Downregulation of leptin and resistin expression in bloodfollowing bariatric surgery

Claire Edwards • A. Katharine Hindle •

Sidney Fu • Fredrick Brody

Received: 26 April 2010 / Accepted: 22 October 2010 / Published online: 22 December 2010

� Springer Science+Business Media, LLC 2010

Abstract

Background Type 2 diabetes (T2D) resolves rapidly after

bariatric surgery, even before substantial weight is lost.

However, the molecular pathways underlying this phenom-

enon remain unclear. Microarray data has shown that

numerous genes are differentially expressed in blood after

bariatric surgery, including resistin and leptin. Resistin and

leptin are circulating hormones derived from adipose tissue,

which are associated with obesity and insulin resistance. This

study examined expression of these genes before and after

bariatric surgery in diabetic and nondiabetic obese patients.

Methods The study included 16 obese patients who

underwent bariatric surgery, either Roux-en-Y gastric

bypass (RYGB) or adjustable gastric banding. Eight patients

had T2D. Preoperative blood samples were collected in

PAXgene tubes to stabilize mRNA. Postoperative samples

were collected 3 months after surgery. Total RNA was

isolated and cDNA was synthesized. Real-time quantitative

PCR was used to quantify mRNA. Results were analyzed

using Student’s t test with a P \ 0.05 considered significant.

Results Postoperatively, five diabetic patients had dis-

continued hypoglycemic medications and one showed

improved glycemic control. Both leptin and resistin mRNA

levels were elevated in the diabetic group but decreased

after surgery to levels near those of the nondiabetic group.

Greater downregulation of resistin and leptin expression

occurred in patients who lost more excess body weight

(EBW), while patients who lost less than 10% EBW had a

mean increase in expression of the two genes. Downregu-

lation of both genes was more pronounced after RYGB

compared to gastric banding.

Conclusions Downregulation of resistin and leptin gene

expression after bariatric surgery may play a role in nor-

malizing obesity-associated insulin resistance. Interest-

ingly, downregulation is greater after RYGB and in

patients who lose a greater proportion of EBW. Targeted

therapies for obesity and diabetes may be developed by

understanding the pathways by which these adipocytokines

contribute to obesity and T2D.

Keywords Bariatric surgery � Type 2 diabetes �Genomics � Resistin � Leptin

Type 2 diabetes (T2D) usually resolves rapidly after bari-

atric surgery, even before substantial weight is lost.

Although this clinical phenomenon has been well estab-

lished, the underlying molecular pathways by which T2D

resolves after bariatric surgery remain unclear. Recently,

data have evolved regarding the hormonal interplay that

may underlie the resolution of diabetes. Leptin and resistin

are circulating hormones derived from adipose tissue that

may be implicated in this mechanism. Leptin acts upon the

hypothalamus to regulate energy balance and decrease an

individual’s appetite when energy stores are sufficient.

Rarely, severe obesity is caused by a deficiency of leptin.

However, in the majority of obese people, leptin levels are

elevated due to ‘‘leptin resistance’’ which actually

Presented at the 12th WCES, April 14–17 2010, National Harbor,

MD.

C. Edwards � A. K. Hindle (&) � F. Brody

Department of General Surgery, The George Washington

University Medical Center, Washington, DC, USA

e-mail: akhindle@gmail.com

S. Fu � F. Brody

Department of Molecular Biology and Biochemistry,

The George Washington University Medical Center,

Washington, DC, USA

123

Surg Endosc (2011) 25:1962–1968

DOI 10.1007/s00464-010-1494-z

corresponds with a decreased sensitivity to the hormone’s

effects [1, 2]. Leptin may also have a role in the patho-

physiology of obesity-related T2D. Separate from its

effects on feeding behavior and energy intake, leptin

modulates hepatic gluconeogenesis and b-cell function to

influence glucose metabolism [3]. Certain animal models

document improvements in insulin resistance after admin-

istering leptin [4].

