1

Title: Natural Competence Promotes Helicobacter pylori Chronic Infection 1 2 Running Title: Natural Competence and H. pylori Chronic Infection 3 Marion S. Dorer1, Ilana E. Cohen1,2, Tate H. Sessler1, Jutta Fero1, Nina R. 4 Salama1* 5 1Division of Human Biology, Fred Hutchinson Cancer Research Center. 1100 6 Fairview Ave. N, Seattle, WA 98109. 7 2Program in Molecular and Cellular Biology. University of Washington, Seattle, 8 WA 98105. 9 10 Corresponding Author: 11 Nina R. Salama 12 Telephone: 206-667-1540 13 Fax: 206-667-6524 14 nsalama@fhcrc.org 15 16

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.01042-12 IAI Accepts, published online ahead of print on 31 October 2012

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

2

Abstract: 17 Animal models are important tools for studies of human disease, but 18 developing these models is a particular challenge for organisms with restricted 19 host ranges, such as the human stomach pathogen Helicobacter pylori. In most 20 cases, H. pylori infects the stomach for many decades before symptoms appear, 21 distinguishing it from many bacterial pathogens that cause acute infection. To 22 model chronic infection in the mouse, a human clinical isolate was selected for its 23 ability to survive for two months in the mouse stomach and the resulting strain, 24 MSD132, colonized the mouse stomach for at least 28 weeks. During selection, 25 the cagY component of the Cag type-IV secretion system was mutated, 26 disrupting a key interaction with host cells. Increases in both bacterial 27 persistence and bacterial burden occurred prior to this mutation and a mixed 28 population of cagY+ and cagY- cells was isolated from a single mouse, 29 suggesting that mutations accumulate during selection and that factors in 30 addition to the Cag apparatus are important for murine adaptation. Diversity in 31 both alleles and genes is common in H. pylori strains and natural competence 32 mediates a high rate of inter-strain genetic exchange. Mutants of the Com 33 apparatus, a membrane DNA transporter, and DprA, a cytosolic competence 34 factor, showed reduced persistence, although initial colonization was normal. 35 Thus, exchange of DNA between genetically heterogeneous H. pylori may 36 improve chronic colonization. The strains and methods described here will be 37 important tools for defining both the spectrum of mutations that promote murine 38 adaptation and the genetic program of chronic infection. 39

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

3

Introduction 40 The Gram-negative human stomach pathogen Helicobacter pylori 41

colonizes 50% of the world’s population, and chronic infection leads to gastritis, 42 peptic ulcer disease, gastric cancer, and gastric mucosal-associated lymphoid 43 tissue lymphoma in a subset of infected patients (1). H. pylori infection is 44 restricted to humans and non-human primates, is usually acquired in childhood, 45 and persists throughout the lifetime of the host. 46

Several H. pylori strains have been established that will infect mice (2-5). 47 The first and most widely used mouse adapted strain SS1 colonizes mice for at 48 least eight months (3), but it is a poor model for genetic studies as it is quite 49 difficult to transform for unknown reasons (6). Strain NSH57 is genetically 50 tractable, but infection wanes after four weeks (2). Despite these limitations, 51 mouse models of infection have been used to identify virulence factors required 52 for initial stomach colonization, including flagellar motility and chemotaxis (7, 8), 53 a urease that neutralizes pH around the bacterium in the acidic lumen of the 54 stomach (9), adhesins that bind the bacterium to the epithelial surface (10), and 55 bacterial cell shape (11). There have also been two screens in small animals for 56 genes required for short-term colonization (2, 12). Despite the importance of 57 chronic colonization to disease progression, little is known about the genetic 58 program that promotes long-term infection. 59

Sequencing of multiple isolates of H. pylori and comparative genomic 60 studies demonstrate a wide diversity of gene content and alleles between clinical 61 isolates (13-15) and most strains are naturally competent (16). Components of 62

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

4

the Com apparatus (ComB2-4, ComB6-10) form a type-IV secretion system 63 (T4SS) that is similar to the T4SS originally described in Agrobacterium 64 tumefaciens and mediates DNA uptake from the environment (17). Several 65 proposed models explain the selective pressure maintaining natural competence 66 in a variety of organisms, including H. pylori: [1] a source of templates for the 67 repair of DNA (18), [2] a source of energy or nucleotides (19), and [3] adaptation 68 to a hostile environment through genetic exchange (20). In prior work, we found 69 natural competence is not required during initial colonization (21), but the role of 70 natural competence during chronic infection is unclear. 71

H. pylori strains often harbor a second T4SS, the Cag apparatus, and its 72 presence increases the risk of the infected person to develop more severe 73 gastric symptoms (22). The Cag T4SS translocates the effector protein CagA into 74 gastric epithelial cells and induces mammalian cells to secrete pro-inflammatory 75 cytokines, such as IL-8 (23, 24). Although H. pylori harboring the Cag T4S 76 system can successfully infect humans for decades, Cag T4SS activity is thought 77 to limit H. pylori colonization of the mouse (25). This work presents the 78 development of an H. pylori strain for the study of chronic infection in mice. Using 79 this new strain, we found that natural competence promotes stomach 80 colonization during chronic infection. 81 Materials and Methods 82 Media and Antibiotics 83 H. pylori strains were grown on solid horse blood agar (HB) plates containing 4% 84 Columbia agar base (BD Bioscience), 5% defibrinated horse blood (HemoStat 85

