Draft - University of Toronto T-SpaceDraft 7 DNA extraction and sequencing of the TLF region. A representative plant from each of the 21 accessions, based on ploidy analysis, was selected

Draft

Phylogenetic relationships among low ploidy Poa species

using chloroplast sequences

Journal: Genome

Manuscript ID gen-2016-0110.R1

Manuscript Type: Article

Date Submitted by the Author: 17-Oct-2016

Complete List of Authors: Joshi, Alpana; USDA-ARS, FRRL Bushman, Shaun; USDA-ARS, FRRL Pickett, Brandon; USDA-ARS, FRRL Robbins, Matthew; US Department of Agriculture, Agricultural Research Service, Forage and Range Research Laboratory, Staub, Jack; USDA ARS, Forage & Range Research Laboratory

Johnson, Paul; Utah State University, Plant, Soils, and Climate

Keyword: Poa, flow cytometry, phylogeny, Kentucky bluegrass

https://mc06.manuscriptcentral.com/genome-pubs

Genome

Draft

1

Phylogenetic relationships among low ploidy Poa species using chloroplast sequences

Alpana Joshi, B. Shaun Bushman*, Brandon Pickett, Matthew D. Robbins, Jack E. Staub, Paul G.

Johnson

Alpana Joshi, B. Shaun Bushman*, Brandon Pickett, Matthew D. Robbins, and Jack E.

Staub. USDA-ARS Forage and Range Research Unit, 695 N 1100 E, Logan, UT 84322-6300.

Paul G. Johnson. Department of Plants, Soils, and Climate, Utah State University, 4820 Old

Main Hill, Logan, UT 84322-4820.

Corresponding author email: [email protected]

Abbreviations: TLF is trnT-trnF chloroplast region

Keywords: Poa, flow cytometry, phylogeny, Kentucky bluegrass

Page 1 of 62


Genome

Draft

2

Abstract

Species in the Poa genus are taxonomically and genetically difficult to delineate due to high and

variable polyploidy, aneuploidy, and challenging breeding systems. Approximately 5% of the

proposed species in Poa are considered to include or comprise diploids, but very few of those

diploids are represented in seed collections. Recent phylogenetic studies of Poa have included

some diploid species to elucidate Poa genome relationships. In this study we build upon that

foundation of diploid Poa relationships with additional confirmed diploid species and accessions,

and with additional chloroplast sequences. We also include a sample from P. pratensis and P.

arachnifera to hone in on possible ancestral genomes in these two agronomic and highly

polyploidy species. Relative to most of the Poa species, Poa section Dioicopoa (P. ligularis, P.

iridifolia, and P. arachnifera) contained relatively large chromosomes. Phylogenies were

constructed using the TLF gene region and five additional chloroplast genes, and the placement

of new species and accessions fit within chloroplast lineages reported in Soreng et al. (2010)

better than by taxonomic subgenera and sections. Low ploidy species in the “P” chloroplast

lineage, such as P. iberica and P. remota, grouped closest to P. pratensis.

Page 2 of 62


Genome

Draft

3

Introduction

Poa is the largest genus of grasses, comprising 5 subgenera, 13 sections, and up to 500 species

(Gillespie and Soreng 2005). The genus is taxonomically and genetically difficult to delineate,

and interspecific hybridization, high and variable polyploidy, and facultative apomixis have been

major sources of variation (Stebbins 1950; Clausen 1961; Tzvelev 1976; Hunziker and Stebbins

1987; Soreng 1990; Gillespie and Soreng 2005). Because of the high degree of polyploidy in the

genus, it is believed that many Poa species originated through allopolyploidy (Stebbins 1950;

Darmency and Gasquez 1997; Brysting et al. 2000, 2004; Patterson et al. 2005). Additionally,

genomic redundancy and rampant aneuploidy among highly polyploid taxa suggests some degree

of autopolyploidy. Many taxa within Poa include a range of polyploid levels, from diploids to

octaploids (Kelley et al. 2009) or tetraploids to duo-decaploids in the same species (Bowden

1961; Barkworth et al. 2003; Soreng 2005, 2007). With a basic chromosome number of x=7

(Gould 1968), Poa has been referred to as one large polyploid complex (Stebbins 1950). Given

the challenging diversity in ploidy among and within species, flow cytometry has been used to

quantify the DNA content in a several other Poa species (Eaton et al. 2004; Patterson et al. 2005;

Kelly et al. 2009; Raggi et al. 2015).

Sectional and infra-sectional taxonomy of Poa is complicated and has been the subject of

major revisions by taxonomists over the years. (Tzvelev 1976; Hunziker and Stebbins 1987;

Phillips 1989; Gillespie et al. 2007). Consideration of section Ochlopoa has switched back and

forth between a subgenus and genus designation (Hylander 1953; Soreng 1990; Gillespie and

Boles 2001; Bohling and Scholz 2003). Poa section Dioicopoa was initially considered as

subgenus (Nicora 1977, 1978) but later it recognized as section within the Poa subgenus (Soreng

1998; Gillespie et al. 2007). Arctopoa was initially considered a section (Tzvelev 1964) or a

Page 3 of 62


Genome

Draft

4

subgenus (Probatova 1971) of Poa, but then later recognized as a separate genus (Probatova

1974; Gillespie et al. 2008). When polyploid complexes within species are added to this

taxonomic murkiness, which complexes can show substantial morphological differences (e.g.,

Speckmann and Van Dijk 1972), resolution of Poa taxa can in many cases be challenging.

However, DNA sequence analysis, particularly from chloroplast regions, has been used to aid in

delineation of Poa sections and species (Gillespie and Soreng 2005; Patterson et al. 2005;

Gillespie et al. 2007; Raggi et al. 2015). Soreng et al. (2010) used the chloroplast TLF region

(Taberlet et al. 1991) to classify diploid species into four of the Poa subgenera: Ochlopoa, Poa,

Pseudopoa, and Stenopoa. The distribution of those diploids are mainly concentrated in Eurasia

(Edmondson et al. 1980; Moore et al. 1982), with very few represented in seed collections.

Some Poa species are widely cultivated as forage and turf grasses (Balasko et al. 1995;

Weddin and Huff 1996; Huff 2003), with P. pratensis (Kentucky bluegrass) and P. arachnifera

(Texas bluegrass) as two heavily utilized species for turf. Poa pratensis was examined

cytologically to determine its somatic chromosome number, and 91% of the P. pratensis taxa had

chromosome numbers ranging from 2n=24–124 (Bowden 1961; Love and Love 1975), with the

most common ploidy levels of 56, 63, 70, and 77 (Speckmann and Van Dijk 1972). Similarly,

polyploid P. arachnifera chromosome numbers have ranged from 2n=42-91 (Brown 1939;

Gould 1958; Kelley et al. 2009), with the most common chromosome numbers of 2n=8x=56

(Hartung 1946; Patterson et al. 2005). Interspecific hybridization between P. arachnifera and P.

pratensis have been made, taking advantage of the apomixis in P. pratensis and the dioecy in P.

arachnifera, for the development of hybrid turfgrass cultivars (Read et al. 1999; Meyer et al.

2005; Rose-Fricker et al. 2007; Smith and Meyer 2009). However, despite an analysis done by

Meeks and Chandra (2015) showing unique sequences in the thioredoxin region of P.

Page 4 of 62


Genome

Draft

5

arachnifera compared to P. pratensis, the genomic relationship responsible for their ability to

form interspecific hybrids is not yet well understood.

The purposes of this study were to confirm chloroplast lineage analyses of Soreng et al.

(2010) in diploid Poa species, and build upon that framework with the addition of more

chloroplast region sequences and further diploid species and accessions. Additionally, we

include samples of high-polyploid P. pratensis and P. arachnifera with the aim to hone in on

possible diploid progenitors of those species. Because of ploidy inconsistencies in published

literature, we use chromosome counts and flow cytometry to assure ploidy levels, and further

highlight relationships within sections of Poa that contain P. pratensis and P. arachnifera.

Materials and methods

Plant materials and sampling. Twenty-one accessions of Poa were obtained from the National

Plant Germplasm System (USA), the Margot Forde Germplasm Centre (New Zealand), and the

IPK Genebank (Germany). The accessions included sampling of putative diploid Poa species,

and several tetraploid Poa species for Poa subgenera where diploids were unavailable. The

sampling included the three main Poa subgenera and eight sections (Table 1). Additionally,

certified sod-quality seed of the P. pratensis cultivar ‘Midnight’ was sampled, as was a

collection of P. arachnifera obtained from J. Goldman (USDA-ARS, Woodward, OK). Ten

seeds of each accession were planted in Sunshine Mix #2 (Sun Gro Horticulture, Agawam, MA)

and five healthy plants of each accession were selected and maintained in a greenhouse in Logan,

UT. For a few accessions, less than five plants germinated such that only those plants were used

in analyses (Table 1).