The normal physiologic role of resistin is still unclear,

but the hormone has been linked to the development of

obesity and T2D. Resistin levels are increased in obese mice

relative to normal-weight animals, and administration of

exogenous resistin to normal mice results in both impaired

glucose tolerance and insulin resistance. Conversely, neu-

tralization of resistin with an anti-resistin antibody increa-

ses insulin sensitivity and blood glucose levels in mice on a

high-fat diet. Moreover, resistin levels are modulated in

vitro by antidiabetic thiazoledinedione drugs [5].

Most evidence suggests that both obesity and insulin

resistance are associated with increased leptin and resistin

levels. Circulating levels of leptin appear to increase as a

function of the amount of adipose tissue [1, 4]. Although

there are conflicting results, resistin levels appear to also

increase as body mass index (BMI) increases [5–7]. Resi-

stin mRNA is higher in white blood cells from diabetic

versus nondiabetic women [8], and patients with high

resistin levels are more likely to develop T2D within

10 years compared to matched patients with low resistin

levels [9]. Studies on the effect of weight loss following

lifestyle modifications or bariatric surgery yield mixed

results regarding resistin and leptin.

Despite all that is known at this point, the molecular link

between obesity and T2D is still unclear. Since T2D often

resolves quickly postoperatively, morbidly obese patients

undergoing bariatric surgery represent a unique clinical

opportunity to unravel this phenomenon. This study

examines serum levels of leptin and resistin mRNA pre-

and postoperatively in diabetic and nondiabetic morbidly

obese patients who underwent bariatric surgery. This study

hypothesizes that changes in leptin and resistin expression

levels are associated with the clinical resolution of diabetes

in obese patients who undergo bariatric surgery. Since

these cytokines originate from adipose tissue, this study

proposes that patients with more excess body weight loss

might demonstrate greater changes in gene expression.

Methods

Patient recruitment and clinical information

This study was approved by the George Washington Uni-

versity Institutional Review Board (IRB #070701). A total

of 16 patients referred to the George Washington University

Medical Center for bariatric surgery were recruited. All

patients were morbidly obese as defined by the 1991 NIH

consensus guidelines (BMI [ 40 or BMI [ 35 with at least

one obesity-related comorbidity). Blood samples were

drawn immediately prior to the patient’s operation. All

patients underwent laparoscopic bariatric surgery (either

Roux-en-Y gastric bypass [RYGB] or adjustable gastric

banding). Blood samples were again collected 3 months

postoperatively. Eight of the 16 patients had T2D and were

using either oral hypoglycemic agents or insulin. Demo-

graphic data were obtained by review of patient charts. Ideal

body weight (IBW) was calculated by adding 100 pounds

plus 5 pounds for each inch above 5 feet tall for women and

by adding 106 pounds plus 6 pounds for each inch above 5

feet tall for men. Excess body weight (EBW) was then

calculated by subtracting IBW from actual weight.

RNA purification

Blood samples were collected and incubated in PAXgene

tubes (Preanalytix/Qiagen, Valencia, CA) to stabilize

mRNA expression. Total RNA was isolated using the

PAXgene Blood RNA kit according to the manufacturer’s

instructions. RNA was then purified using the Qiagen

RNeasy Mini kit cleanup procedure.

Microarray assays

In an initial microarray study, blood samples from four

postoperative patients were compared with samples from

preoperative patients. RNA quality was assessed with the

Bioanalyzer 2100 (Agilent, Santa Clara, CA). All samples

used for the microarray had RNA Integrity Number [ 8.

The Nugen Ovation V2 amplification system and Nugen

whole-blood module (Nugen, San Carlos, CA) were used

with 100 ng of total RNA. Amplified cDNA was purified

using the Qiagen PCR purification kit. A 4.4-lg aliquot of

purified cDNA was fragmented and labeled using Nugen’s

kit and protocol. Fragmented and labeled cDNA was

hybridized to Human Genome Focus arrays (Affymetrix,

Santa Clara, CA) per the Affymetrix Eukaryotic Sample

and Array Processing manual. The chips were scanned and

normalized. The .cel files were then imported into the

GeneSpring GX 10.0 program for statistical analysis. A list

of significantly (P B 0.1) up- or down-regulated genes was

identified.

