3223RESEARCH ARTICLE

INTRODUCTIONRecent studies have linked together the action of several tumor

suppressors into a Fat-Hippo-Warts signaling network (reviewed by

Reddy and Irvine, 2008). These genes play a crucial role in growth

control from Drosophila to mammals, as exemplified by the ever-

increasing number of cancers that have been associated with

mutations in pathway genes (Steinhardt et al., 2008; Zeng and Hong,

2008). Fat-Warts signaling regulates growth through a

transcriptional co-activator protein, called Yorkie (Yki) in

Drosophila and YAP in vertebrates (Dong et al., 2007; Huang et al.,

2005). In addition, Fat influences a distinct planar cell polarity (PCP)

pathway (reviewed by Reddy and Irvine, 2008; Strutt, 2008). Planar

cell polarity is the polarization of cells within the plane of a tissue,

and can include both polarized structures, like hairs and bristles, and

polarized behaviors, such as cell division and cell intercalation

(Strutt, 2008).

Fat is a large member of the cadherin family, and acts as a

transmembrane receptor (reviewed by Reddy and Irvine, 2008). Fat

influences the subcellular localization of both the unconventional

myosin Dachs and the FERM-domain protein Expanded, and

through these proteins ultimately regulates the kinase Warts (Bennett

and Harvey, 2006; Cho et al., 2006; Feng and Irvine, 2007; Mao et

al., 2006; Silva et al., 2006; Tyler and Baker, 2007; Willecke et al.,

2006). Warts then inhibits Yki by phosphorylating it:

phosphorylated Yki is retained in the cytoplasm, but

unphosphorylated Yki enters the nucleus to promote the

transcription of target genes (Dong et al., 2007; Oh and Irvine, 2008;

Zhao et al., 2007). The Fat PCP pathway is less well characterized,

but it is partially dependent upon Dachs (Mao et al., 2006), and also

involves Atrophin (Grunge), a transcriptional co-repressor that can

bind to the Fat cytoplasmic domain (Fanto et al., 2003).

The only Fat ligand identified is Dachsous (Ds), which like Fat

is a large, atypical cadherin (Clark et al., 1995), and which

influences the phosphorylation of Fat by Discs overgrown (Feng

and Irvine, 2009; Sopko et al., 2009). ds mutants have phenotypes

similar to, but weaker than, those of fat mutants, raising the

possibility that there might be other ligands, or other means of

regulating Fat. The Golgi kinase Four-jointed (Fj) also regulates

Fat signaling, but presumably acts by modulating Fat-Ds

interactions (Ishikawa et al., 2008; Reddy and Irvine, 2008).

Intriguingly, the two known Fat pathway regulators (ds and fj) are

expressed in gradients in developing tissues (Clark et al., 1995;

Villano and Katz, 1995). The vectors (directions) of these

gradients parallel vectors of PCP, and experimental manipulations

of ds and fj indicate that, at least in some tissues, their graded

expression can direct PCP (Adler et al., 1998; Casal et al., 2002;

Simon, 2004; Strutt and Strutt, 2002; Yang et al., 2002; Zeidler et

al., 1999). The graded expression of ds and fj also influences the

transcriptional branch of the pathway and wing growth, but in this

case it is the slope rather than the vector of their gradients that

appears to be instructive (Cho et al., 2006; Cho and Irvine, 2004;

Reddy and Irvine, 2008; Rogulja et al., 2008; Willecke et al.,

2008).

Although thus far most components of Fat signaling have been

identified through genetic studies in Drosophila, protein interaction

screens are an alternative approach with which to identify

components of signaling pathways. A genome-wide yeast two-

hybrid screen identified the product of the CG13139 gene as both a

candidate Fat-interacting protein and a candidate Ds-interacting

protein (Giot et al., 2003). This gene, which we have named lowfat(lft), encodes a small protein of unknown structure and biochemical

function. It shares sequence similarity with two vertebrate genes,

Limb expression 1 (Lix1) and Lix1-like (Lix1l; Fig. 1A). Lix1 was

first identified in chickens through a differential screen for genes

expressed during early limb development (Swindell et al., 2001).

Subsequent analysis in mice revealed that Lix1 is actually expressed

more broadly (Moeller et al., 2002). Lix1l has been defined only by

its sequence similarity to Lix1. The biological functions of these

genes have not been described, although genetic mapping of a feline

spinal muscular atrophy identified LIX1 as a candidate gene (Fyfe et

al., 2006).