Page 5 of 62


Genome

Draft

6

Flow cytometry and cytological analysis. Flow cytometry was performed on the plants from

each accession. Young, fully expanded leaves weighing 100 mg were collected and finely

chopped in Petri dishes containing 1 mL of freshly made chopping buffer (10 mM MgSO4, 50

mM KCl, 5 mM Hepes). Leaf nuclei were filtered through 30 µm nylon mesh into test tubes,

centrifuged at 200 × g for 5 min, and resuspended in 1 mL of fresh chopping buffer with the

addition of 100 mg L−1

dithiothreitol, 16.5 mg L−1

of ribonuclease A and 100 mg L−1

propidium

iodide. Tubes were incubated at 37°C for 15 min after which 3 µL of chicken erythrocyte nuclei

(CEN) singlets (Biosure, Grass Valley, CA) were added to each tube, serving as an internal

control for each sample. Samples were analyzed at 488 nm (FL2A filter) with a BD Accuri™ C6

Flow Cytometer (BD Biosciences, San Jose, CA). For each sample, the plant nuclear 2C DNA

content, measured in picograms (pg), was determined by multiplying the relative 2C DNA

content (plant sample peak mean/CEN peak mean) to the CEN 2C DNA content of 2.5 pg. The

process was repeated to confirm original 2C values. Diploid plants (2x=14) were tested with and

without the CEN standard to determine if their flow cytometry peak overlapped with the CEN

peak. In those cases where the CEN and plant peak were inseparable, a genome size of 2.5 pg

was assigned.

Because of the possibility of varying chromosome sizes, chromosome counting of root tip

cells at the metaphase stage was performed to confirm ploidy level (Table 1). Root tips were

collected approximately 3 hour after sunrise directly into cold 2mm 8-hydroxyquinoline solution,

refrigerated for 3 to 4 hours, then transferred to an aceto-orcein solution for 48 hours. Samples

were then squashed on a glass slide containing one drop of 45% acetic acid, and examined under

a 1000× light microscope (Zeiss, Germany). Two to three roots per accession were analyzed to

verify ploidy.

Page 6 of 62


Genome

Draft

7

DNA extraction and sequencing of the TLF region. A representative plant from each of the 21

accessions, based on ploidy analysis, was selected for DNA sequencing and phylogenetic

analysis. Total genomic DNA was isolated from 25 mg of lyophilized leaf tissue using DNeasy

Plant Mini kits (QIAGEN Inc., Valencia, CA). The chloroplast TLF region was amplified in the

samples using primers ‘‘a’’ (5′- CATTACAAATGCGATGCTCT), ‘‘f’’ (5′-

ATTTGAACTGGTGACACGAG), “b” (5′- TCTACCGATTTCGCCATATC), “c” (5′-

CGAAATCGGTAGACGCTACG), “d” (5′- GGGGATAGAGGGACTTGAAC) and “e” (5′-

GGTTCAAGTCCCTCTATCCC) (Taberlet et al. 1991). PCR products were purified using

ExcelaPure-UF purification kits (Edge BioSystems, Gaithersburg, MD) and sequenced on an

ABI3730 using BigDye Terminator v3.1 (Thermo Fisher, Waltham, MA). Sequences were

assembled and edited manually using Sequencher v5.1 (Gene Codes Corporation, Ann Arbor,

Michigan, USA). Additional diploid and tetraploid Poa TLF sequences reported in Soreng et al.

(2010) were included from the NCBI Nucleotide database for comparison with sequences from

the new taxa. Informative InDels across all samples were scored following the simple InDel

coding method described by Simmons and Ochoterena (2000).

Additional chloroplast gene sequencing. To obtain additional chloroplast sequences, leaf tissue

of the 21 samples was collected, flash frozen in liquid nitrogen, and total RNA extracted using

Zymo Direct-zol RNA extraction kits (Zymo, Irvine, CA). cDNA sequencing libraries were

constructed using the KAPA stranded mRNA-Seq kit (Kapa Biosystems, Wilmington, MA).

Samples were barcoded and pooled into groups of four for sequencing. After pooling into groups

of six, the libraries were sequenced on an Ion Torrent PGM instrument using the Ion PI

Sequencing 200 Kit v3. Resulting sequences were sequentially trimmed and de-multiplexed by

Page 7 of 62


Genome

Draft

8

barcode using the Torrent Suite software (Life Technologies, Grand Island, NY), and again with

TRIMMOMATIC (Bolger et al. 2014). Trimmed sequence reads from each library were

assembled using TRINITY software (Grabherr et al. 2011), with default kmer and bubble sizes.

Assembled sequences were aligned to the barley (Hordeum vulgare L.) chloroplast genome with

BLASTn searches at E-value thresholds of e-20

. Sequences from the 21 Poa species with hits to

the same barley chloroplast gene, and with a similar barley gene start position to ensure sequence

overlap, were aligned with each other. Once gene regions were selected based on those criteria,

each individual gene category was aligned and analyzed manually in Sequencher v5.1. Aligned

sequences were deposited into the National Center for Biotechnology Information Popset

database, with BioProject ID (accession no: TLF (KX522653-KX522673), ndhJ (KX513004-

KX513024), psaC (KX513025-KX513045), psbM (KX513046-KX513066), rbcL (KX513067-

KX513087) and rps2 (KX513088-KX513108).

Phylogenetic analysis. Phylogenetic analyses were conducted using Maximum Likelihood (ML)

and Maximum Parsimony (MP) in PAUP v4.0 (Swofford 2002). Fast stepwise addition and full

Heuristic searches were conducted depending on the run time with the tree-bisection-

reconnection (TBR), Collapse and MulTrees options, and MaxTrees set at 1,000. One thousand

bootstrap replications were conducted for nodal support. jModelTest v. 3.7 (Posada and Crandall

1998) was used to select best-fit models of nucleotide substitution using the Akaike Information

Criterion (AIC) framework.

Results

Page 8 of 62


Genome

Draft

9

Twenty one Poa species were included, with particular interest in diploids and tetraploids when

diploids were not available, including a sample of P. pratensis and P. arachnifera. The lower

ploidy species included three different Poa subgenera; Ochlopoa, Poa, and Stenopoa. The genus

Arctopoa, with a single A. tibetica sample, was included as an outgroup (Table 1). The A.

tibetica had a 2C value of 12.8 pg in a tetraploid plant (Table 1).

In subgenus Ochlopoa section Alpinae, P. badensis and P. pumila were both diploid with

2x=14 chromosomes and a similar average genetic content of 2.5 pg (Table 1). In subgenus and

section Stenopoa, root tip chromosome counting confirmed that the P. araratica, P. nemoralis,

and P. palustris accessions were tetraploids with 4x=28, and had 2C values ranging from 5.7–6.6

pg (Table 1). Two accessions of P. trivialis (PI 594396, GR 4757), classified in section

Pandemos of Stenopoa, were diploid at 2x=14 and approximate 2C contents of 2.5 pg (Table 1).

From subgenus Poa, taxa from Macropoa, Homalopoa, Madropoa, and Dioicopoa sections

were sampled, and included the high polyploid P. pratensis and P. arachnifera, five diploid

species, and six tetraploid species. All the diploids showed overlapping peaks with the CEN

internal standard, such that their 2C values were approximately 2.5 pg. Section Macropoa

contained one tetraploid species, P. iberica, with an average 2C value of 5.9 pg. From section

Homalopoa, the P. remota plants were tetraploids with an average 2C value of 5.35 pg and a

range from 5.0–5.5 pg. From section Madropoa, the tetraploid P. nervosa had a smaller average

2C content of 3.15 pg than other tetraploids Poa. The polyploid P. arachnifera and two

tetraploid (P. ligularis and P. iridifolia) species were sampled from section Dioicopoa. The mean

2C values in both tetraploids were larger than those of other Poa sections with respect to their

chromosome counts, 7.60 pg for P. ligularis and 8.12 pg for P. iridifolia. Poa arachnifera had a

2C value of 12.3 pg with approximately 56 chromosomes. The Poa section contained only

Page 9 of 62


Genome

Draft

10

polyploid P. pratensis cv. Midnight, which had approximately 63 chromosomes and a 2C value

of 8.2 pg. Although the sheer number of small chromosomes in the cells precluded exact counts

in P. pratensis, its chromosome number did exceed 56 while its 2C value was substantially lower

than that of P. arachnifera.