Synthesis of cDNA

cDNA was synthesized from RNA using the iScript cDNA

Synthesis kit (Bio-Rad Laboratories, Hercules, CA). Each

reaction contained 200 ng of total RNA, 4 ll of 5X iScript

Surg Endosc (2011) 25:1962–1968 1963

123

Reaction Mix, 1 ll of iScript Reverse Transcriptase, and

nuclease-free water to a reaction volume of 20 ll and was

incubated at 25�C for 5 min, 42�C for 30 min, and 85�C

for 5 min. Then, cDNA was stored at -20�C.

Real-time PCR analysis

Real-time quantitative PCR was used to quantify relative

gene expression of leptin and resistin. Primer sequences

were as follows: leptin, forward: cccaggtcagattgacgggacca,

reverse: tgcccatttccctgcctgcc; resistin, forward: cgcctgtggct

cgtgggatg, reverse: cgacctcagggctgcacacg. One microliter

of each cDNA sample was mixed with 1 ll of 20 pM

forward primer, 1 ll of 20 pM reverse primer, 12.5 ll of

29 SYBR� Green reagent (SA Biosciences, Frederick,

MD, USA), and DNase/RNase-free water to a total volume

of 25 ll. Quantitative PCR was then performed using an

Applied Biosystems 7300 System (Applied Biosystems,

Foster City, CA). Data were analyzed using the accompa-

nying SDS 7700 software. Cycle threshold (Ct) was defined

as the cycle number at which a significant increase in the

fluorescence signal was first detected. A standard curve

was generated using serial dilutions of cDNA. Quantity of

unknown samples was calculated from Ct values using the

standard curve. Relative expression of leptin and resistin

were calculated for each sample by dividing the calculated

quantity of the gene of interest by the calculated quantity of

18 s ribosomal RNA for the same sample. Results were

analyzed using Student’s t test with P \ 0.05 being

significant.

Results

A list of differentially expressed genes was generated by

comparing the pre- and postoperative blood microarrays.

Many of these genes are related to metabolism and insulin

signaling (Table 1). Five patients underwent Roux-en-Y

gastric bypass (RYGB) and 11 patients had an adjustable

gastric band placed. All procedures were completed lapa-

roscopically without complications. At 3 months postop-

eratively, five of the eight diabetic patients had discontinued

hypoglycemic medications completely and one showed

improved glycemic control with fewer medications. Two

patients with T2D did not experience resolution of diabetes.

Patients who underwent RYGB lost more EBW than

patients with an adjustable gastric band placement (Fig. 1).

Resistin levels were significantly higher in diabetic

patients versus nondiabetic patients (Fig. 2A). Mean resi-

stin expression was significantly lower after surgery in the

diabetic group. In the nondiabetic group, however, mean

resistin expression was essentially unchanged after surgery.

There was a trend toward higher leptin expression in dia-

betic patients (Fig. 2B). As with resistin, mean leptin levels

decreased after surgery in the diabetic group but not in the

non-diabetic group. These trends were not statistically

significant.

The mean change in gene expression levels for both

adipocytokines varied with EBW lost (Fig. 3A, B). Mean

resistin gene expression decreased 1.9-fold in patients who

lost 10–20% or more EBW and increased 2.4-fold in

patients who lost less than 10% EBW. The difference

between the groups was statistically significant (P = 0.05).

In patients who lost more than 20% EBW, mean resistin

expression decreased 1.4-fold. Leptin expression did not

show the same downregulation. Mean leptin expression

increased 0.5-fold in patients who lost 10–20% EBW and

increased 2.7-fold in those patients who lost less than 10%

of their EBW. In patients who lost more than 20% EBW,

mean leptin expression was essentially unchanged (0.06-

fold decrease).