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

5

Laboratories), 0.2% β-cyclodextrin (Sigma), vancomycin (Sigma; 10 μg ml−1), 86 cefsulodin (Sigma; 5 μg ml−1), polymyxin B (Sigma; 2.5 U ml−1), trimethoprim 87 (Sigma; 5 μg ml−1), and amphotericin B (Sigma; 8 μg ml−1) at 37°C in a trigas 88 incubator equilibrated with 10% oxygen, 10% carbon dioxide, and 80% nitrogen. 89 For liquid culture, H. pylori was grown in Brucella broth (BD Biosciences) 90 containing 10% fetal bovine serum (BB10; Hyclone) with shaking in the tri-gas 91 incubator. For antibiotic resistance marker selection (chloramphenicol 92 acetyltransferase, cat), bacterial media were additionally supplemented with 93 chloramphenicol (15 μg ml−1) and for sucrose sensitivity counter selection 94 (levansucrase, sacB), bacterial media were additionally supplemented with 95 sucrose (60 mg ml−1). When culturing bacteria from mouse stomachs, bacitracin 96 (200 μg ml−1) was added. 97 Strains 98 Strains used in this study are listed in Table 1. All strains described are 99 derivatives of NSH57 (2), which is a mouse adapted derivative of the sequenced 100 human clinical isolated G27 (26). ∆comB10::cat (HpG27_37) (21) and ∆dprA::cat 101 (HpG27_315) (27) mutants in the NSH57 strain background were described 102 previously and replace 70% of the coding sequence (from G27 genomic positions 103 39460-40238) with the cat cassette (comB10::cat) or replace 39% of the coding 104 sequence (from genomic positions 345017-345326) with the cat cassette 105 (dprA::cat). These same mutations were introduced into the MSD132 strain 106 background by natural transformation to generate strains MSD146a, MSD146b, 107 MSD177a and MSD177b. MSD132cat contains the cat cassette inserted between 108

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

6

positions 204322 and 204768 in the G27 genome, a previously characterized 109 neutral locus located between the divergently transcribed genes HPG27_186 and 110 HPG27_187 (28). The MSD132cat insertion construct was created using PCR 111 Soeing (29) of the products of primers oMSD1131, 1132, 1431, 1432 (Table 2). 112 MSD132tac was created in the same manner with the cat gene inserted in reverse 113 orientation. NSH57 bearing the MSD85 allele of cagY (HPG27_486) was 114 constructed by allelic exchange. A catsacB insertion cassette, conferring 115 chloramphenicol resistance and sucrose sensitivity, was constructed using PCR 116 Soeing of the products of primers oIEC148, 149, 150, and 151 (Table 2) and 117 replaced the region of the NSH57 cagY gene from genomic positions 524989 to 118 525379 to generate strain IEC42 (∆cagY). Strain IEC42 was then transformed 119 with genomic DNA isolated from MSD85 and a clone, IEC51 (cagY*), in which 120 the catsacB cassette at cagY had been replaced with MSD85 DNA was selected 121 based on sucrose resistance and chloramphenicol sensitivity. PCR and Sanger 122 sequencing of strain IEC51 using primers oIEC90, oIEC91 (PCR), and oIEC92 123 (sequencing) were used to confirm the allelic exchange. 124 Analysis of CagA translocation and IL-8 induction 125 Human AGS cells (ATCC #CRL-1739), derived from a patient with gastric 126 adenocarcinoma, were seeded at 5 × 104 cells/well on 24-well plates for 16 hours 127 before infection. H. pylori cells from mid-log-phase liquid cultures were added at 128 a multiplicity of infection of 10:1. Supernatants were collected at 6 and 24 hours 129 and release of IL-8 was assayed using an enzyme-linked immunosorbent assay 130 (ELISA) following the manufacturer's protocol (GE Healthcare). At 6 and 24 131

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

7

hours, infected cells were washed twice with PBS plus 10 mM sodium 132 orthovanadate and resuspended in SDS loading buffer. CagA tyrosine 133 phosphorylation and total CagA were detected by immunoblotting as described 134 (24). 135 Sequencing of cagY 136 The region of the cagY gene from nucleotides 524297 to 526942 was amplified 137 from genomic DNA of strains NSH57, MSD69, MSD83, MSD85, MSD86, 138 MSD132, and IEC51 (Fig. 1B and Table 1) using PCR primers oIEC90 and 139 oIEC91. The FHCRC Genomics Shared Resource sequenced amplified products 140 using primer oIEC92 with ABI’s BigDye Terminator Cycle Sequencing Reagent 141 on an ABI 3730xl DNA Analyzer (Applied Biosystems). Oligonucleotide primer 142 sequences are listed in Table 2. 143 Mouse colonization 144 Female C57BL/6 or FvB/N mice 24 – 28 days old were obtained from Charles 145 River Laboratories or Jackson Laboratories and certified free of endogenous 146 Helicobacter infection by the vendor. The mice were housed in an Association for 147 the Assessment and Accreditation of Laboratory Animal Care-accredited facility 148 in sterilized microisolator caging and provided with irradiated PMI 5053 rodent 149 chow and acidified, reverse-osmosis purified water ad libitum. The Institutional 150 Animal Care and Use Committee approved all manipulations. H. pylori infection 151 and recovery from the stomach were performed as described (30). To determine 152 CFUs (colony forming units), dilutions of mouse stomach homogenates were 153 plated to the appropriate selective medium. The competitive index was 154