The final aligned TLF data matrix contained 2,120 nucleotides of which 1,835 characters

were constant, 195 nucleotide positions were parsimony informative, and 54 InDels were present

(Supplemental Table 1). Using jModeltest, the “GTR+G” substitution model exhibited the lowest

AIC value, and the ML phylogeny detected four main clades of the Poa genus that generally

corresponded to species in subgenera Ochlopoa, Stenopoa, Poa, and a fourth eclectic clade

containing species from subgenera Nanopoa, Stenopoa and Ochlopoa (Figure 1).

An Ochlopoa clade consisted of taxa from sections Alpinae and Micrantherae, and were

grouped together with 96% bootstrap support (Figure 1). The two diploid accessions, P. badensis

and P. pumila, grouped with other section Alpinae diploid and tetraploid species that were

previously reported (P. ligulata, P. molinerii), and confirmed taxonomic placement and identity

of the two newly analyzed accessions. The chloroplast genome lineages described by Soreng et

al. (2010) also supported this taxa grouping, where “M” and “A” lineages formed sub-clades

with 100% and 99% bootstrap support, respectively. The newly analyzed accessions of P. pumila

and P. badensis grouped with other taxa of section Alpinae carrying the “A” lineage. These

Ochlopoa samples were the most distal Poa species with respect to the P. pratensis sample.

The three newly analyzed tetraploid samples in the subgenus Stenopoa (P. nemoralis, P.

palustris, and P. araratica), which are categorized as section Stenopoa, grouped with previously

reported diploid taxa in subgenus Stenopoa section Abbreviatae (P. lettermanii and P.

pseudoabbreviata) that were unavailable as live plants (Figure 1). Our Poa ligularis sample

Page 10 of 62


Genome

Draft

11

(subgenus Poa section Dioicopoa) shared two INDELs and several SNPs with Stenopoa species

in “V” and “S” lineages rather than other members of sect. Dioicopoa in “H” lineage

(Supplemental Table 1). These five taxa from subgenus Stenopoa shared the chloroplast “S”

lineage. Poa trivialis samples have been classified in a Pandemos section (Ascherson and

Graebner 1898‑1902) and given a unique “V” chloroplast lineage (Soreng et al. 2010) because

of their chloroplast phylogenetic groupings with subgenus Stenopoa (Zhu et al. 2006; Soreng

2007) yet nuclear phylogenetic groupings with Ochlopoa (Soreng et al. 2010). Both newly

analyzed P. trivialis accessions and the previously reported P. trivialis TLF sequences from

Genbank grouped as expected in a sub-clade next to Stenopoa taxa. All four accessions of P.

trivialis included in this analysis shared 11 InDels not present in any other Poa taxa (data not

shown).

A Poa clade was also resolved with bootstrap support (91%), and included all diploid,

tetraploid, and higher ploidy members of subgenus Poa (Figure 1). Our present analysis placed

newly analyzed diploid (P. bucharica, P. sibirica, and P. asiae-minoris), tetraploid (P. iberica

and P. remota), and nonaploid P. pratensis accessions with other taxa from sections Macropoa

and Homalopoa. These taxa grouped into the “P” chloroplast lineage sub-clade with 86%

bootstrap support together with previously reported species from sections Macropoa (P.

siberica) and Homalopoa (P. remota). The newly analyzed tetraploid P. remota was grouped in

same “P” lineage clade with previously published P. remota sequences (GQ324451 and

GQ324452), but carried a unique 17 nucleotide InDel and grouped closer to P. pratensis cv.

Midnight than the other P. remota sequences. Diploid and tetraploid taxa of sections Homalopoa

(P. chaixii and P. hybrida), Madropoa (P. macrantha and P. nervosa), and Dioicopoa (P.

Page 11 of 62


Genome

Draft

12

iridifolia and P. arachnifera) formed respective groups and contained the “H” chloroplast

lineage. Section Homalopoa species thus spanned both “P” and “H” chloroplast lineages.

The fourth clade represented taxa of “N” chloroplast lineage, and included subgenera

Nanopoa, Stenopoa, and an Ochlopoa species. This “N” lineage clade, although eclectic (Soreng

et al. 2010), was included in this study to test if any newly analyzed samples would group with

any of these previously reported taxa. The Genbank accessions corresponding to P. trichophylla

(subgenus and section Nanopoa), P. dolosa (subgenus Stenopoa and section Orienos), and P.

media (subgenus Ochlopoa and section Alpinae) grouped together with 56% bootstrap support.

No newly analyzed Poa species grouped with these taxa.

In addition to the TLF region, five novel chloroplast DNA fragments were aligned among the

21 new samples, comprising an additional 4,198 nut of chloroplast sequence (Table 2). All five

had the same “GTR+G” DNA substitution model as the TLF region, were combined into one

analysis, and resulted in 69 parsimony informative characters and 6 InDels (Supplemental Table

1). Unlike the TLF region, these additional sequences were of coding sequences rather than

intergenic regions, and thus contained fewer informative characters. A consensus phylogeny

showing bootstrap support values over 50% at nodes is shown in Figure 2.

Three main clades were detected that corresponded to subgenera Ochlopoa, Stenopoa, and

Poa (Figure 2). Similar to the TLF phylogeny, Ochlopoa taxa were the first to separate from the

A. tibetica outgroup and the most distal clade to the P. pratensis sample. Both P. badensis and P.

pumila grouped into this clade with 100% support and again represented the “A” chloroplast

lineage. The Stenopoa clade had bootstrap support of 83% and consisted of tetraploid P.

araratica, P. nemoralis, and P. palustris from the Stenopoa section and “S” chloroplast lineage;

and both P. trivialis sequences from the Pandemos section and “V” lineage. Adjacent to this

Page 12 of 62


Genome

Draft

13

clade was the sequence from P. nervosa (subgenus Poa section Madropoa), which grouped with

Stenopoa species in “V” and “S” lineages rather than with other sect. Madropoa species in the

“H” lineage. The Poa clade separated into two sub-clades, which associated with chloroplast

lineages “H” and “P”, but with only moderate bootstrap support. Similar to the TLF phylogeny,

the “H” lineage sub-clade included taxa from sections Dioicopoa, Madropoa, Homalopoa.

Within this sub-clade, the higher ploidy and North American P. arachnifera grouped with South

American Dioicopoa tetraploids P. iridifolia and P. ligularis with 97% nodal support. The “P”

lineage contained taxa from Homalopoa, Macropoa, and the P. pratensis cultivar Midnight

(Figure 2), and this lineage group was congruent with the TLF phylogeny as well. However, the

P. pratensis cv. Midnight grouped closest to the tetraploid P. iberica (Figure 2), rather than P.

remota in the TLF phylogeny (Figure 1).

Discussion

Since counting the number of P. pratensis chromosomes is difficult due to the high numbers

of small chromosomes and frequent aneuploidy, we also conducted flow cytometry to estimate

the average genome content (Eaton el al. 2004; Wieners et al. 2006; Murovec et al. 2009). This

allowed for a more complete understanding of the correlation between ploidy level and genome

size variation in the four Poa subgenera taxa that we sampled. Huff and Bara (1993) reported a

significant correlation between DNA content and chromosome number in Kentucky bluegrass.

Our analysis also generally observed a correlation between ploidy level of taxa of and their

genome contents (r =0.75, P < 0.05), with diploid taxa 2C values similar to our CEN internal

standard of approximately 2.5 pg, and tetraploid samples slightly higher than 5 pg. Notable

exceptions were P. nervosa, P. ligularis, and P. iridifolia, where the P. nervosa samples had a

Page 13 of 62


Genome

Draft

14

relatively small average 2C value of 3.15 pg while the 2C contents in tetraploid P. ligularis and

P. iridifolia were larger than expected at approximately 8 pg. Tetraploid Arctopoa tibetica, the

closely related but separate genus used as an outgroup, exhibited even larger chromosomes with

an average 2C value of 12.8 pg for tetraploid plants.

The genome size of higher ploidy Poa samples, P. arachnifera and P. pratensis, were

consistent with the genome size of lower ploidy Poa samples that grouped near them in

phylogenetic analyses. The octaploid P. arachnifera showed similarly large chromosomes to P.

iridifolia, and grouped with P. iridifolia in phylogenetic analyses, such that it may share genomic

ancestry with P. iridifolia. The nonaploid P. pratensis cv. Midnight sample, however, possessed

small chromosomes similar to P. nervosa, but did not group near the P. nervosa sample with

either chloroplast phylogeny dataset. Although common nuclear genomes cannot be ruled out, it

is unlikely that P. pratensis shares a chloroplast genome with P. nervosa.