Mean change in both resistin and leptin mRNA levels

(Fig. 4) varied significantly with type of surgery. Mean

resistin expression was essentially unchanged after an

adjustable band (0.12-fold increase) but decreased 3.6-fold

after a RYGB (P = 0.029 for the comparison between

Table 1 List of representative

genes that are differentially

expressed after bariatric surgery

List was generated by

microarray assay comparing

four postoperative to

preoperative patients

Gene symbol Regulation Fold change Function

CPT1A Down 2.45 Mitochondrial oxidation of long-chain fatty acids

IL-1A Down 1.79 Proinflammatory cytokine

RETN Down 1.76 Resistin

FASN Down 1.59 Fatty acid synthase

TNF Down 1.54 TNF superfamily member 2

IDE Up 1.49 Insulin degrading protein

FABP2 Up 1.42 Intestinal fatty acid binding protein

LEP Down 1.37 Leptin

PPARG Up 1.26 Nuclear receptor; role in glucose homeostasis

and fatty acid oxidation

PLIN Up 1.20 Lipid storage within adipocytes

1964 Surg Endosc (2011) 25:1962–1968

123

groups). Mean leptin expression increased 1.6-fold fol-

lowing an adjustable band and decreased 2.7-fold follow-

ing a RYGB (P \ 0.01).

We analyzed pre- and post-operative blood samples

from one sleeve gastrectomy patient (results not shown).

This nondiabetic patient lost 16% EBW. She had a dra-

matic 10-fold decrease in both leptin and resistin at

3 months postoperatively. However, she also had very

elevated levels of both leptin and resistin mRNA preop-

eratively relative to the rest of the patient group.

Discussion

Our data show that downregulation of the adipose tissue-

derived hormones leptin and resistin occurs after bariatric

surgery, especially among diabetic patients and patients

undergoing RYGB. While some empirical data about

Fig. 1 At the 3-month follow-up, patients who had a gastric bypass

procedure lost an average of 25.5% excess body weight. Patients who

had gastric banding lost an average of 21.1% excess body weight

Fig. 2 Resistin and leptin mRNA levels decreased after surgery in

diabetic patients. The decrease in resistin among diabetic patients was

statistically significant (*P \ 0.01). Leptin expression also decreased

after surgery, but this was not significant

Fig. 3 Change in resistin and leptin expression varies by excess body

weight (EBW) lost. Resistin mRNA level (top) increased slightly after

bariatric surgery in patients who lost less than 10% of their EBW

(mean change = 2.4-fold increase). In patients who lost 10–20%

EBW, the mean change in resistin was a 1.9-fold decrease. The

comparison between these two groups was statistically significant

(*P = 0.05). Mean change in resistin expression in patients who lost

more than 20% EBW was a 1.4 fold-decrease. Changes in leptin after

bariatric surgery (bottom graph) were less pronounced. Mean change

for patients who lost less than 10% EBW was a 2.7-fold increase,

mean change for patients who lost 10–20% EBW was a 0.5-fold

increase, and mean change for patients who lost more than 20% EBW

was a 0.1-fold increase

Surg Endosc (2011) 25:1962–1968 1965

123

serum protein levels of leptin and resistin has already been

published, serum protein assays may not be a precise

reflection of hormone activity. Resistin undergoes post-

translational modification, including formation of multi-

mers [10], and leptin has both free and receptor-bound

biologically active forms [11]. This study is unique in that

it examines gene expression specifically by quantifying

mRNA directly.

The influence of obesity on serum levels of resistin and

leptin is still not clear, as published results have been

mixed, especially in the case of resistin. Some studies

showed increasing levels of resistin with increasing degrees

of obesity (as defined by BMI or waist circumference) [5,

12–14], while others showed no such relationship [6, 15].

Serum concentration [16, 17] and adipose tissue production

[18] of leptin, however, is consistently increased in obesity.

Extremely rare cases of obesity caused by loss-of-function

leptin mutations are an exception.