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

8

determined by dividing the CFU ratio of the two clones at each time point by the 155 starting CFU ratio and 20 colonies were considered to be the limit of detection. 156 For experiments analyzed by qPCR, mouse stomachs were disrupted and diluted 157 in Brucella broth and the supernatant was plated to non-selective medium. When 158 >20 but <200 colonies were isolated, the mixture of colonies was grown 159 overnight on a fresh plate to amplify for preparation of genomic DNA. All strains, 160 including ΔcomB10::cat and ΔdprA::cat, show equivalent growth rates in culture 161 (data not shown). When >200 colonies were isolated, H. pylori cells were 162 collected directly into nuclei lysis buffer. Genomic DNA was prepared using the 163 Wizard genomic DNA kit (Promega) by the manufacturer’s protocol, except cells 164 were heated in nuclei lysis buffer at 80˚C for five minutes. Stomach tissue for 165 histopathology was fixed in 10% formalin for three days. Tissue was prepared 166 and stained using standard procedures by the FHCRC Experimental 167 Histopathology Shared Resource. 168 qPCR determination of competitive index and colonization load 169 qPCR was performed on genomic DNA in a standard reaction using iTAQ SYBR 170 green (BioRad) on an ABI prism 7900HT sequence detection system (Applied 171 Biosystems). A standard curve was prepared for each oligonucleotide primer set 172 and used to determine the limit of detection and the relative quantity of each 173 clone. Oligonucleotide primers are listed in Table 2. Clones were detected as 174 follows: MSD132cat with oMSD1415 and oMSD1416, MSD132tac with oMSD1415 175 and oTHS7095, the ∆comB10::cat mutant with oMSD1416 and oMSD1425, and 176 the ∆dprA::cat mutant with oMSD1416 and oMSD1438. The competitive index is 177

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

9

defined as the ratio of mutant to MSD132cat. The colonization load of each strain 178 was obtained by multiplying the relative quantity of each clone by the total 179 colonization load measured by CFU. 180 Statistical comparisons 181 The competitive index in each experiment was compared to one, the expected 182 value if each strain infected with equal efficiency, using the Signed Rank Test in 183 SAS v.9.2 (SAS Institute Inc.). Colonization loads of mutant compared to 184 MS132cat wild-type were compared using one-way ANOVA on log transformed 185 data using GraphPad Prism version 6.00 for Windows (GraphPad Software, La 186 Jolla California USA, www.graphpad.com). 187 Results 188 Selection of an H. pylori strain that colonizes mice for at least seven 189 months 190

Our lab has established strain NSH57 as a model for H. pylori infection in 191 mice (2). This strain derives from the sequenced human clinical isolate G27 and 192 survives for one to four weeks in the C57BL/6 mouse stomach, but the H. pylori 193 burden drops after four weeks of infection and can be cleared in a subset of mice 194 at eight weeks (Fig. 1A). To develop a model of H. pylori chronic infection, strain 195 NSH57 was introduced into mice, recovered and enumerated four to nine weeks 196 later, and the output clones were re-introduced into mice for another round of 197 selection (Fig. 1B). In the first round, FVB/N mice were used, as they are slightly 198 more permissive to colonization by H. pylori. Colonies recovered from these mice 199

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

10

were then selected in C57BL/6 mice five more times by serial passage, resulting 200 in increased colonization load (Fig. 1C). 201

A single colony (MSD132) was isolated from the final round of selection 202 and colonizes the mouse stomach for at least seven months (Fig. 1D). After 203 seven months, H. pylori were found throughout the glandular stomach of all five 204 mice, were mostly associated with the epithelial surface (Fig. 1E), and were 205 rarely found in the glands. No significant inflammatory cell infiltration was 206 observed in the stomach epithelium of these mice (data not shown). 207 The Cag T4SS apparatus is defective in strain MSD132 208 Previous studies have reported that H. pylori strains lacking the Cag T4SS 209 survive longer in the mouse stomach than do unrelated cag+ strains (4, 25). The 210 parent strain NSH57 has an active Cag T4SS (2), as do Round 1 and 2 strains, 211 which retained the ability to induce IL-8 (Fig. 2A) while producing a 10-fold 212 increase in the bacterial load after eight weeks of infection (Fig. 1C). In Round 3, 213 strains MSD85 and MSD86 were isolated from the same mouse (Fig. 1B): 214 MSD86 retains the ability to induce IL-8 and to translocate CagA, whereas this 215 capacity is lost in MSD85 (Fig. 2B,C). After eight weeks in mice, 20-fold more 216 CFU/g tissue were found for MSD85 than MSD86 (data not shown), so MSD85 217 was chosen for further selection. 218 CagY is a surface-exposed component of the Cag T4SS and undergoes 219 extensive recombination, usually producing recombinants with the correct open 220 reading frame (31). Given this plasticity, we first checked whether cagY was 221 mutated in MSD132 using the published G27 genome sequence (26) as a 222