Drosophila lowfat, a novel modulator of Fat signalingYaopan Mao*, Binnaz Kucuk* and Kenneth D. Irvine†

The Fat-Hippo-Warts signaling network regulates both transcription and planar cell polarity. Despite its crucial importance to thenormal control of growth and planar polarity, we have only a limited understanding of the mechanisms that regulate Fat. Wereport here the identification of a conserved cytoplasmic protein, Lowfat (Lft), as a modulator of Fat signaling. Drosophila Lft, andits human homologs LIX1 and LIX1-like, bind to the cytoplasmic domains of the Fat ligand Dachsous, the receptor protein Fat, andits human homolog FAT4. Lft protein can localize to the sub-apical membrane in disc cells, and this membrane localization isinfluenced by Fat and Dachsous. Lft expression is normally upregulated along the dorsoventral boundary of the developing wing,and is responsible for elevated levels of Fat protein there. Levels of Fat and Dachsous protein are reduced in lft mutant cells, andcan be increased by overexpression of Lft. lft mutant animals exhibit a wing phenotype similar to that of animals with weak allelesof fat, and lft interacts genetically with both fat and dachsous. These studies identify Lft as a novel component of the Fat signalingpathway, and the Lft-mediated elevation of Fat levels as a mechanism for modulating Fat signaling.

KEY WORDS: Drosophila, Fat, Hippo, Lix1, PCP, Signaling

Development 136, 3223-3233 (2009) doi:10.1242/dev.036152

Howard Hughes Medical Institute, Waksman Institute and Department of MolecularBiology and Biochemistry, Rutgers The State University of New Jersey, Piscataway,NJ 08854, USA.

*These authors contributed equally to this work†Author for correspondence (irvine@waksman.rutgers.edu)

Accepted 22 July 2009 DEVELO

PMENT

3224

While a basic outline of Fat signaling has emerged, many steps

remain poorly understood. Here, we show that lft is a modulator of

Fat signaling, and identify a cellular requirement for Lft in

establishing normal levels of both Fat and Ds. Our observations

identify transcriptional regulation of lft as a potential mechanism for

modulating Fat signaling through its post-translational regulation of

Fat and Ds protein levels. We also establish human LIX1L as a

functional homolog of Lft, and LIX1 and LIX1L as Fat-interacting

proteins, thus identifying a likely cellular function of vertebrate Lix1genes as modulators of Fat signaling. This linkage raises the

possibility that other Fat pathway components could be candidate

susceptibility loci for spinal muscular atrophy.

MATERIALS AND METHODSDrosophila stocks and crossesUnless otherwise noted, crosses were conducted at 25°C. Gal4 lines

employed included ptc-Gal4, en-Gal4, act-Gal4[3rd chromosome] and tub-Gal4[LL7]. ds and fat mutant stocks employed have been described

previously (Cho et al., 2006; Cho and Irvine, 2004).

A null mutation in lft was created using ends-out homologous

recombination-mediated gene targeting (Gong and Golic, 2003). The

targeting vector included a 5000-bp left arm and a 3680-bp right arm,

amplified by PCR from wild-type (Oregon-R) genomic DNA and cloned

into pW25 (Gong and Golic, 2003). The left arm 3� end is 40-bp upstream

of the lft start codon, and the right arm 5� end is 16-bp upstream the lft stop

codon. Third chromosome transgenic lines, W25-TG2 and W25-TG4, were

crossed to hs-Flp; hs-I-SceI/TM3, and heat shocked at 38°C for one hour

three days after egg laying. Progeny with mosaic eyes were crossed to hs-Flp-70 lines, and their progeny with non-mosaic eyes were balanced over

CyO. Southern blotting and PCR were performed to confirm correct

targeting. The targeted line lftTG2 was used for all experiments.

Primers for creating the targeting construct were as follows:

Left arm, CG13139-960 5�-GGTCCATTGCGGCCGCGCTGCC -

TGCGAGCTACGGTGCTCAAAA-3� and CG13139-5964 5�-GACG -

GTACCGGTTTCGGGTTTCGTTTTCAGCACAAA-3�;Right arm, CG13139-7013 5�-TGAGGCGCGCCCGGCTA CCAT -

TGATGATTA-3� CG13139-10775 5�-CCGGACCGGGTGG AAGAAT-3�.TILLING was performed by the Seattle TILLING Project

(http://tilling.fhcrc.org). The screened region covered 1464 bp, including

part of the promoter region and the first 214 codons. The primers sequences

were 5�-TGGTCCGTTCTCCTGGATAAAATAAAAGTG-3� (left primer)

and 5�-ATTATCGTGCTCCCTGGCAATCCAAT-3� (right primer).