Presently, the literature documents conflicting results

regarding the effects of bariatric surgery and weight loss on

adipocytokines. Leptin serum level has been shown in

several studies to decrease after bariatric surgery [11, 19]

with greater reduction following a RYGB versus gastric

banding [20]. There is less of a consensus in the case of

resistin. In one study, serum resistin levels initially

increased 6 months after gastric banding and then

decreased thereafter [21]. Other studies of bariatric patients

document that resistin levels increased postoperatively and

remain elevated [22]. Yet another set of investigators

performed sleeve gastrectomy, jejunectomy, and omen-

tectomy and showed consistently decreased resistin levels

postoperatively. The authors attributed this decrease in

resistin to removal of a preponderance of visceral fat [23].

As previously outlined, resistin and leptin appear to be

associated with insulin resistance. Our data show that

decreased gene expression of resistin and leptin accompa-

nies the normalization of T2D that occurs in morbidly

obese patients following bariatric surgery. Mean gene

expression of resistin in the diabetic population was ini-

tially high and then decreased, while resistin expression in

the nondiabetic population remained unchanged. This

suggests that modulation of this gene may be one of the

underlying factors that explain the unusually rapid resolu-

tion of T2D.

Our data show that both resistin and leptin vary signif-

icantly with EBW lost. However, EBW lost may not fully

explain the changes in gene expression. Rather, the chan-

ges in EBW may reflect only the weight loss of a RYGB

versus a gastric band. Obviously, EBW loss at 3 months

will be significantly greater after a RYGB than after a

gastric band. Rather, the changes in gene expression may

reflect the physiologic changes after bypassing the proxi-

mal foregut, as discussed below.

There was a significant trend toward a greater down-

regulation of resistin levels following a RYGB versus

gastric banding. Leptin also was significantly decreased

after RYGB compared to gastric banding and this certainly

agrees with previously reported data [20]. It is puzzling

that a small number of patients experienced increases in

leptin and resistin. This resulted in an overall mean

increase in patients who underwent gastric banding and in

the group of patients who lost less than 10% EBW. The

loss of adipose tissue in these patients during the 3-month

follow-up period may simply be too small to create a dif-

ference in genomic expression of these fat-derived hor-

mones. Alternatively, these few patients may have been in

a subclinical inflammatory state that resulted in a net

increase in resistin and leptin expression despite loss of

adipose tissue. Both resistin and leptin expression are

increased in the presence of proinflammatory cytokines [1,

24, 25].

As noted above, it is not clear why the alteration in

expression of adipocytokines differs by type of surgery.

Fig. 4 Mean change in resistin level (top) varied with type of surgery

(0.1-fold increase for adjustable band versus 3.6-fold decrease for

gastric bypass). Mean change in leptin level (bottom) also varied by

type of surgery (1.9-fold increase for adjustable band versus 2.7-fold

decrease for gastric bypass). Comparison between the two groups is

statistically significant for both hormones

1966 Surg Endosc (2011) 25:1962–1968

123

Modification of leptin and resistin expression was highest

following RYGB, which was also the procedure associated

with the greatest weight loss. Although we were unable to

draw any conclusions about sleeve gastrectomy because we

analyzed blood from only one patient, this patient did

demonstrate a large downregulation of leptin and resistin

postoperatively. Leptin and resistin are derived from adi-

pocytes or fat-associated inflammatory cells, and fat mass

is lost rapidly after bariatric surgery [26]. Therefore, leptin

and resistin expression may decrease more after RYGB and

sleeve gastrectomy simply because of a greater loss of

adipose tissue after these procedures. However, this phe-

nomenon may also be due to other factors. For example,

exclusion of the proximal intestine from the alimentary

tract after a RYGB may cause changes in intestine-derived

hormones such as glucose-dependent insulinotropic poly-

peptide (GIP) or glucagon-like peptide-1 (GLP-1). These

changes might in turn influence leptin, resistin, and other

hormones related to metabolism. Similarly, the loss of the

fundus after a sleeve gastrectomy may influence the cir-

culating level of ghrelin, a hormone that may interact with

leptin and resistin. As well, changes in the delivery rate of

nutrients to the small intestine may influence insulin levels,

which may actually precede and influence changes in

adipocytokine level. It has also been proposed that there

are undiscovered factors derived from the stomach or

intestine that may have a role in this interplay [27].