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

11

reference and found a single base insertion (+T at position 525134). This 223 insertion creates a stop codon at amino acid 462 out of 1903 amino acids. As 224 CagY is required for Cag T4S activity (32), this mutation may explain the loss of 225 IL-8 induction observed for MSD85. To verify the importance of this sequence 226 change we used allelic exchange (33) to place the MSD85 allele of cagY in the 227 NSH57 strain (cagY*). The cagY* strain showed diminished IL-8 production 228 (Figure 2B) and no detectable CagA tyrosine phosphorylation (which requires 229 T4SS-dependent translocation into the host cell cytosol) during infection of AGS 230 gastric epithelial cells, similar to a NSH57 cagY deletion mutant (ΔcagY). Thus 231 the T insertion mutation is sufficient to abolish Cag T4SS activity, though we 232 cannot rule out the existence of additional cag PAI mutations in strain MSD85 233 and its derivatives. MSD85 and all strains from Rounds 4-6 harbor this early stop 234 codon, whereas MSD86 and strains from Rounds 1 and 2 do not. Strains from 235 Rounds 1 and 2 have significantly improved chronic colonization of the mouse 236 stomach compared to NSH57 (Fig. 1C), showing that the loss of Cag T4SS 237 activity is not the only factor required for murine adaptation. 238 Development of chronic colonization competition assay 239 One-week colonization of the mouse stomach is often analyzed with a 240 competition assay. One of the competing clones, usually the mutant, harbors the 241 cat gene, conferring chloramphenicol resistance, while the other clone is not 242 marked (30). In our chronic colonization model, MSD132 harboring the cat gene 243 at a neutral locus (28) (MSD132cat) is compromised for colonization compared to 244 MSD132 after eight weeks, with an average competitive index (CIave)=0.15 245

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

12

(range 0.021-13). While this defect is not significantly different than the expected 246 null result of CIave=1 (p=0.13), we were concerned that cat might have a 247 detrimental effect on mutant colonization, so we explored a new experimental 248 design where both the experimental and control strain carry an insertion of cat 249 into the genome. Primers were designed to the unique junction between cat and 250 the genome for each clone and quantitative PCR was used to assess the 251 competitive index. To validate this method we first tested MSD132cat against a 252 strain where the cat marker was inserted at the same locus but in the reverse 253 orientation, MSD132tac. After eight weeks of infection an average competitive 254 index of 0.78 (range 0.0082-16) was observed and this was not significantly 255 different from 1 (p=0.49). These results indicate that although expression of cat 256 may confer a slight competitive disadvantage during chronic colonization, 257 comparisons between strains that both contain cat are robust. 258 Natural competence promotes chronic colonization 259

With a robust assay in hand, we wanted to investigate persistence 260 phenotypes for genes not required for initial colonization. We chose to test 261 natural competence because our previous study showed that natural 262 competence is not required for colonization of the mouse stomach after one 263 week (21) yet most clinical isolates are naturally competent (16). Natural 264 competence was retained during mouse adaptation as assessed by capacity for 265 natural transformation of MSD132, which we utilized to generate the isogenic 266 strains described here. Consistent with our prior studies in the NSH57 strain 267 background, the ∆comB10 mutant infected all mice and showed similar 268

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

13

colonization loads as MSD132cat after one week (geometric mean colonization 269 loads 16,000 ∆comB10 vs. 7,800 MSD132cat CFU/stomach). However, after eight 270 weeks, two independently generated ∆comB10 mutant clones showed 271 attenuated colonization compared to MSD132cat (Figure 3A). As the 272 transformation defect of natural competence mutants limits our ability to 273 introduce exogenous DNA for complementation studies, we tested independent 274 clones to control for possible secondary mutations influencing the observed 275 colonization phenotype. For one clone no ∆comB10 mutant could be detected in 276 one mouse and in seven of the nine remaining mice the colonization load was 277 lower for the comB10 mutant (geometric mean colonization loads 5,500 278 ∆comB10 vs. 32,000 MSD132cat CFU/stomach p<0.01). For the second clone the 279 ∆comB10 mutant could be detected in all the mice, but all but one mouse 280 showed lower colonization loads of this mutant (geometric mean colonization 281 loads 7,900 ∆comB10 CFU/stomach vs. 51,000 MSD132cat CFU/stomach 282 p<0.001). These results suggest that natural competence plays an important role 283 during chronic H. pylori infection. 284

In order to confirm that natural competence is required for chronic 285 colonization, the role of DprA was tested. DprA is a cytosolic protein that binds 286 DNA cooperatively with RecA, possibly to promote recombination into the 287 genome (34). The ∆dprA mutant takes up DNA through the Com apparatus (35), 288 but fails to recombine it into the genome (27), making it an ideal test of the 289 hypothesis that natural competence may be a source of energy or nucleotides 290 during chronic infection. Similar to ΔcomB10 (21), two independent ΔdprA mutant 291