For the creation of conventional mutant clones, lftTG2 FRT40A, dsUAO71

FRT40A/CyO Kr-Gal4 UAS GFP, fatG-rv FRT40A/CyO GFP, fatG-rv lftTG2

FRT40A/CyO GFP or dsUA071 lftTG2 FRT40A/CyO GFP were crossed to y whs-FLP[122]; Ubi-GFP FRT40A/CyO.

For the creation of MARCM clones, lftTG2 FRT40A; UAS-d:V5[9F], fat8FRT40A; UAS-lft:FLAG[6] or dsUAO71 FRT40A; UAS-lft:FLAG[6] were

crossed to y w hs-FLP tub-Gal4 UAS-GFP/FM7; tub-Gal80 FRT40A/CyO.

For the examination of wing disc growth, en-Gal4 UAS-GFP/CyO; UAS-dcr2/TM6B flies were crossed to RNAi ds (vdrc36219), RNAi lft and RNAids (vdrc36219); RNAi lft /TM6B flies, and cultured at 28.5°C.

Two methods were used to establish transgenic lines expressing FLAG-

tagged lft. For P-mediated transformation, pUAST-Flag:lft was created, and

insertions were isolated on the second (UAS-FLAG:lft[H]) and third

(UAS-FLAG:lft[G]/TM6B, UAS-FLAG:lft[F]/TM6B and UAS-FLAG:lft[6]/TM6B) chromosomes. In order to compare the activities of lftversus its mammalian homologs, we used phiC31-mediated site-specific

integration to insert transgenes into the attP site at 68A (Groth et al., 2004).

Plasmids pUASTattB-3xFlagCG13139, pUASTattB-3xFlagLIX1 and

pUASTattB-LIX1L were used to create the transgenic fly lines

UAS-FLAG:lft[attP68A], UAS-FLAG:LIX1[attP68A], and UAS-FLAG:LIX1L[attP68A], respectively.

To investigate the consequences of reducing lft on fat mRNA expression,

en-Gal4, UAS-GFP/CyO; dcr2/TM6B flies were crossed to UAS-RNAi lft(NIG13139R-1), and, as a control, to UAS-RNAi fat (vdrc 9396), and

cultured at 28.5°C. To investigate regulation of lft mRNA, en-Gal4, UAS-

GFP/CyO; dcr2/TM6B flies were crossed to UAS-RNAi fat, UAS-RNAiwarts (vdrc 9928), UAS-RNAi Notch (NIG 3936R-3) or w– controls and

cultured at 28.5°C. Regulation by Notch was also confirmed by crossing

UAS-ECN:FLAG (dominant negative Notch) to ptc-Gal4. Knockdown of

Wg signaling was lethal, so regulation by Wg signaling was investigated by

crossing UAS-sgg to ptc-Gal4 UAS-GFP;UAS-Gal80ts/TM6B. Flies were

kept at 18°C, and then shifted to 29°C for 48 hours to allow expression of

Sgg (GSK3β) before dissecting.

For rescue experiments, lftTG2 FRT40A; tub-Gal4/TM6B was crossed to

lftTG2 FRT40A; UAS-FLAG:lft[F]/TM6B, lftTG2 FRT40A; UAS-FLAG:lft[attP68A], lftTG2 FRT40A; UAS-FLAG:LIX1[attP68A] or lftTG2

FRT40A;UAS-FLAG:LIX1L[attP68A].

To examine the influence of ft or ds mutant clones on FLAG:Lft

localization, hs-Flp, arm-lacZ/CyO; act-Gal4/TM6B was crossed to ft8

FRT40A/CyO; UAS-FLAG:lft[G]/TM6B or dsUA071 FRT40A /CyO; UAS-FLAG:lft[G]/TM6B.

Histology and imagingDiscs were fixed and stained as described previously (Cho and Irvine, 2004),

using mouse anti-Wg [1:800, 4D4, Developmental Studies Hybridoma Bank

(DSHB)], rat anti-Fat (1:400) (Feng and Irvine, 2009), rat anti-Ds (1:200,

M. Simon, Stanford University, Stanford, USA), mouse anti-V5 (1:400,

Invitrogen), mouse anti-Flag (1:600, Sigma), mouse anti-Diap1 (1:500, gift

of B. Hay, Cal Tech, Pasadena, USA), rat anti-Elav (1:20, 7E8A10, DSHB),

mouse anti-Pros (1:50, MR1A, DSHB), goat anti-β-gal (1:1000, Biogenesis)

and rat anti-E-Cad (1:40, DSHB). Fluorescent stains were captured on a

Leica TCS-SP5 confocal laser scanning microscope. For horizontal sections,

maximum projection using Leica software was employed to allow

visualization of staining in different focal planes.