Because chloroplast phylogenies have been generally based on a similar small set of regions,

amplifiable by universal PCR primers, we also aimed to confirm the TLF region sequence with

additional chloroplast sequences obtained from cDNA next-generation sequencing. This

sequencing allowed us to align five additional sequence segments, corresponding photosystem II

protein M (psbM), photosystem I subunit VII (psaC), ribulose-1,5-bisphosphate

carboxylase/oxygenase large subunit (rbcL), NADH-plastoquinone oxidoreductase subunit J

(ndhJ), and ribosomal protein S2 (rps2) genic regions (Table 2). These data more fully

established the maternal relationship among low ploidy Poa samples, and between low ploidy

Poa samples and P. pratensis. Both the TLF and combined chloroplast sequence analyses

generally confirmed the previously reported phylogenies (Soreng 1990; Gillespie and Boles

Page 14 of 62


Genome

Draft

15

2001; Gillespie and Soreng 2005; Patterson et al. 2005; Gillespie et al. 2007; Soreng et al. 2010),

and place samples into similar chloroplast lineages as reported in Soreng et al. (2010).

Two notable exceptions were detected between previous reports and the current study, but

only between one of the two phylogenies in the current study. Poa nervosa, a member of sect.

Madropoa, was placed near Stenopoa species in our 5-gene combined phylogeny (Figure 2)

while grouping with other sect. Madropoa taxa as expected in the TLF phylogeny (Figure 1).

Poa ligularis, a member of sect. Dioicopoa, tended to group with sect. Stenopoa taxa in the TLF

phylogeny (Figure 1) while grouping with strong support with other sect. Dioicopoa taxa as

expected in the 5-gene combined phylogeny (Figure 2). As both species grouped by taxonomic

section and chloroplast lineage in one of the two phylogenies, their disparate groupings are

possibly a result of insufficient discriminating sequence polymorphisms rather than incorrect

taxonomic identity. Further sampling of P. nervosa and P. ligularis accessions, and further

chloroplast sequencing, would be necessary to better understand the distribution of sequence

polymorphism across these species.

In this study, additional species and accessions were added to the known phylogeny of lower

ploidy Poa species. Our analysis added new species to the available information; P. asiae-

minoris, P. bucharica, P. ligularis, and P. araratica. The former two grouped in the “P”

chloroplast lineage with P. pratensis, and the latter two grouped with either Stenopoa species in

the “S” lineage or other Dioicopoa species in the “H” lineage. New accessions of species

previously considered in phylogenetic analyses included P. badensis, P. pumila, P. sibirica, P.

iberica, P. remota, P. chaixii, P. macrantha, P. arachnifera, and P. trivialis (Table 1). All these

accessions grouped with other sources of the same species, consistent with previous reports,

confirming their taxonomic identity and building upon the foundation of low ploidy maternal

Page 15 of 62


Genome

Draft

16

relationships. Interestingly, all plants analyzed in our accessions of P. pumila, P. sibirica, and P.

chaixii were diploid, despite these species sometimes comprising a polyploid series. Conversely,

our P. remota collection putatively contained both diploids and tetraploids but our analysis only

identified tetraploid plants. Regardless, these newly analyzed P. remota and P. sibirica samples

grouped in the same clade and chloroplast lineage as P. pratensis, and provide low-ploidy

genomes for future comparison to wider arrays of P. pratensis sampling.

One aim of this study was to hone in on maternal relationships between polyploid P.

pratensis cv. Midnight and lower ploidy Poa species, including tetraploids where diploid species

were not available. Little is known regarding P. pratensis evolution, genome composition, or

intraspecific phylogenetic relationships because of reticulation from allo- and auto-polyploidy,

facultative apomixis, population dynamics, and frequent aneuploidy among plants. The P.

pratensis sample in this study grouped with five diploid and tetraploid species with a “P”

chloroplast lineage that spanned both Macropoa and Homalopoa sections. In the TLF phylogeny,

P. pratensis grouped closest to the tetraploid P. remota while in the 5-gene combined phylogeny

it grouped closest to tetraploid P. iberica. Although P. iberica, P. remota, and P. pratensis have

not been previously assessed together, the grouping of P. pratensis with P. iberica in this study

is consistent with Soreng (1990) and Patterson et al. (2005), while the grouping of P. pratensis

with P. remota was reported by Gillespie et al. (2009). Closest diploids to P. pratensis cv.

Midnight were P. asiae-minoris, P. bucharica, and (as mentioned above) P. sibirica, which also

spanned both Macropoa and Homalopoa sections but associated with the “P” chloroplast

lineage. These data show a close relationship of P. pratensis with P. remota and P. iberica as

well as several diploid Poa species, and confirm that the “P” chloroplast lineage contains the

likely maternal ancestors of P. pratensis.

Page 16 of 62


Genome

Draft

17

The relationship established in our present study is based on chloroplast genes that represent

the maternal inheritance. We brought together newly analyzed low-ploidy species, and new

accessions of species previously considered, in the taxonomic sections and chloroplast lineages

that would be closest to P. pratensis. This study provides phylogenetic evidence that newly

analyzed species in the “P” lineage first reported in Soreng et al. (2010) showed a close

relationship with P. pratensis. Although further sampling may be needed to identify the exact

genome ancestor(s) of P. pratensis, these data provide a lineage and candidate species that may

be related to this agronomic and high-ploidy Poa species.

Acknowledgements

We would like to acknowledge the assistance of Lisa Michaels in the data collection.

Page 17 of 62


Genome

Draft

18

References

Ascherson, P., and Graebner, P. 1898‑1902. Synopsis der Mitteleuropaischen Flora. 2(1).

Familie 22. Gramina. Leipzig: W. Engelmann.

Balasko, J.A., Evers, G.W., and Duell, R.W. 1995. Bluegrasses, ryegrasses, and bentgrasses. In

R.F. Barnes, D.A. Miller, C.J. Nelson, M. Collins, and K.J. Moore (eds.) Forages. Vol. 1. An

introduction to grassland agriculture forages. Iowa State Univ. Press, Ames. pp. 357–371.

Barkworth, M.E., Capels, K.M., Long, S., and Anderton, L.K. (ed.). 2003. Flora of North

America: Magnoliophyta: Commelinidae (in part): Poaceae, part 1: North of Mexico.

Bohling, N., and Scholz, H. 2003. The Gramineae (Poaceae) flora of the Southern Aegean

islands (Greece). Checklist, new records, internal distribution. – Ber. Inst. Landschafts-

Pflanzenokologie Univ. Hohenheim, Beih. 16.

Bolger, A.M., Lohse, M., and Usadel, B. 2014. Trimmomatic: a flexible trimmer for Illumina

sequence data. Bioinformatics, 30: 2114–2120.

Bowden, W.M. 1961. Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe

Festuceae: Poa and Puccinellia. Canadian Journal of Botany, 39: 123–138.

Brown, W.L. 1939. Chromosome complements of five species of Poa with an analysis of

variance in Poa pratensis. Amer. Jour. Bot. 26: 717–723.

Brysting, A.K., Fay, M.F., Leitch, I.J., and Aiken, S. 2004. One or more species in the arctic

grass genus Dupontia? – A contribution to the Panarctic Flora project. Taxon, 53: 365–382.

Brysting, A.K., Holst-Jensen, A., and Leitch, I. 2000. Genomic origin and organization of the

hybrid Poa jemtlandica (Poaceae) verified by genomic in situ hybridization and chloroplast

DNA sequences. Annals of Botany, 85: 439–445.

Clausen, J. 1961. Introgression facilitated by apomixis in polyploid Poa. Euphytica, 10: 87–94.

Page 18 of 62


Genome

Draft

19

Darmency, H., and J. Gasquez. 1997. Spontaneous hybridization of the putative ancestors of the

allotetraploid Poa annua. New Phytologist, 136: 497–501.

Eaton, T., Curley, J., Williamson, R., and Jung, G. 2004. Determination of the level of variation

in polyploidy among Kentucky bluegrass cultivars by means of flow cytometry. Crop

Science, 44: 2168–2174.

Edmondson, J.R. 1980. Poa L. In Flora Europaea, vol. 5, eds. Tutin, T.G., Heywood, V.H.,

Burges, N.A., Moore, D.M., Valentine, D.H., Walters, S.M., and Webb, D.A. Cambridge,

UK: Cambridge University Press. pp. 159–167.