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

14

clones showed no significant defect in competition with wild type strain 292 MSD132cat after one week of infection (Fig. 3A, geometric mean load 8,300 and 293 12,000 ΔdprA CFU/stomach vs. 9,000 and 5,100 MSD132cat CFU/ stomach). At 294 eight weeks post-infection, 2/11 mice had no detectable ΔdprA cells for one 295 clone and 1/11 had no detectable ΔdprA cells for the other clone. However, the 296 remaining mice showed similar colonization loads for ΔdprA and MSD132cat cells. 297 After 12 weeks, 4/12 mice had no detectable ΔdprA cells and four of the six 298 remaining mice showed lower loads of ΔdprA cells (geometric mean colonization 299 loads 2,000 ∆dprA CFU/stomach vs. 12,000 MSD132cat CFU/stomach, p<0.001) 300 These data show that natural competence promotes chronic colonization in a 301 mouse model and suggest that natural competence has a role distinct from 302 acquiring nucleotides or energy. 303 Discussion 304 In this study, we report the development of a genetically tractable H. pylori 305 strain, MSD132, that colonizes the mouse stomach for at least 28 weeks. This 306 strain has lost the ability to translocate the CagA protein into host cells and 307 stimulate the production of IL-8, a major mediator of the inflammatory response. 308 Loss of Cag T4SS activity has been proposed to contribute to adaptation to the 309 mouse stomach (25). However, during the selection of strain MSD132, significant 310 increases in chronic colonization occurred prior to loss of Cag T4SS activity, 311 suggesting that a variety of mutations accumulate during selection. These 312 mutations may be combined through natural competence, thus contributing to 313 long-term colonization of the mouse stomach. 314

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

15

H. pylori usually colonizes people at a young age and infection persists 315 throughout the lifetime of its host (36). In humans, gastritis is evident in the vast 316 majority of H. pylori-infected people, even in patients without symptoms (22). In 317 contrast, little inflammation is observed in mice colonized with the MSD132 strain 318 after seven months. One possibility is that loss of the Cag T4SS in strain 319 MSD132 causes a decreased inflammatory response, resulting in higher 320 colonization loads and longer survival in the mouse stomach. However, this 321 change cannot be the only source of adaptation to the mouse, as a 10-fold 322 increase in the bacterial burden occurred during Rounds 1 and 2, prior to the 323 acquisition of this mutation. Although the apparent lack of immune stimulation is 324 a shortcoming of the model, most severe gastric symptoms in humans arise after 325 decades of infection (22), suggesting that there is much to learn about the H. 326 pylori genetic program of chronic colonization, even in the absence of a severe 327 inflammatory reaction. 328

Our studies in the mouse using multiple independent mutants in multiple 329 genes show that natural competence promotes chronic colonization. The 330 increased time needed to observe a significant decrease in load for the ΔdprA 331 mutant compared to ΔcomB10 (12 weeks vs. 8 weeks) may result from a more 332 severe defect in natural transformation for ΔcomB10 compared to ΔdprA. While 333 we have been unable to detect natural transformation in vitro for ΔdprA mutants, 334 another group reported limited natural transformation (35). Alternatively the 335 difference may reflect stochastic differences in the time required to accumulate 336 mutations that are the substrates of genetic exchange. 337

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

16

Natural competence may be maintained in a population as a source of 338 templates for the repair of DNA (18), a source of energy or nucleotides (19), or to 339 allow adaptation to a hostile environment through genetic exchange (20). Our 340 previous studies have shown that cells lacking competence have wild-type 341 sensitivity to DNA damaging agents, suggesting that natural competence is not a 342 major contributor to DNA repair (21). In this study, we also tested the idea that 343 natural competence may be a source of energy or nucleotides. In cells lacking 344 DprA, DNA enters through the Com apparatus (35), but is destroyed before it can 345 be recombined (27). As ΔdprA mutants shows similar attenuation of chronic 346 colonization as ΔcomB10 mutants, the uptake of DNA as an energy source must 347 not be the main function of natural competence during stomach colonization. 348

We favor the hypothesis that natural competence promotes adaptation to 349 a changing environment during chronic colonization. It is clear that mutations 350 arise during long-term colonization of the mouse stomach, as a mixture of cagY+ 351 and cagY- strains were isolated from the same mouse in Round 3. Beneficial and 352 detrimental mutations may arise from inherent errors in replication or other 353 environmental insults, creating a heterogeneous population of bacterial cells 354 dominated by sub-populations of organisms with varied fitness. Competent 355 organisms then import random fragments of DNA from these sub-populations, 356 which can purge deleterious mutations and may occasionally combine two 357 beneficial mutations into the same genome, thus producing an organism that is 358 more fit than either parent strain. 359

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

17

Further studies using whole genome sequencing approaches may 360 address the spectrum of additional mutations that promote mouse stomach 361 colonization. In addition, MSD132 will be a useful model strain to define the 362 broad genetic program and the role of natural competence during chronic 363 infection. 364 365

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

18

Acknowledgements 366 This project was supported by Public Health Service grants DK080894 367