In situ hybridization was carried out as described previously (Rauskolb

and Irvine, 1999). For lft, an antisense RNA probe derived from the full-

length coding region of lft was used, and discs from lftTG2 were used as a

negative control. For fat, an antisense RNA probe derived from cDNA

encoding the intracellular domain of Fat was used, and a sense probe was

used as a negative control.

Photoshop and Image J were used for measurements of wing areas and

distances. Prism (Graphpad) was used for statistical analyses.

Co-immunoprecipitation and western blottingCo-immunoprecipitation experiments were performed as described

previously (Cho et al., 2006), using cell lysates prepared in

radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl pH 7.5,

150 mM NaCl, 1 mM EDTA, 1% NP40, 0.1% SDS, 0.5% Na deoxycholate).

Cell debris was precipitated by centrifugation with a table-top centrifuge at

15,700 g for 15 minutes. The supernatant was mixed with anti-FLAG M2

beads (Sigma); after overnight incubation, beads were washed seven times

with RIPA buffer and then boiled in SDS-PAGE loading buffer.

Wing imaginal discs for the western blotting experiment were collected

from wild-type (w–), lftTG2, and the progeny of act-Gal4/TM6B crossed to

UAS-FLAG:lft[F], UAS-FLAG:lft[6]. Flies were allowed to lay for 5-6

hours, and wing discs were collected 96 hours later. Wing discs were

dissected in ice-cold HyQ CCM3 serum-free medium (Hyclone, catalog

number SH30065.01), and approximately 30 discs were pelleted at 1500 gfor 4 minutes and then flash frozen in dry ice/ethanol and stored at –80°C.

For chemiluminescence western blotting, we used mouse anti-V5-HRP

(1:6000, Invitrogen), mouse anti-FLAG M2-HRP (1:100,000, Sigma),

mouse anti-α-Tubulin (1:4000, Sigma) and rat anti-Fat (1:4000). For

quantitative western blotting, immunofluorescent secondary antibodies were

used [anti-mouse IgG IRDye700 (LiCor) and anti-rat IgG IRDye800

(Rockwell)], and gels were captured on a Li-Cor Odyssey infrared imaging

system and analyzed using Li-Cor software.

Plasmid constructspUAST-Fat-TM-ICD:V5 was constructed from pUAST-fat-STI-4 (Feng and

Irvine, 2009) by digesting with KpnI and XbaI to remove an existing triple

epitope tag, and then ligating with oligonucleotides (5�-CGGTAAG -

CCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGG -

TCATCATCACCATCACCATTGAGTTTAAGAATTCT-3� and 5�-CTA -

RESEARCH ARTICLE Development 136 (19)

DEVELO

PMENT

GAGAATTCTTAAACTCAATGGTGATGGTGATGATGACCG GTACG -

CGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACC G -

GTAC-3�) to insert V5 and His tags.

pUAST-Ds-TM-ICD:V5 was constructed by PCR amplifying the Ds

transmembrane and intracellular domains from genomic DNA (using the

forward primer 5�-GCCTTTCCGCGAAGAAGAGCCG GTGGTTC -

GTCAAGTGGTTCCATT-3� and the reverse primer 5�-GCAG GTA C -

CCATCCGTGTCCCCACATTTCCCCTCTGACTT-3�). The PCR product

was digested with SapI and KpnI, and ligated into SapI/KpnI cut pUAST-

fatSTI-4, to create a fusion gene utilizing the Fat signal peptide but the Ds

transmembrane and cytoplasmic domains. The C-terminal tags were then

exchanged as described above for Fat-TM-ICD-V5.

pUAST-TM-EGFP:V5 was constructed by PCR amplifying EGFP from

pmaxEGFP (Amaxa) using the forward primer 5�-GCACCGCGG -

AACTAGTGCCACCATGCCCGCCATGAA-3� (adding a SacII site) and

the reverse primer 5�-GCAGGTAC CTCGAG CTCGAGATCTGGCGAA-

3� (adding a KpnI site), and digesting the PCR product with SacII/KpnI. This

fragment was then cloned into SacII/KpnI cut pUAST-Ft-TM-ICD, which

leaves the transmembrane domain and five amino acids of the predicted Fat

cytoplasmic domain. The C-terminal tags were then exchanged as described

above.