After bariatric surgery, the changes in cytokines and

hormones derived from adipose tissue and the GI tract

appear to impart a significantly greater physiological effect

than the restrictive and malabsorptive effects alone would

predict. This pilot study is limited by the small number of

patients, with substantial variation between individuals in

terms of both weight loss and adipocytokine expression.

However, the data suggest that modulation of gene

expression of resistin and leptin is one of the factors

associated with the resolution of T2D in obese patients

after bariatric surgery, and that this modulation varies with

amount of weight lost and, especially, the type of bariatric

procedure performed. As this cohort grows, we may find

that the type of operation and preoperative gene expression

levels may actually have predictive value for the degree of

T2D resolution. Ultimately, an increased capacity to

delineate a patient’s gene expression patterns may help

guide bariatric surgeons to choose the most appropriate

procedure for each individual patient. For example, these

results suggest that a T2D patient with elevated resistin

expression may be best served by a RYGB rather than a

gastric band. Obviously, more details are needed regarding

the pathways by which resistin and leptin contribute to both

obesity and T2D in order to conclusively provide this type

of direction for bariatric surgery. As this project continues,

we plan to further investigate the long-term effects of these

procedures on metabolic genes by analyzing blood samples

from patients at 6 months and 1 year after surgery. An

additional goal is to increase the number of sleeve gas-

trectomy patients enrolled in the study in order to explore

the influence of this procedure on leptin and resistin levels.

Disclosures Drs. Edwards, Hindle, Fu, and Brody have no conflicts

of interest or financial ties to disclose.

References

1. Kelesidis T, Kelesidis I, Chou S, Mantzoros CS (2010) Narrative

review: the role of leptin in human physiology: emerging clinical

applications. Ann Int Med 152:93–100

2. Verna EC, Berk PD (2008) Role of fatty acids in the pathogenesis

of obesity and fatty liver: impact of bariatric surgery. Semin

Liver Dis 28:407–426

3. McTernan PG, McTernan CL, Chetty R, Jenner K, Fisher FM,

Lauer MN, Crocker J, Barnett AH, Kumar S (2002) Increased

resistin gene and protein expression in human abdominal adipose

tissue. J Clin Endocrinol Metab 87:2407

4. Yannakoulia M, Yiannakouris N, Bluher S, Matalas AL, Klimis-

Zacas D, Mantzoros CS (2003) Body fat mass and macronutrient

intake in relation to circulating soluble leptin receptor, free leptin

index, adiponectin, and resistin concentrations in healthy humans.

J Clin Endocrinol Metab 88:1730–1736

5. Steppan CM, Bailey ST, Bhat S, Brown EJ, Banerjee RR, Wright

CM, Patel HR, Ahima RS, Lazar MA (2001) The hormone res-

istin links obesity to diabetes. Nature 409:307–312

6. Won JC, Park CY, Lee WY, Lee ES, Oh SW, Park SW (2009)

Association of plasma levels of resistin with subcutaneous fat

mass and markers of inflammation but not with metabolic

determinants or insulin resistance. J Korean Med Sci 24:695–700

7. Rabe K, Lehrke M, Parhofer KG, Broedl UC (2008) Adipokines

and insulin resistance. Mol Med 14:741–751

8. Tsiotra PC, Tsigos C, Anastasiou E, Yfanti E, Boutati E,

Souvatzoglou E, Kyrou I, Raptis SA (2008) Peripheral mono-

nuclear cell resistin mRNA expression is increased in type 2

diabetic women. Mediators Inflamm 2008:892864

9. Chen BH, Song Y, Ding EL, Roberts CK, Manson JE, Rifai N,

Buring JE, Gaziano JM, Liu S (2009) Circulating levels of resi-

stin and risk of type 2 diabetes in men and women: results from

two prospective cohorts. Diabetes Care 32:329–334

10. McTernan PG, Kusminski CM, Kumar S (2006) Resistin. Curr

Opin Lipidol 17:170–175

11. van Dielen FMH, van ‘t Veer C, Buurman WA, Greve JWM

(2002) Leptin and soluble leptin receptor levels in obese and

weight-losing individuals. J Clin Endocrinol Metab 87:1708–

1716

12. Azuma K, Katsukawa F, Oguchi S, Murata M, Yamazaki H,

Shimada A, Saruta T (2003) Correlation between serum resistin

level and adiposity in obese individuals. Obes Res 11:997–1001

13. Degawa-Yamauchi M, Bovenkerk JE, Juliar BE, Watson W, Kerr

K, Jones R, Zhu Q, Considine RV (2003) Serum resistin (FIZZ3)