(MSD) and AI054423 (NRS) and NRSA T32 007270 from NIGMS (IEC). Its 368 contents are the responsibility of the authors and do not necessarily represent 369 the official views of the NIH. We thank Sue Knoblaugh for histopathology 370 analysis, Sarah Talarico for statistical analysis, Abigail Mazon for strain 371 construction and members of the Salama lab for helpful discussions. 372 373 References 374 1. Peek RM, Jr., Blaser MJ. 2002. Helicobacter pylori and gastrointestinal tract 375

adenocarcinomas. Nat Rev Cancer 2:28-37. 376 2. Baldwin DN, Shepherd B, Kraemer P, Hall MK, Sycuro LK, Pinto-Santini DM, 377

Salama NR. 2007. Identification of Helicobacter pylori genes that contribute to 378 stomach colonization. Infect Immun 75:1005-1016. 379

3. Lee A, O'Rourke J, De Ungria MC, Robertson B, Daskalopoulos G, Dixon 380 MF. 1997. A standardized mouse model of Helicobacter pylori infection: 381 Introducing the Sydney strain. Gastroenterol 112:1386-1397. 382

4. Thompson LJ, Danon SJ, Wilson JE, O'Rourke JL, Salama NR, Falkow S, 383 Mitchell H, Lee A. 2004. Chronic Helicobacter pylori infection with Sydney strain 384 1 and a newly identified mouse-adapted strain (Sydney strain 2000) in C57BL/6 385 and BALB/c mice. Infect Immun 72:4668-4679. 386

5. Ermak TH, Giannasca PJ, Nichols R, Myers GA, Nedrud J, Weltzin R, Lee 387 CK, Kleanthous H, Monath TP. 1998. Immunization of mice with urease vaccine 388 affords protection against Helicobacter pylori infection in the absence of 389 antibodies and is mediated by MHC class II-restricted responses. J Exp Med 390 188:2277-2288. 391

6. Donahue JP, Israel DA, Peek RM, Blaser MJ, Miller GG. 2000. Overcoming 392 the restriction barrier to plasmid transformation of Helicobacter pylori. Mol 393 Microbiol 37:1066-1074. 394

7. Ottemann KM, Lowenthal AC. 2002. Helicobacter pylori uses motility for initial 395 colonization and to attain robust infection. Infect Immun 70:1984-1990. 396

8. Terry K, Williams SM, Connolly L, Ottemann KM. 2005. Chemotaxis plays 397 multiple roles during Helicobacter pylori animal infection. Infect Immun 73:803-398 811. 399

9. Montecucco C, Rappuoli R. 2001. Living dangerously: how Helicobacter pylori 400 survives in the human stomach. Nat Rev Mol Cell Biol 2:457-466. 401

10. Dorer MS, Talarico S, Salama NR. 2009. Helicobacter pylori's unconventional 402 role in health and disease. PLoS Pathog 5:e1000544. 403

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

19

11. Sycuro LK, Pincus Z, Gutierrez KD, Biboy J, Stern CA, Vollmer W, Salama 404 NR. 2010. Peptidoglycan crosslinking relaxation promotes Helicobacter pylori's 405 helical shape and stomach colonization. Cell 141:822-833. 406

12. Kavermann H, Burns BP, Angermuller K, Odenbreit S, Fischer W, Melchers 407 K, Haas R. 2003. Identification and characterization of Helicobacter pylori genes 408 essential for gastric colonization. J Exp Med 197:813-822. 409

13. Alm RA, Ling LS, Moir DT, King BL, Brown ED, Doig PC, Smith DR, Noonan 410 B, Guild BC, deJonge BL, Carmel G, Tummino PJ, Caruso A, Uria-Nickelsen 411 M, Mills DM, Ives C, Gibson R, Merberg D, Mills SD, Jiang Q, Taylor DE, 412 Vovis GF, Trust TJ. 1999. Genomic-sequence comparison of two unrelated 413 isolates of the human gastric pathogen Helicobacter pylori. Nature 397:176-180. 414

14. Gressmann H, Linz B, Ghai R, Pleissner KP, Schlapbach R, Yamaoka Y, 415 Kraft C, Suerbaum S, Meyer TF, Achtman M. 2005. Gain and loss of multiple 416 genes during the evolution of Helicobacter pylori. PLoS Genet 1:e43. 417

15. Salama N, Guillemin K, McDaniel TK, Sherlock G, Tompkins L, Falkow S. 418 2000. A whole-genome microarray reveals genetic diversity among Helicobacter 419 pylori strains. Proc Natl Acad Sci U S A 97:14668-14673. 420

16. Yeh YC, Chang KC, Yang JC, Fang CT, Wang JT. 2002. Association of 421 metronidazole resistance and natural competence in Helicobacter pylori. 422 Antimicrob Agents Chemother 46:1564-1567. 423

17. Hofreuter D, Odenbreit S, Haas R. 2001. Natural transformation competence in 424 Helicobacter pylori is mediated by the basic components of a type IV secretion 425 system. Mol Microbiol 41:379-391. 426

18. Hoelzer MA, Michod RE. 1991. DNA repair and the evolution of transformation 427 in Bacillus subtilis. III. Sex with damaged DNA. Genetics 128:215-223. 428

19. Redfield RJ. 1993. Genes for breakfast: the have-your-cake-and-eat-it-too of 429 bacterial transformation. The Journal of heredity 84:400-404. 430

20. Baltrus DA, Guillemin K, Phillips PC. 2008. Natural transformation increases 431 the rate of adaptation in the human pathogen Helicobacter pylori. Evolution 432 62:39-49. 433