Gillespie, L.J., and Boles, R. 2001. Phylogenetic relationships and infraspecific variation in

Canadian Arctic Poa based on chloroplast DNA restriction site data. Canadian Journal of

Botany, 79: 679–701.

Gillespie, L.J., and Soreng, R.J. 2005. A phylogenetic analysis of the bluegrass genus Poa L.

(Poaceae) based on cpDNA restriction site data. Systematic Botany, 30: 84–105.

Gillespie, L.J., Archambault, A., and Soreng, R.J. 2007. Phylogeny of Poa (Poaceae) based on

trnT-trnF sequence data: major clades and basal relationships. Aliso, 23: 420–434.

Gillespie, L.J., Soreng, R.J., and Jacobs, S.W.L. 2009. Phylogenetic relationships of Australian

Poa (Poaceae: Poinae), including molecular evidence for two new genera, Saxipoa and

Sylvipoa. Australian Systematic Botany, 22: 413–436.

Gould, F.W. 1958. Chromosome Numbers in Southwestern Grasses. American Journal of

Botany, 45: 757–767.

Gould, F.W. 1968. Grass Systematics. McGraw-Hill, Inc. New York.

Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, X.,

Fan, L., Raychowdhury, R., Zeng, Q., Chen, Z., Mauceli, E., Hacohen, N., Gnirke, A., Rhind,

Page 19 of 62


Genome

Draft

20

N., di Palma, F., Birren, B.W., Nusbaum, C., Lindblad-Toh, K., Friedman, N., and Regev, A.

2011. Full-length transcriptome assembly from RNA-seq data without a reference genome.

29: 644–652.

Hartung, M.E. 1946. Chromosome numbers in Poa, Agropyron, and Elymus. Am. J. Bot. 33:

516–531.

Huff, D. 2003. Kentucky Studies on the origin, evolution and distribution of the Gramineae. IV.

The genus Poa L bluegrass. In: Casler M, Duncan R, editors. Turfgrass biology, genetics,

and breeding. John Wiley and Sons Hoboken, NJ. pp. 27–38.

Huff, D.R., and Bara, J.M. 1993: Determining genetic origins of aberrant progeny from

facultative apomictic Kentucky bluegrass using a combination of flow cytometry and silver-

stained RAPD markers. Theor. Appl. Genet. 87, 201–208.

Hunziker, J.H., and Stebbins, G.L. 1987. Chromosomal evolution in the Gramineae, In T. R.

Soderstrom, K.W. Hilu, C.S. Campbell, and M.E. Barkworth [eds.] Grass systematics and

evolution. Smithsonian Institution Press, Washington, D.C., USA. pp. 179–187.

Hylander, N. 1953. Taxa et nomina nova in opere meo: Nordisk Karlvaxtflora I. Botaniska

Notiser 1953: 352–259.

Kelley, A.M., Johnson, P.G., Waldron, B.L., and Peel, M.D. 2009. A survey of apomixis and

ploidy levels among Poa L. (Poaceae) using flow cytometry. Crop Sci. 49: 1395–1402.

Love, A., and Love, D. 1975. Cytotaxonomical atlas of the Arctic flora. Vaduz: J. Cramer.

Meeks, M. and Chandra, A. 2015. The application of flow cytometry and a thioredoxin-like

nuclear gene for breeding Poa arachnifera x Poa pratensis hybrids. Plant Breeding, 134,

612–622.

Page 20 of 62


Genome

Draft

21

Meyer, W., Hignight, K., and Tubbs, S. 2005. Boutique Kentucky bluegrass. U.S. plant variety

protection cert. no. 200200112.

Moore, D.M (ed.). 1982. Flora Europaea check-list and chromosome index. Cambridge, U.K.:

Cambridge University Press.

Murovec, J., Kastelec, D., and Vilhar, B. 2009. High variability of nuclear DNA content in

cultivars and natural populations of Poa pratensis L. in relation to morphological characters.

Acta Biologica Cracoviensia, 51: 45–52.

Nicora, E.G. 1977. Gramineas Argentinas nuevas. Hickenia, 1: 99–107.

Nicora, E.G. 1978. Gramineae. Flora Patagónica 8:1–583. Colect. Cient. INTA, Buenos

Aires.Oxford University Press.

Patterson, J.T., Larson, S.R., and Johnson, P.G. 2005. Genome relationships in polyploid Poa

pratensis and other Poa species inferred from phylogenetic analysis of nuclear and

chloroplast DNA sequences. Genome, 48: 76–87.

Phillips, S.M. 1989. The genus Poa (Gramineae) in Ethiopia. Kew Bulletin, 44: 127–137

Posada, D., and Crandall, K.A. 1998. Modeltest: testing the model of DNA substitution.

Bioinformatics, 14: 817–818.

Probatova, N.S. 1971. New species of meadow grass of the genus Poa L. from Yakutia. Novosti

Sist. Vyssh. Rast. 8: 25–27.

Probatova, N.S. 1974. De genere novo Arctopoa (Griseb.) Probot. (Poaceae). Novosti Sist.

Vyssh. Rast. 11: 44–54.

Raggi, L., Bitocchi, E., Russi, L., Marconi, G., Sharbel, T.F., Beronesi, F., and Albertini, E.

2015. Understanding genetic diversity and population structure of a Poa pratensis worldwide

collection through morphological, nuclear and chloroplast diversity analysis. Plos One, 10(4).

Page 21 of 62


Genome

Draft

22

Read, J.C., Reinert, J.A., Colbaugh, P.F., and Knoop, W.E. 1999. Registration of ‘Reveille’

hybrid bluegrass. Crop Sci. 39: 590.

Rose-Fricker, C.A., Smith, D.A., Bonos, S.A., and Meyer, W.A. 2007. Longhorn Kentucky

bluegrass. U.S. Plant variety protection application no. 200700091. Applied for.

Simmons, M.P., and Ochoterena, H. 2000. Gaps as characters in sequence-based phylogenetic

analysis. Systematic Biology, 49: 369–381.

Smith, D.A., and Meyer, W. A. 2009: Spitfire Kentucky bluegrass. U.S. Plant variety protection

application no.200900426.

Soreng, R.J. 1990. Chloroplast DNA phylogenetics and biogeography in a reticulating group:

study in Poa (Poaceae). American Journal Botany 77: 1383–1400.

Soreng, R.J. 1998. An infrageneric classification for Poa in North America, and other notes on

sections, species, and subspecies of Poa, Puccinellia, and Dissanthelium (Poaceae:Poeae).

Novon, 8: 187–202.

Soreng, R.J. 2005. Miscellaneous chromosome number reports for Poa (Poaceae) in North

America. Sida, 21(4): 2195–2203.

Soreng, R.J. 2007. Poa L. in Flora of North America, vol. 24, Magnoliophyta: Commelinidae (in

part): Poaceae, part 1. Flora of North America North of Mexico, vol. 24. Oxford University

Press, New York, 486−601.

Soreng, R.J., Bull, R.D., and Gillespie, L.J. 2010. Phylogeny and reticulation in Poa L. based on

plastid trnTLF and nrITS sequences with attention to diploids. In: Seberg, O., Petersen, G.,

Barfod, A.S. and Davis, J.I. (Eds.) Diversity, Phylogeny, and Evolution in the

monocotyledons, Aarhus University Press, Aarhus, 619–643.

Page 22 of 62


Genome

Draft

23

Speckmann, G.J., and Van Dijk, G.E. 1972. Chromosome number and plant morphology in some

ecotypes of Poa pratensis L. Euphytica 21:171–180.

Stebbins, G.L. 1950. Variation and evolution in plants. Columbia University Press, New York.

Swofford, D.L. 2002. PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods).

Sinauer Associates, Sunderland, Massachusetts.

Taberlet, P., Gielly, L., Pautou, G., and Bouvet, J. 1991. Universal primers for amplification of

three non-coding regions of chloroplast DNA. Plant Molecular Biology, 17: 1105–1109.

Tzvelev, N.N. 1964. Poa. In Arkticheskaya Flora SSSR, vol. 2, Gramineae, eds. O.V.

Rebristaya, A.K. Skvortsov, A.I. Tomachev, N.N. Tzvelev, and B.A. Yurtsev. [English

translation: 1995. Flora of the Russian Arctic, vol. 1, Polypodiaceae—Gramineae, eds. A.I.

Tolmachev and J.G. Packer, translator G.C.D. Griffiths. Edmonton: University of Alberta

Press.]. pp. 182–224.

