hagege, G. Gerbaud, and N. Guiso. 2000. Bordetella 177
holmesii isolated from a patient with sickle cell anemia: analysis and comparison with 178
other Bordetella holmesii isolates. Clin. Microbiol. Infect. 6:131-136. 179
[13] Sagristà-Sauleda J., J. A. Barrabés, G. Permanyer-Miralda, and J. Soler-Soler. 180
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
11
1993. Purulent pericarditis: review of a 20-year experience in a general hospital. J. Am. 181
Coll. Cardiol. 22: 1661–1665. 182
[14] Shepard, C. W., M. I. Daneshvar, R. M. Kaiser, D. A. Ashford, D. Lonsway, J. B. 183
Patel, R. E. Morey, J. G. Jordan, R. S. Weyant, and M. Fischer. 2004. Bordetella 184
holmesii bacteremia: a newly recognized clinical entity among asplenic patients. Clin. 185
Infect. Dis. 38:799-804. 186
[15] Spilker, T., A. A. Liwienski, and J. J. LiPuma. 2008. Identification of Bordetella spp. in 187
respiratory specimens from individuals with cystic fibrosis. Clin. Microbiol. Infect. 188
14:504-506. 189
[16] Tang, Y. W., M. K. Hopkins, C. P. Kolbert, P. A. Hartley, P. J. Severance, and D. H. 190
Persing. 1998. Bordetella holmesii-like organisms associated with septicemia, 191
endocarditis, and respiratory failure. Clin. Infect. Dis. 26:389-392. 192
[17] Troughton R. W., C. R. Asher, and A. L. Klein. 2004. Pericarditis. Lancet 193
363:717-727. 194
[18] Vandamme, P., J. Hommez, M. Vancanneyt, M. Monsieurs, B. Hoste, B. Cookson, 195
C. H. Wirsing von Konig, K. Kersters, and P. J. Blackall. 1995. Bordetella hinzii sp. 196
nov., isolated from poultry and humans. Int. J. Syst. Bacteriol. 45:37-45. 197
[19] Vandamme, P., M. Heyndrickx, M. Vancanneyt, B. Hoste, P. De Vos, E. Falsen, K. 198
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
12
Kersters, and K. H. Hinz. 1996. Bordetella trematum sp. nov., isolated from wounds 199
and ear infections in humans, and reassessment of Alcaligenes denitrificans Ruger and 200
Tan 1983. Int. J. Syst. Bacteriol. 46:849-858. 201
[20] Weyant, R. S., D. G. Hollis, R. E. Weaver, M. F. Amin, A. G. Steigerwalt, S. P. 202
O'Connor, A. M. Whitney, M. I. Daneshvar, C. W. Moss, and D. J. Brenner. 1995. 203
Bordetella holmesii sp. nov., a new gram-negative species associated with septicemia. 204
J. Clin. Microbiol. 33:1-7. 205
206
207
Figure legends 208
FIG. 1. Computed tomography (CT) of the chest on admission shows massive pericardial 209
effusion (FIG. 1A, white solid line) and slight pleural and lung changes adjacent to the 210
pericardium (FIG. 1B, black dashed line). High density lesions are seen in the pleura and 211
lung parenchyma adjacent to the pericardium while chest CT scan of a normal control 212
individual (TN) without pericarditis shows no such changes (FIG. 1C). 213
Fig. 2. Isolation of colonies from pericardial effusion and microscopic view of isolates (the 214
upper right panel, original magnification X1,000). Colonies grew slowly and at least 48 h 215
were required before they became observable. All colonies are less than 1mm in diameter 216
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Infectious Pericarditis Due to B. holmesii Nei T, et al.
13
and appear as brown or green areas in the medium. Isolates were found to be short 217
gram-negative coccobacilli by microscopic study. 218
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Figure 1Figure 1
B C
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Figure 2Figure 2
10μm
on Novem
ber 24, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from