pUAST- FAT4-TM-ICD:V5 was constructed from pUAST-FAT4-TM-

ICD:FLAG (Y. Feng) using a PCR product (forward primer, 5�-CTGAAGCCTCGAAGGTACCACGGTCGCAGGGCC-3�; reverse

primer, 5�-GGGGTACCTCAACCGGTACGCGTAGAATCGAG ACCG -

AGGAGAGGGTTAGGGATAGGCTTACCCACATACTGTTCTGCT-3�)to exchange the existing FLAG tag for a V5 tag.

pUAST-Fat-TM-ICD-�C:V5 was constructed by PCR amplifying the

portion of the fat intracellular domain to be retained (using the forward

primer, GGGAATTCGTTAACAGATCTGCG GCCGCATGGAG AGG -

CTA and the reverse primer, TCTAGATTATCAACCGGT ACGC -

GTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCCT -

CGAATCCATCGTA), digesting with EcoRI and XbaI, and then using this

fragment to replace the corresponding region of Fat-TM-ICD:V5. The

resulting construct lacks the C-terminal 99 codons of Fat.

pUAST-TM-EGFP+Ft-C:V5 was constructed by PCR amplifying the C-

terminal 99 codons from pUAST- Fat-TM-ICD:V5 (using the forward

primer, GGGGTACCCTGGCCGCCGCCTCATCATTTCGCGGAT and

the reverse primer, GGGGTACCTCCCACGTACTCCTCTGGAGCC).

This PCR product was then digested with KpnI, and ligated into KpnI cut

pUAST-EGFP:V5.

lft constructs were generated from a full-length cDNA, amplified by

RT-PCR from wild-type (Oregon-R) larvae using a one-step RT-PCR kit

(Qiagen) (using CG13139-UPinfrm, 5�-GTACCCGGGGA TGGTC TAT -

CCCGAAGAACCTTTT-3� and CG13139-lower, 5�-CCGGC TGCA -

GTT AATCATCAATGGTAGCCGAGTTAA-3�). This PCR product,

together with a triple FLAG epitope tag at the 5� end, was cloned into

pUAST and pUASTattB using XhoI and XbaI sites. The constructed

plasmids were named pUAST-FlagCG13139 and pUASTattB-

3xFlagCG13139, respectively. Human cDNAs of LIX1 and LIX1-likewere obtained from the ATCC and cloned by PCR (using the primers

hlix1up, 5�-GACGGTACCAGGCCTATGGACAGAACCTTGGAATC -

TCT-3� and hlix1lw, 5�-GACGCTAGCGGGCTTGGCCTTGCTAGT -

GATA-3� for human LIX1; and hlix1Lup, 5�-GACGGTACCA GGCCT -

ATGG AGA CTATGCGAGCGCA-3� and hlix1Llw, 5�-GACGCTAGC -

GGGTGGATG CCTAGCAGTTGGAA-3� for human LIX1-like) into

pUAST-FlagCG13139 using KpnI and NheI/XbaI sites, replacing the lftinsertion. The constructed plasmids were named pUASTattB-lix1 and

pUASTattB-lix1-like. All plasmid constructs were verified by DNA

sequencing.

RESULTSLowfat binds to the intracellular domains of Fatand DachsousTo evaluate whether the reported interaction between Lft and Fat and

Ds (Giot et al., 2003) could be reproduced in Drosophila cells,

epitope-tagged Lowfat protein (FLAG:Lft) was expressed in

cultured S2 cells together with tagged fragments of Fat or Ds. As Lft

was predicted to encode a cytoplasmic protein, we focused on

examining interactions between Lft and polypeptides including the

intracellular and transmembrane domains of Fat and Ds (Fat-TM-

ICD:V5 and Ds-TM-ICD:V5, Fig. 1B), but excluding their

extracellular domains. Immunoprecipitation of Lft:FLAG

specifically and reproducibly co-precipitated Fat-TM-ICD:V5 or

Ds-TM-ICD:V5, but not a control protein (TM-EGFP:V5; Fig. 1D).

Thus Lft can bind to both Fat and Ds in Drosophila cells.

Pair-wise BLASTP analysis of the Fat and Ds cytoplasmic

domains identified a small region of similarity between them (Fig.