Tzvelve, N.N. 1976. Zlaki SSSR. Nauka Publishers, Leningrad, Russia. [English translation:

1983. Grasses of the Soviet Union, Vol. 1 and 2. Amerind Publishing Co., New Delhi, India.

1196.

Weddin, W., and Huff, D.R. 1996. Bluegrasses. In L.E. Moser et al. (ed.) Cool-season forage

grasses. ASA, CSSA, and SSSA, Madison, WI.

Wieners, R.R., Fei, S., and Johnson, R.C. 2006. Characterization of a USDA Kentucky Bluegrass

(Poa pratensis L.) Core Collection for Reproductive Mode and DNA Content by Flow

Cytometry. Genet. Resour. Crop Evol. 53: 1531–1541.

Zhu, G.H., Liu, L., Soreng, R.J., and Olonova, M.V. 2006. Poa L. In Flora of China. vol. 22,

Poaceae, eds. Flora of China Editorial Committee. Saint Louis, Missouri, U.S.A.: Missouri

Botanical Garden Press. pp. 257–309.

Page 23 of 62


Genome

Draft

24

Table 1. Poa subgenera, sections, chloroplast lineages, and species sampled for sequence and

ploidy analysis.

*The chloroplast lineage is listed similar to Soreng et al. (2010).

†Somatic chromosome count.

‡Mean 2C content of up to five plants. Where only a single plant was sampled, no upper or lower

bounds are shown.

Subgenus Section Cp

lineage* Species

Source /

Accession Origin N 2n†

Mean

2C (pg)‡

Range

2C (pg)

Ochlopoa Alpinae A badensis PI 659654 Czech Republic 5 14 2.5 2.5

Ochlopoa Alpinae A pumila PI 662326 Turkey 4 14 2.5 2.5

Poa Macropoa P bucharica PI 659940 Kyrgyzstan 5 14 2.5 2.5

Poa Macropoa P sibirica W6 21559 Mongolia 5 14 2.5 2.5

Poa Macropoa P iberica GR 5932 Soviet Union 3 28 5.9 5.4-6.5

Poa Homalopoa P asiae-

minoris

R. Soreng Turkey 3 14 2.5 2.5

Poa Homalopoa P remota W6 30378 Kyrgyzstan 4 28 5.35 5-5.5

Poa Homalopoa H chaixii GR 11720 Germany 5 14 2.5 2.5

Poa Homalopoa H hybrida PI 249765 Greece 5 14 2.5 2.5

Poa Madropoa H nervosa PI 232352 Wyoming, USA 4 28 3.15 2.9-3.4

Poa Madropoa H macrantha W6 26828 California, USA 5 28 5.96 5.4-6.4

Poa Dioicopoa H ligularis PI 284255 Argentina 1 28 7.6 -

Poa Dioicopoa H iridifolia PI 284254 Argentina 5 28 8.12 7.6-8.4

Poa Dioicopoa H arachnifera J. Goldman Texas, USA 1 56 12.3 -

Poa Poa p pratensis cv. Midnight n/a 1 63 8.2 -

Stenopoa Stenopoa S nemoralis PI 371759 Alaska, USA 4 28 6.2 6-6.6

Stenopoa Stenopoa S palustris PI 232351 Montana, USA 3 28 5.8 5.7-5.9

Stenopoa Stenopoa S araratica GR 7280 Afghanistan 5 28 5.88 5.8-6

Stenopoa Pandemos V trivialis-1 GR 4757 Germany 5 14 2.5 2.5

Stenopoa Pandemos H trivialis-2 PI 594396 United States 5 14 2.5 2.5

- - - A. tibetica W6 30476 Kyrgyzstan 1 28 12.8 -

Page 24 of 62


Genome

Draft

25

Table 2. Chloroplast gene regions sequenced for 21 Poa species.

Gene Name Gene/Region

ID

Total

Length

Num. Pars.

Inf. Char.

Num.

InDels

trnT-trnL-trnF TLF 2120 195 54

Photosystem II protein M psbM 497 10 2

Photosystem I subunit VII psaC 551 11 1

Ribulose-1,5-bisphosphate carboxylase /

oxygenase

rbcL 1670 19 2

NADH-plastoquinone oxidoreductase

subunit J

ndhJ 719 19 1

Ribosomal protein S2 rps2 761 10 0

Page 25 of 62


Genome

Draft

26

Figure 1. Maximum likelihood phylogram of 29 Poa species based on a TLF gene region

listed in Table 2. Alphabetical groupings and black vertical bars correspond to chloroplast

lineages reported in Soreng et al. (2010). Gray vertical bars represent clades mentioned in the

text. Numbers represent bootstrap support for nodes.

Figure 2. Maximum likelihood phylogram of 21 Poa species based on a 5-gene combined

region listed in Table 2. Alphabetical groupings and black vertical bars correspond to

chloroplast lineages reported in Soreng et al. (2010). Gray vertical bars represent clades

mentioned in the text. Numbers represent bootstrap support for nodes.

Page 26 of 62


Genome

Draft

236x355mm (300 x 300 DPI)

Page 27 of 62


Genome

Draft

245x373mm (300 x 300 DPI)

Page 28 of 62


Genome

Draft

Supplemental Table I. Variable characters for the six chloroplast gene regions.