protein is increased in obese humans. J Clin Endocrinol Metab

88:5452–5455

14. Norata GD, Ongari M, Garlaschelli K, Raselli S, Grigore L,

Catapano AL (2007) Plasma resistin levels correlate with deter-

minants of the metabolic syndrome. Eur J Endocrinol 156:279–

284

15. Chen CC, Li TC, Li CI, Liu CS, Wang HJ, Lin CC (2005) Serum

resistin level among healthy subjects: relationship to anthropo-

metric and metabolic parameters. Metabolism 54:471–475

Surg Endosc (2011) 25:1962–1968 1967

123

16. Korner J, Leibel RL (2003) To eat or not to eat - how the gut talks

to the brain. N Engl J Med 349:926–928

17. Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens

TW, Nyce MR, Ohannesian JP, Marco CC, McKee LJ, Bauer TL,

Caro JF (1996) Serum immunoreactive-leptin concentrations in

normal-weight and obese humans. N Engl J Med 334:292–295

18. Lonnqvist F, Arner P, Nordfors L, Schalling M (1995) Overex-

pression of the obese (ob) gene in adipose tissue of human obese

subjects. Nat Med 1:950–953

19. Faraj M, Havel PJ, Phelis S, Blank D, Sniderman AD, Cianflone

K (2003) Plasma acylation-stimulating protein, adiponectin,

leptin, and ghrelin before and after weight loss induced by gastric

bypass surgery in morbidly obese subjects. J Clin Endocrinol

Metab 88:1594–1602

20. Trakhtenbroit MA, Leichman JG, Algahim MF, Miller CC III,

Moody FG, Lux TR, Taegtmeyer H (2009) Body weight, insulin

resistance, and serum adipokine levels 2 years after 2 types of

bariatric surgery. Am J Med 122:435–442

21. Moschen AR, Molnar C, Wolf AM, Weiss H, Graziadei I, Kaser

S, Ebenbichler CF, Stadlmann S, Moser PL, Tilg H (2009)

Effects of weight loss induced by bariatric surgery on hepatic

adipocytokine expression. J Hepatol 51:765–777

22. Nijhuis J, van Dielen FMH, Fouraschen SMG, van den Broek

MAJ, Rensen SSM, Buurman WA, Greve JWM (2007) Endo-

thelial activation markers and their key regulators after restrictive

bariatric surgery. Obesity 15:1395–1399

23. Santoro S, Milleo FQ, Malzoni CE, Klajner S, Borges PCM,

Santo MA, Campos FG, Artoni RF (2008) Enterohormonal

changes after digestive adaptation: five-year results of a surgical

proposal to treat obesity and associated diseases. Obes Surg

18:17–26

24. Filkova M, Haluzik M, Gay S, Senolt L (2009) The role of res-

istin as a regulator of inflammation: implications for various

human pathologies. Clin Immunol 133:157–170

25. Fantuzzi G (2005) Adipose tissue, adipokines, and inflammation.

J Allergy Clin Immunol 115:911–919 (quiz 920)

26. Das SK, Roberts SB, Kehayias JJ, Wang J, Hsu LKG, Shikora

SA, Saltzman E, McCrory MA (2003) Body composition

assessment in extreme obesity and after massive weight loss

induced by gastric bypass surgery. Am J Physiol Endocrinol

Metab 284:E1080–E1088

27. Rubino F, Gagner M (2002) Potential of surgery for curing type 2

diabetes mellitus. Ann Surg 236:554–559

1968 Surg Endosc (2011) 25:1962–1968

123