1C) (Clark et al., 1995). Deletion of the C-terminal 99 amino acids

of Fat (Fat-TM-ICD-�C:V5), which includes this region,

substantially reduced Fat-Lft binding (Fig. 1D), implying that this

region contributes to their physical association. However, as binding

was not completely eliminated, the interaction between Lft and Fat

apparently also involves additional regions of the cytoplasmic

domain. Nonetheless, the Fat C-terminal region makes a crucial

contribution to the association with Lft, as its addition onto GFP

(TM-EGFP+Ft-C:V5) conferred to this protein a modest but

reproducible ability to bind Lft (Fig. 1D). Thus, Lft is a Fat- and Ds-

binding protein, and this binding is mediated in part through the C

terminus of Fat, which exhibits some sequence similarity to a region

of Ds.

lft is required for normal wing developmentTo investigate biological requirements for lft, we first reduced lftexpression by RNAi, using a UAS-hairpin transgene (UAS-RNAilft; NIG-13139R-1). Ubiquitous expression of this lft RNAi

transgene under act-Gal4 control resulted in flies with slightly

shorter wings (Fig. 2C), but no evident phenotypes in other

organs. The reduced length of the wing was most obvious in the

middle, where the distance between the anterior and the posterior

cross-veins was decreased (Fig. 2C,J). Reduction in the distance

between cross-veins is a diagnostic Fat pathway phenotype, as it

has been observed in viable alleles of all of the genes identified to

date as functioning specifically within the Fat branch of the Fat-

Hippo-Warts pathways [i.e. fat, ds, fj, approximated (app) and

dachs] (Mao et al., 2006; Matakatsu and Blair, 2008; Villano and

Katz, 1995; Waddington, 1940). The observation of this

phenotype with lft RNAi thus suggests that it is a component of

the Fat pathway.

RNAi often only partially reduces gene function, hence we sought

to isolate mutations in lft. Two strategies were used, both of which

were successful. In one approach, we used homologous

recombination-mediated gene targeting (Gong and Golic, 2003) to

create a lft allele in which the entire coding region was deleted (Fig.

2A). This deletion allele of lft (lftTG2) is homozygous viable and

fertile, and the only obvious phenotype was a reduced wing length

and a shorter cross-vein distance (Fig. 2D,J). Measurements

revealed an average wing area that was 82% of that in wild-type

wings, and an average cross-vein distance that was 59% of that in

wild-type wings (Fig. 2J, data not shown). This wing phenotype was

stronger than the lft RNAi phenotype, and similar to that observed

in null alleles of fj or app, or in hypomorphic alleles of fat or dachs.

The reduced size of the wing implies that the regulation of wing

growth by Fat signaling could be affected, which would suggest that

there is an influence on Fat-Warts signaling. At the same time, the

shape of the wing was also affected, as the length was affected more

than the width, especially in the middle of the wing. Wing shape can

be influenced by the Fat PCP pathway (Baena-Lopez et al., 2005).

The orientation of wing hairs, however, which also reflects PCP, was

3225RESEARCH ARTICLEModulation of Fat signaling by lowfat

DEVELO

PMENT

3226

not significantly affected in lft mutants (Fig. 3D). We also examined

lft mutant clones for effects on PCP, or the transcription of

downstream targets of Fat-Warts signaling, including Diap1,

Wingless and Expanded, but no significant effects were observed

(see Fig. S1 in the supplementary material; data not shown).

Sequence analysis implied that there are no other lft-like genes in

Drosophila. These observations suggest that lft could contribute to

normal Fat signaling during wing development, but that the

requirement for lft is relatively mild.

In parallel to the creation of a deletion allele of lft, we

employed the Seattle TILLING Project (http://tilling.fhcrc.org/)

to identify point mutations in lft. TILLING screens for nucleotide

changes in mutagenized chromosomes regardless of phenotypic

effect (Till et al., 2003). Seven mis-sense mutations in the lftcoding region were identified by TILLING of a 1464-bp region,

corresponding to the first 214 codons of lft. Two of these resulted

in obvious wing phenotypes as transheterozygotes with lftTG2

(Fig. 2E,J). Measurements of the distance between cross-veins

identified lft3709 as similar to lftTG2, whereas lft3762 exhibited a

slightly milder reduction in cross-vein length. Another allele,

lft0451, exhibited an even weaker phenotype (Fig. 2J). All of these

alleles change amino acids that are conserved among Lft and its

human homologs LIX1 and LIX1L (Fig. 1A). The other four mis-

sense mutations did not exhibit significant wing phenotypes. Lft

and its vertebrate homologs are highly conserved, but structurally

novel, and their biochemical function is unknown. The

RESEARCH ARTICLE Development 136 (19)