TLF

Po

siti

on

con

tig

ara

chn

ife

ra

ara

rati

ca

asi

ae

-min

ori

s

ba

de

nsi

s

bu

cha

rica

cha

ixii

hy

bri

da

ibe

rica

irid

ifo

lia

lig

ula

ris

ma

cra

nth

a

mid

nig

ht

ne

mo

rali

s

ne

rvo

sa

pa

lust

ris

pu

mil

a

rem

ota

sib

iric

a

7 A C X X

9 : A A A A A A X X A A

14 G X X

17 A : : G X : X : G

21 A : X : X :

34 T G X X G

39 T G X X

56 C X X A

60 G T X X T

64 T C X X

66 : T X X

77 : C X X

78 C X X A

97 G X X

105 A T X X T T

115 T X : X

117 : A X X A

120 A : : X X : : :

126 A : : X X : : :

127 C : : X X : : :

128 T : : X X : : :

129 T : : X X : : :

130 A : : X X : : :

131 T : : X X : : :

132 : X A X A

159 G T X X

161 T A X X

162 A T X X

189 A G X X C G

198 T : X X :

205 C A X X A

212 T G G X : G G G

222 A X

226 T X G G

228 C X T T

234 A X T

235 T X A

238 T A X A A : A

Page 29 of 62


Genome

Draft

239 A T T X T T T : T T

240 T X A :

241 T X :

242 T X :

243 : A X A A A

244 : T X T T T

245 : T X T T T

246 : T X T T T

250 T G X G

256 G X C

262 G T X

265 T G X

278 G X T

281 T X A

294 A C X

306 : G G X G

307 : G G X G

308 : A A X A

309 : A A X A

310 : A A X A

311 : A A X A

312 : T T X T

323 T X C

327 A G X G

329 T X G G

347 G T X T

350 C G X G G G

358 T G X

374 A T X T

377 : A X A

386 : T X T

387 : A X A

388 : T X T

389 : A X A

390 : T X T

391 : A X A

392 : T X T

393 : G X G

394 : A X A

395 : A X A

396 : A X A

397 : G X G

398 : A X A

399 : T X T

400 : A X A

401 : T X T

402 : A X A

Page 30 of 62


Genome

Draft

403 : A X A

404 : T X T

405 : A X A

406 : A X A

407 : A X A

408 : G X G

433 G X T T

451 A G G X G G G G

463 G A X A

476 T A X

482 T A X

495 T G X

512 G T X

519 A C C X C C C C

520 C G G X G G G

523 : T X T

524 : C X C

525 : G X G

526 : A X A

527 : C X C

528 : T X T

529 : C X C

530 : G X G

531 : A X A

532 : A X A

533 : G X G

534 : G X G

535 : G X G

536 : C X C

537 : T X T

538 : G X G

539 : C X C

540 : C X C

541 : A X A

542 : T X T

543 : T X T

544 : A X A

545 : G X G

546 : T X T

547 : G X G

548 : T X T

549 : T X T

550 : T X T

551 : C X C

552 : T X T

553 : T X T

554 : G X G

Page 31 of 62


Genome

Draft

558 C X

567 G T X T

576 G A X A

579 A G X G

584 A G X G

585 A X G

586 A : X

588 A X

595 C X T T

596 T G G X G G G

602 T C X

608 G T X T

615 T X G G

617 A T X T T T

618 A T X T T T

619 A X

620 : G X G G G

621 : A X A A A

622 : A X A A A

623 : A X A A A

624 : A X A A A

625 : A X A A A

626 : A X A A A

627 : T X T T T

628 : A X A A A

629 : A X A A A

630 : A X A A A

631 : A X A A A

662 A X T

663 G T T X T T T T

670 T C X C

671 T X A

672 A T X

673 A X

684 A C T X C C C

685 A T G X

686 G X A A

688 G A A X A A A

692 G A X A A A

696 G T X T

755 A T X

760 T C X C

766 T G X G

781 G A X A A

786 C X A

792 C X

804 G A X A

Page 32 of 62


Genome

Draft

806 C A A X A A A

812 G C C X C C C

822 C X

824 C G X G G G

832 G T T X T T T

842 A T X

845 C A X

854 : X

855 C A X

873 T : : X

881 A G X G

889 G T T X

890 T X C X

891 C X : X

892 T X : X

893 C X : X

894 : X A X

895 : X G X

896 : X G X

897 : X T X

898 : X C X

899 : X C X

900 : X A X

901 : X G X

902 : X C X

903 : X A X

904 : X T X

905 : X A X

906 : X G X

907 : X G X

908 : X T X

909 : X A X

912 A X C X C C C

916 G X X X T

945 : T X X

968 T X C

1,074 G A A

1,165 G

1,178 C T

1,181 C T T

1,182 G : :

1,183 A : :

1,184 A : :

1,185 A : :

1,186 T : :

1,187 T : :

1,188 C : :

Page 33 of 62


Genome

Draft

1,189 T : :

1,190 A : :

1,191 A : :

1,192 A : :

1,193 A : :

1,194 A : :

1,195 G : :

1,196 A : :

1,197 A : :

1,198 G : :

1,199 G : :

1,200 G : :

1,201 C : :

1,202 T : :

1,203 T : :

1,204 T : :

1,205 A : :

1,206 T : :

1,207 : T

1,208 : T

1,209 : T

1,210 : A

1,211 : T

1,212 A : :

1,213 C : :

1,214 A : :

1,215 G : :

1,216 C : :

1,217 T : :

1,231 A C C

1,238 G T T

1,240 G C C

1,263 G A A A A A

1,267 A : : : : : :

1,268 T : : : : : :

1,269 A : : : : : :

1,270 T : : : : : :

1,271 T : : : : : :

1,275 A T T T T T T

1,278 T G

1,284 T

1,308 G : :

1,309 A : C : C

1,310 A : :

1,311 A : :

1,312 T : : : : : :

1,313 T : : : : : :

Page 34 of 62


Genome

Draft

1,314 T : : : : : :

1,315 G : : : : : :

1,316 A : : : : : :

1,317 A : : : : : :

1,318 A : : : : : :

1,319 T : :

1,320 A : :

1,321 G : :

1,322 A : :

1,323 A : :

1,324 A : :

1,325 T : :

1,326 G : :

1,327 A : :

1,328 T : :

1,329 T : :

1,330 A : :

1,331 T : :

1,344 T G

1,346 A T

1,347 T G G

1,357 A C C

1,366 G

1,367 T

1,368 G

1,408 A G G G G G G G

1,411 C T T T

1,414 A

1,420 G T

1,426 T G G G

1,449 C T T T

1,486 C T T T

1,531 A C

1,537 C T

1,563 C :

1,570 T C C C

1,572 C

1,586 T

1,590 : A A

1,591 : G G

1,592 : T T

1,593 : A A

1,594 : T T

1,597 C T T T T T T T

1,598 T A A A A A A A

1,601 A T T T T T T T

1,602 T A A A A A A A

Page 35 of 62


Genome

Draft

1,604 C : : : : : : :

1,605 C : : : : : : :

1,606 C : : : : : : :

1,607 T : : : : : : :

1,608 A : : : : : : :

1,609 A : : : : : : :

1,610 C : : : : : : :

1,611 T : : : : : : :

1,612 T : : : : : : :

1,613 A : : : : : : :

1,614 T : : : : : : :

1,615 A : : : : : : :

1,616 G : : : : : : :

1,617 T : : : : : : :

1,618 A : : : : : : :

1,619 T : : : : : : :

1,620 T : : : : : : :

1,621 T : : : : : : :

1,622 A : : : : : : :

1,623 T : : : : : : :

1,630 T :

1,631 : T

1,648 : G G G

1,649 : T T T

1,650 : C C C

1,651 : A A A

1,652 : A A A

1,653 : T T T

1,697 G

1,702 G A A A

1,735 A C C

1,751 :

1,752 :

1,753 :

1,754 :

1,755 :

1,756 :

1,757 :

1,758 :

1,759 :

1,760 :

1,761 :

1,763 G

1,764 A G G

1,768 T

1,769 C

1,770 G

Page 36 of 62


Genome

Draft

1,771 G

1,772 G

1,773 A

1,774 A

1,775 G

1,776 G

1,779 T C C

1,782 C

1,783 G

1,784 G

1,785 T

1,786 T

1,787 A

1,788 T

1,789 T

1,790 C

1,791 A

1,792 A

1,793 T

1,794 C

1,795 T

1,796 A C C C C C C C

1,797 T

1,798 T

1,799 T

1,800 T

1,801 T

1,802 T

1,803 C

1,804 A

1,805 G

1,806 : T T

1,807 : T T

1,808 : T T

1,809 : T T

1,810 : T T

1,811 : T T

1,812 : C C

1,813 : A A

1,814 : G G

1,815 T

1,816 A

1,817 T

1,818 T

1,819 A

1,820 T

1,821 T

Page 37 of 62


Genome

Draft

1,822 A

1,823 A

1,824 G

1,825 T

1,826 A

1,827 A

1,828 A

1,829 C

1,830 C

1,852 T C C C C C

1,853 C T T T

1,858 : C C

1,859 : C C

1,860 : C C

1,861 : C C

1,862 G

1,864 T A

1,869 A

1,875 A : :

1,876 G : :

1,877 A : :

1,878 A : :

1,879 T : :

1,880 T : :

1,881 T : :

1,901 A

1,905 T

1,993 G A

Total Differences 41 93 17 215 28 8 30 1 41 60 16 12 93 19 92 180 13 16

psbM

62 A C

74 A G G

97 A G

131 A G G G

137 C T T T T T T

143 T G G

156 C G

160 C T T

186 C T T T

256 G C C C C C C

263 T C C

326 C T

416 T X G

439 T X

444 G T X T

464 T X :

Page 38 of 62


Genome

Draft

465 A : : : : X : :

466 A : : : : X : :

467 A : : : : X : :

468 T A A A A X A A


psaC

32 G X X

108 A X

170 G

344 T A A A

345 G C C

420 T G G G G

424 C A

436 C X T

437 T C X C C

442 G A X A A A A A

479 T X X X

484 T X X X G

493 C X X X A

500 A X X X G

501 : X X X

502 : X X X

503 T X X X

505 C X X X

507 : X X X

516 A X X G X X

547 A X X X G X


rbcL

50 A X X X C

57 T : X X X

58 T : X X X

59 T : X X X

60 C : T X X X

61 G : X X X

62 T : X X X

63 T : X X X

64 T : X X X

65 A : X X X C

66 T : X X X

67 T : X X X

68 T : X X X

69 T : X X X

70 T : X X X

71 T : X X X

Page 39 of 62


Genome

Draft

72 A : X X X

73 : X X X T

74 T : X X X

75 T : X X X

76 T : X X X

77 A : X X X

78 G : X X X

79 A : X X X G

80 C : X X X

81 C : X X X

82 T : X X X

83 T : X X X

84 C : X X X

85 T : X X X : : :

86 T : X X X : : :

87 T : X X X : : :

88 A : X X X : : :

89 T : X X X : : :

90 A : X X X : : :

91 T : X X X : : :

92 T : X X X : : :

93 T : X X X : : :

94 A : X X X : : :

95 G : X X X : : :

96 T : X X X : : :

97 T : X X X : : :

98 T : X X X : : :

99 T : X X X : : :

100 A : X X X : : :

101 T : X X X : : :

102 C : X X X : : :

103 T : X X X : : :

104 A : X X X : : :

105 G : C X X X T : : C :

106 T : X X X

107 T : X X X

108 A : X X X

109 T : X X X

110 C : X X X

123 C T X X X T

124 G T X X X T

125 G A X X X A

126 C T : X X X : T T

127 T X X X : :

128 C X X X : :

129 : G X X X G G G G

130 : A X X X A A A A

Page 40 of 62


Genome

Draft

131 : T X X X T

132 : A X X X A A A A

133 : G X X X G

134 : T X X X T

135 : A X X X A

136 : T X X X T

137 : C X X X C

138 : T X X X T

139 : A X X X A

140 : C X X X C

141 : C X X X C

142 : G X X X G

143 : G X X X G

144 : C X X X C

145 : T X X X T T T

146 : C X X X C C C

147 G X X X : : :

148 A X X X : : :

149 A X X X : : :

318 T X X X

391 G X X :

443 T A X X A A

463 : A X X

475 G X X A

484 G A X X A A A A

487 : X X T T T

506 G A

533 C A

574 C A A A

588 : C

642 T C

721 C G G G

794 C T T T T

804 A C C C C

867 A G G G

891 A G G G

943 : T T

978 G : X

985 C X T

1,007 : X T T

1,008 T X

1,028 T X :