21. Dorer MS, Fero J, Salama NR. 2010. DNA damage triggers genetic exchange in 434 Helicobacter pylori. PLoS Pathog 6:e1001026. 435

22. Kusters JG, van Vliet AH, Kuipers EJ. 2006. Pathogenesis of Helicobacter 436 pylori infection. Clin Microbiol Rev 19:449-490. 437

23. Sharma SA, Tummutu MKR, Miller GG, Blaser MJ. 1995. Interleukin-8 438 Repsonse of gastric epithelial cell lines to Helicobacter pylori stimulation in vitro. 439 Infect Immun 63:1681-1687. 440

24. Stein M, Rappuoli R, Covacci A. 2000. Tyrosine phosphorylation of the 441 Helicobacter pylori CagA antigen after cag-driven host cell translocation. Proc 442 Natl Acad Sci U S A 97:1263-1268. 443

25. Philpott DJ, Belaid D, Troubadour P, Thiberge JM, Tankovic J, Labigne A, 444 Ferrero RL. 2002. Reduced activation of inflammatory responses in host cells by 445 mouse-adapted Helicobacter pylori isolates. Cell Microbiol 4:285-296. 446

26. Baltrus DA, Amieva MR, Covacci A, Lowe TM, Merrell DS, Ottemann KM, 447 Stein M, Salama NR, Guillemin K. 2009. The complete genome sequence of 448 Helicobacter pylori strain G27. J Bacteriol 191:447-448. 449

27. Humbert O, Dorer MS, Salama NR. 2011. Characterization of Helicobacter 450 pylori factors that control transformation frequency and integration length during 451 inter-strain DNA recombination. Mol Microbiol 79:387-401. 452

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

20

28. Langford ML, Zabaleta J, Ochoa AC, Testerman TL, McGee DJ. 2006. In vitro 453 and in vivo complementation of the Helicobacter pylori arginase mutant using an 454 intergenic chromosomal site. Helicobacter 11:477-493. 455

29. Horton RM. 1997. In vitro recombination and mutagenesis of DNA. SOEing 456 together tailor-made genes. Methods Mol Biol 67:141-149. 457

30. Salama NR, Otto G, Tompkins L, Falkow S. 2001. Vacuolating cytotoxin of 458 Helicobacter pylori plays a role during colonization in a mouse model of infection. 459 Infect Immun 69:730-736. 460

31. Aras RA, Fischer W, Perez-Perez GI, Crosatti M, Ando T, Haas R, Blaser MJ. 461 2003. Plasticity of repetitive DNA sequences within a bacterial (Type IV) 462 secretion system component. J Exp Med 198:1349-1360. 463

32. Akopyants NS, Clifton SW, Kersulyte D, Crabtree JE, Youree BE, Reece CA, 464 Bukanov NO, Drazek ES, Roe BA, Berg DE. 1998. Analyses of the cag 465 pathogenicity island of Helicobacter pylori. Mol Microbiol 28:37-53. 466

33. Copass M, Grandi G, Rappuoli R. 1997. Introduction of unmarked mutations in 467 the Helicobacter pylori vacA gene with a sucrose sensitivity marker. Infect Immun 468 65:1949-1952. 469

34. Mortier-Barriere I, Velten M, Dupaigne P, Mirouze N, Pietrement O, 470 McGovern S, Fichant G, Martin B, Noirot P, Le Cam E, Polard P, Claverys 471 JP. 2007. A key presynaptic role in transformation for a widespread bacterial 472 protein: DprA conveys incoming ssDNA to RecA. Cell 130:824-836. 473

35. Ando T, Israel DA, Kusugami K, Blaser MJ. 1999. HP0333, a member of the 474 dprA family, is involved in natural transformation in Helicobacter pylori. J 475 Bacteriol 181:5572-5580. 476

36. Fiedorek SC, Malaty HM, Evans DL, Pumphrey CL, Casteel HB, Evans DJ, 477 Jr., Graham DY. 1991. Factors influencing the epidemiology of Helicobacter 478 pylori infection in children. Pediatrics 88:578-582. 479

480 481

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

21

Figure Legends 482 Fig. 1. Selection of a mouse-adapted H. pylori strain that persists for at 483 least 28 weeks. (A,C,D) Each data point shows the colony forming units (CFU)/g 484 stomach tissue for a single mouse. (A) Decreasing colonization load of strain 485 NSH57 over eight weeks. (B, C) Six rounds of sequential mouse stomach 486 colonization were used to select strain MSD132. Mice were infected for the time 487 indicated (B) and the mouse stomach colonization load after each round (C) is 488 shown. (D) MSD132 colonizes the mouse stomach at constant levels for at least 489 28 weeks. (E) Light micrograph of glandular stomach from a C57BL/6 mouse 490 colonized for 28 weeks with strain MSD132. H. pylori were visualized with a 491 Steiner stain (black) and most H. pylori are associated with the epithelial surface. 492 Data shown are from a single mouse adaptation selection experiment. 493 Fig. 2. The Cag apparatus is defective in mouse-adapted strains with 494 improved persistence due to mutation of cagY. (A,B) ELISA assay of IL-8 495 present in the medium of AGS cells during co-culture with H. pylori. (A) MSD69, 496 Round 1; MSD83, Round 2, MSD85 and MSD86, Round 3, MSD101, Round 4 497 (see Figure 1B). (B) MSD85 and MSD86 were recovered in Round 3 from the 498 same mouse. The cagY mutation present in MSD85 was engineered into NSH57 499 using allelic exchange (see Material and Methods) to generate IEC51 (cagY*) 500 and compared to IEC42, an NSH57 cagY deletion strain (ΔcagY). (C) 501 Immunoblot analysis of total protein prepared from the same co-culture 502 experiment as in (B) and probed with either anti-CagA to detect total CagA 503 protein or 4G10 antibody to detect phosphorylated CagA (P-CagA) generated in 504