Fig. 1. Lft, LIX1, and LIX1L bind Fat, Ds and FAT4. (A)Amino acid alignment of Drosophila Lft, and human LIX1L and LIX1. Amino acids identicalamong all three proteins are in red, amino acids identical between two proteins are in blue. Amino acids above, in italics, identify mutations in lftTILLING alleles, which were named according to the mutagenized Zuker collection second chromosome from which they were isolated: lft2101 G16E,lft4168 L45M, lft3762 G72R, lft4907 F75S, lft1925 S90N, lft3709 S99F, lft0451 G140E. Mutations with lft phenotypes are in purple. (B) Schematic of DrosophilaFat, and the portions of Fat retained in Fat-TM-ICD:V5 and Fat-TM-ICD-�C:V5. Thin rectangle denotes a transmembrane domain. (C)Amino acidsequence alignment of the portion of Fat that exhibits similarity to Ds (Clark et al., 1995); the C-terminal half of this region is also conserved in FAT4.Identical amino acids are in red, similar amino acids are in blue. (D)Western blots depicting the results of co-immunoprecipitation experiments. Uppertwo panels (input) show blots on lysates of S2 cells transfected to express the indicated V5-tagged Fat, Ds or EGFP (control) proteins, and FLAG-taggedLft, LIX1 or LIX1L proteins; bottom panel (co-IP) shows blots (anti-V5) on material precipitated by anti-FLAG beads.

DEVELO

PMENT

characterization of these TILLING alleles identified amino acids

that are or are not required for normal Lft function independently

of their evolutionary conservation.

Lft is broadly expressed in imaginal tissuesVertebrate Lix1 was first identified and named as a gene expressed

in developing limbs (Swindell et al., 2001), but subsequent studies

have revealed that it is also expressed elsewhere (Fyfe et al., 2006;

Moeller et al., 2002). Expression of Drosophila lft was examined by

in situ hybridization to mRNA. lft was broadly expressed in

developing imaginal discs, including wing, leg and eye, and was also

expressed within the neuroepithelia of the optic lobes of the brain

(Fig. 4, data not shown). These are all places where fat and ds are

expressed. Comparison with control imaginal discs from lftTG2

mutants indicated that although lft is expressed throughout the wing

and eye disc, the levels of expression vary. In the eye imaginal disc,

lft expression is highest along the morphogenetic furrow (Fig. 4C),

and, in the wing imaginal disc, lft expression is highest near the

dorsoventral (DV) compartment boundary (Fig. 4A). The DV

compartment boundary is a site of Notch activation and a source of

Wg expression, and the upregulation of lft expression in the wing

was eliminated by the downregulation of Notch or Wg signaling (see

Fig. S2 in the supplementary material). By contrast, lft is not subject

to feedback regulation by Fat signaling, as its expression was not

affected by the downregulation of fat or warts (Fig. S2 in the

supplementary material).

Lft increases Fat and Ds protein levelsFat is expressed broadly throughout imaginal discs, but its

expression is not uniform. Consistent with earlier reports (Strutt and

Strutt, 2002; Yang et al., 2002), we observed, using a Fat-specific

sera (Feng and Irvine, 2009), that in the wing imaginal disc Fat

protein staining is elevated in the region fated to give rise to the wing

blade (the wing pouch), especially near the DV boundary, and that

in the eye disc Fat staining is strongest near the morphogenetic

furrow (Fig. 5A,C). Although fat mRNA distribution is also not

uniform at late third instar (see Fig. S3 in the supplementary

material) (Garoia et al., 2000), it does not match the strong increase

in protein levels along the DV boundary or morphogenetic furrow

in comparison to other regions of these discs, suggesting that Fat

levels are regulated post-transcriptionally. The correlation between

regions of imaginal discs in which lft expression is elevated and

regions in which Fat protein staining is elevated raised the possibility

that Lft might influence Fat protein levels or localization.