1,100 A X G G

1,120 T X : :

1,126 C T X T T

1,481 G A X A A A

1,519 G T X T

Page 41 of 62


Genome

Draft

1,557 A X G

1,644 T X X X

1,650 T X X G X

1,651 A X X T X

1,652 T X X A X

1,653 : X X A X C

1,654 : X X A G X G

1,655 : X X A T X T

1,656 : X X A X

1,657 : X X A X A

1,658 : X X T X A

1,659 : X X A A X A

1,660 : X X T X

1,661 C X X A : X :

1,662 G X X : X :

1,663 T X X : X :

1,664 A X X : X :

1,668 C X A X X :


ndhJ

25 G T X X T

59 A G X X G

62 G T X T T X

86 G X X

189 G A X

212 C X T

272 G C X C

311 A C C C C X C

341 A G G

397 A X

404 C X T T

446 G X A A

455 A X G G

470 T X G G A

476 T X C

553 G X T

559 C X A

565 C X T

572 A X C C

573 C X A A

586 G X T T

591 T X G

621 G X A

636 A X G G

649 C X T T

668 C X G X

Page 42 of 62


Genome

Draft

707 A X T T T X

709 A X T T T X

710 A X C C C X

711 T X A A A X

712 G X T T T X

715 C X T T T X


rps2

1 T C X X

2 C X X A

109 A G

161 :

178 T G G G G G G

238 : A

389 A G X X G

392 A G X X G

403 A T X X T

479 C X T X

512 C X X T

572 G X A X

620 A C C X C X C

629 A T X X T

638 T X X

642 A : X X

656 G X X

699 T C X C C X

707 C T X X T

754 C A X X

760 C T X X T


Page 43 of 62


Genome

Draft

Page 44 of 62


Genome

Draft

Page 45 of 62


Genome

Draft

tib

eti

ca

triv

iali

s-1

triv

iali

s-2

Nu

mb

er

of

Va

ria

nts

X 1

X 8

A X 1

X : 7

X 3

X 3

X 1

X 1

X 3

X 1

X 1

X 1

X 1

T X 1

X T 4

X 1

A X A 5

: X : 8

: X : 8

: X : 8

: X : 8

: X : 8

: X : 8

: X : 8

X 2

X 1

X 1

X 1

X 4

X 3

A X 4

G X G 9

X 1

X 2

X 2

X 1

X 1

X A 6

Page 46 of 62


Genome

Draft

X T 10

X 2

X 1

X 1

X A 5

X T 5

X T 5

X T 5

X 3

X 1

X 1

X 1

X 1

X 1

X 1

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 1

G X 4

X 2

X 3

X 4

X 1

X 3

X 3

X T 3

X A 3

X C 3

X A 3

X T 3

X A 3

X G 3

X A 3

X A 3

X A 3

X A 3

X G 3

X A 3

X A 3

X T 3

X A 3

X A 3

Page 47 of 62


Genome

Draft

X T 3

X A 3

X 2

X 2

X 2

X 2

X 2

G X G 9

X 3

X 1

X 1

X 1

X 1

C X C 9

X 5

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

Page 48 of 62


Genome

Draft

X G 1

X 3

X 3

X 2

X 3

X 1

X 1

C X 1

X 2

X G 6

X 1

X 3

A X 3

X T 5

X T 5

: X 1

X G 5

X A 5

X A 5

X A 5

X A 5

X A 5

X A 5

X A 5

X A 5

X A 5

X 4

X 4

X 1

X T 7

C X 4

X 1

X 1

T X 1

C X C 7

X 2

X 2

A X A 8

X A 5

X 3

X 1

X 2

X 3

X A 4

X 1

T X 1

X 2

Page 49 of 62


Genome

Draft

X 5

X 5

A X 1

X 4

X 5

X 1

A X 2

A X A 2

X 1

X 2

G X 4

X 2

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X 1

X C 5

X 2

X 1

X 1

X 3

X 1

X 1

X 3

T X 4

X 3

X 3

X 3

X 3

X 3

X 3

Page 50 of 62


Genome

Draft

G X 4

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 1

X 1

X 1

X 1

X 1

X 3

X 3

X 3

T X 4

X 3

X 3

X 3

X 3

C X 4

A X A 8

: X : 9

: X : 9

: X : 9

: X : 9

: X : 9

T X T 9

X 1

A X 1

T X 4

T X 6

X 3

G X 4

A X : 9

A X : 9

Page 51 of 62


Genome

Draft

X : 8

X : 8

X : 8

X : 8

X : 8

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 1

T X 2

G X 4

X 3

X T 1

G X 1

A X 1

X 7

X 3

X G 1

X 1

X 3

X 3

X 3

X 1

X 1

X 1

X C 4

X : 1

X G 1

X 2

X 2

X 2

X 2

X 2

X T 9

X A 9

X T 9

X A 9

Page 52 of 62


Genome

Draft

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 9

X : 2

X 1

X G 4

X T 4

X C 4

X A 4

X A 4

X T 4

X A 1

X A 4

X 2

X T 1

X C 1

X A 1

X G 1

X T 1

X A 1

X T 1

X T 1

X A 1

X T 1

X T 1

X : 1

X 2

X : 1

X : 1

X : 1

Page 53 of 62


Genome

Draft

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 3

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

C X : 2

X : 1

X : 1

X : 1

X : 8

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

Page 54 of 62


Genome

Draft

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

X : 1

C X C 8

X T 4

X 3

X 3

X 2

X 2

A X 1

X 1

C X 1

X 3

X 3

X 3

X 3

X 3

X 3

X 3

X C 1

X 1

X 1

52 176

1

2

1

G G 5

T T 8

2

1

2

3

C C C 9

2

1

1

C C 2

2

1

Page 55 of 62


Genome

Draft

6

6

6

6

1 4 4

T 1

T 1

A 1

A A 5

2

G G 6

A 2

1

C 4

6

A A 2

1

1

1

A A 2

C C 2

C C 2

A A 2

A A 2

1

1

4 9 8

C 2

1

1

1

2

1

1

1

1

2

1

1

1

1

1

1

Page 56 of 62


Genome

Draft

1

T 2

1

1

1

1

1

2

1

1

1

1

1

4

4

4

4

4

4

4

4

4

4

4

4

4

4

4

4

4

4

4

4

C 8

1

1

1

1

1

2

2

2

T T 7

2

2

5

5

Page 57 of 62


Genome

Draft

2

5

2

2

2

2

2

2

2

2

2

2

2

2

4

4

3

3

3

C 1

1

A 4

1

A A 3

A A A 8

T T 5

1

1

A 4

1

1

3

T T 6

C C 6

G 4

G 4

2

1

1

2

: : 2

: : 3

2

2

T 4

A A 6

2

Page 58 of 62


Genome

Draft

1

C 1

1

C 2

1

A A 4

G G 5

T T 5

A A 3

A A 4

A A 4

A A 5

C C 3

: : 5

: : 4

: : 4

: : 4

2

12 21 21

2

G 3

T T 5

T 1

1

1

2

5

2

: 1

2

2

2

A A 5

1

1

1

T T 3

2

A A 4

2

G G 3

A A 3

G 3

2

G G 3

Page 59 of 62


Genome

Draft

3

3

3

3

3

3

3 8 7

X 1

X 1

X 1

X T 1

X 6

X A 2

X 2

X 2

T 3

X 1

X 1

X 1

C X C 6

X 2

A X 1

X 1

T X 1

X C 4

X 2

X 1

X 2

4 0 4

Page 60 of 62


Genome

Draft

Page 61 of 62


Genome

Draft

Page 62 of 62


Genome

Documents

Draft - University of Toronto T-SpaceDraft 7 DNA extraction and sequencing of the TLF region. A representative plant from each of the 21 accessions, based on ploidy analysis, was selected