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

22

the host cytosol. Data shown are for representative experiments of 2-4 biological 505 replicates. While the amount of IL-8 induction produced by the parent strain and 506 strains carrying cagY mutations show experiment to experiment variation, we 507 always observed higher IL-8 secretion for strains predicted to encode a functional 508 cagY allele and never observed CagA phosphorylation in strains expressing 509 alleles predicted to disrupt the coding sequence. 510 Fig. 3. Natural competence promotes chronic infection. Competitive 511 infections of 1:1 mixtures of independent ΔcomB10 (A) or ΔdprA (B) mutant 512 clones with wild-type MSDcat. Bacterial load per stomach for each strain 513 recovered collected at 1 week, 8 weeks and 12 weeks were determined by 514 plating for total CFU and qPCR determination of the ratio of each genotype. Data 515 points aligned in the vertical plane were recovered from the same mouse. The 516 geometric mean of the colonization loads for all mice from which both strains 517 were above the limit of detection is indicated by filled bars (wild-type MSDcat 518 clones ) and open bars (indicate natural competence mutant clones). A single 519 asterisk denotes a p-value ≤ 0.01, while a double asterisk denotes a p-value ≤ 520 0.001 when comparing mutant and MSD132cat loads at each time point as 521 determined by one-way ANOVA of log transformed data (GraphPad Prism 522 version 6.00). Strains used: MSD146a (ΔcomB10 clone 1), MSD146b (ΔcomB10 523 clone 2), MSD177a (ΔdprA clone 1), MSD177b (ΔdprA clone 2). Data shown are 524 representative of 1-2 biological replicates and ΔdprA clone 1 12 week experiment 525 was performed separately from the 1 week and 8 week experiment. 526 527

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

23

Table 1: H. pylori strains used in this study 528 Alias Description Reference NSH57 WT, mouse adapted from H. pylori G27 (2) MSD69 Round 1 mouse adaptation from NSH57 this work MSD83 Round 2 mouse adaptation from NSH57 this work MSD85 Round 3 mouse adaptation from NSH57 this work MSD86 Round 3 mouse adaptation from NSH57 this work MSD101 Round 4 mouse adaptation from NSH57 this work MSD124 Round 5 mouse adaptation from NSH57 this work MSD132 Round 6 mouse adaptation from NSH57 this work

MSD132cat MSD132 with cat inserted at a neutral locus

this work

IEC42 ∆cagY::catsacB (HPG27_486) in NSH57 this work

IEC51 cagY*, MSD85 allele of cagY (HPG27_486) in NSH57

this work

MSD132tac MSD132 with cat inserted in reverse orientation at a neutral locus

this work

MSD146a ∆comB10::cat (HpG27_37) in MSD132 this work MSD146b ∆comB10::cat (HpG27_37) in MSD132 this work MSD177a ∆dprA::cat (HpG27_315) in MSD132 this work MSD177b ∆dprA::cat (HpG27_315) in MSD132 this work 529 530 on N

ovember 30, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

24

Table 2. Oligonucleotides used in this study 531 Oligo name Sequence oMSD1415 GACGATAATGATGTTAATGATG oMSD1416 TCCGTAAATTCCGATTTGTTG oMSD1425 CCACAGCCAACTAACACAGA oMSD1438 GAGCTTGCTAAAAATGGCGC oMSD1131 AAGGGTTTCTTTAGGGAT oMSD1132 CTGTTCTAATGGGGTGTT oMSD1431 CCCAGTTTGTCGCACTGATAACATCATTAACATCATTATCG oMSD1432 ATCCACTTTTCAATCTATATCTGGCATATTTTTCCCTTATAT oTHS7095 TTGGATGAATTACAAGACTTGC oIEC90 TTTCTCGCTTCAGGGGTGAGCAAC oIEC91 ATCAAGCAAAGGCGCTAGAGACCC oIEC92 GCGCAGTCTTTATAAGCTTTCAGGC oIEC148 TTCATTCCTAGCTCTTGAAACGCAGTC oIEC149 ACTGAACCAACAAAAAGTTCAAGTGGC oIEC150 ATCCACTTTTCAATCTATATCACGCTAAAACCGATGAAGAACGAAACG oIEC151 CAAAAGAAAATGCCGATATCCAGCTTCTTTAGACAAGCCTTTCAAGCA

532 533

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

on Novem

ber 30, 2020 by guesthttp://iai.asm

.org/D

ownloaded from