Indeed, Fat protein staining was clearly reduced in wing and eye

imaginal discs from lft mutants (Fig. 5B,D), especially in regions

where peak levels of Fat staining are observed in wild type. To

provide a direct comparison between Fat levels in wild-type versus

lft mutant cells, Fat staining was examined in discs with lft mutant

clones. In eye discs, and in the wing pouch region of the wing disc,

lft mutant clones were associated with a strong decrease in Fat levels

(Fig. 5E,H). In the region of the disc fated to give rise to the wing

hinge, lft mutant clones had little effect on Fat levels (Fig. 5G),

although this apparently reflects Lft perdurance, as Fat levels could

be affected by lft RNAi in the hinge (see Fig. S3 in the

supplementary material), and also appeared to be reduced in the

hinge within lft mutants (Fig. 5B). Thus, Lft increases Fat levels, and

its effects are most obvious in regions where the highest levels of Fat

and lft are normally observed.

To investigate whether Fat protein staining could also be

influenced by increased Lft, a FLAG epitope-tagged UAS-lfttransgene was created. Expression of UAS-lft under tub-Gal4 control

rescued the wing phenotype of lftTG2 mutants, confirming that

FLAG:Lft provides Lft function (Fig. 2G,J). Expression of UAS-lftunder ptc-Gal4 control elevated Fat protein staining, especially in

the hinge and notal regions of the wing disc, where endogenous

levels of lft are relatively low (Fig. 6A,B). To confirm that the visible

changes in Fat staining associated with mutation or overexpression

of Lft are reflective of differences in Fat protein levels, Fat was

examined by quantitative western blotting of lysates from wing

3227RESEARCH ARTICLEModulation of Fat signaling by lowfat

Fig. 2. lft mutations. (A) Map of the lft transcription unit. Upper line:thick bars indicate exons, thin bars indicate introns, gray indicates ORFand black indicates untranslated regions. Lower line depicts DNApresent and deleted (dashed) in the lftTG2 mutation. (B-I) Adult malewings from the indicated genotypes, arrows point to the cross-veins.Extra vein material was sometimes observed in tub-Gal4 flies, andhence could not be specifically ascribed to the expression of Lft or itshuman homologs. (J) Histogram of the relative distance between cross-veins (normalized to the average distance in wild-type controls) fromthe indicated genotypes. Error bars indicate s.d., between nine and 25wings were measured for each genotype. Statistical analysis (unpairedt-test) confirmed that the reduction in cross-vein length was significantfor each of the mutants; rescue of lftTG2 by lft, LIX1 and LIX1L was alsosignificant (P<0.0001).

DEVELO

PMENT

3228

discs. A 2.2-fold decrease in Fat levels was detected in lft mutant

discs when compared with wild-type discs (Fig. 6J), which, because

this is an average over the entire disc, underestimates the decrease

in peak regions. A 3.0-fold increase in Fat protein levels occurred in

discs overexpressing Lft under act-Gal4 control (Fig. 6J).

To confirm that these effects of lft on Fat protein levels are post-

transcriptional, fat mRNA levels were examined by in situ

hybridization in discs in which lft levels were reduced by RNAi, or

increased by overexpression. Expression of the lft RNAi construct

under en-Gal4 control reduced Fat protein levels, but did not

significantly reduce fat mRNA levels (see Fig. S3E,H in the

supplementary material). Moreover, expression of lft under ptc-Gal4control did not increase fat mRNA levels (see Fig. S3B,C in the

supplementary material). Thus, the influence of Lft on Fat is post-

transcriptional.

The observation that Lft binds to Ds as well as to Fat raised the

possibility that Lft might also influence Ds levels. Indeed, although

endogenous levels of Ds are quite low in the wing pouch, a reduction

in Ds protein staining at the membrane could be observed within lftmutant wing clones (Fig. 5F), and also in eye disc clones (not

shown). When Lft was overexpressed, Ds protein staining was

increased in both the hinge and the pouch (Fig. 6I). The influence of

Lft on Fat and Ds is specific, because mutation or overexpression of

Lft did not detectably influence levels of E-cadherin or Notch (not

shown). To confirm that Lft could independently influence both Fat

and Ds, clones of cells overexpressing Lft but mutant for fat or dswere stained for expression of Ds or Fat, respectively. Strong

upregulation of Fat, and weak upregulation of Ds, was observed in

such clones within both the wing pouch and the wing hinge (see Fig.

S4 in the supplementary material).

Fat and Ds influence Lft membrane localizationTo gain further insight into the mechanism by which Lft

influences Fat, we employed antibodies against the FLAG epitope

tag to localize Lft expressed in imaginal discs from UAS-lfttransgenes. Endogenous Fat and Ds proteins are preferentially

localized to the sub-apical membrane, just apical to the adherens

junctions. FLAG:Lft was detected at the sub-apical membrane,

overlapping Fat and Ds staining, but was also distributed broadly

throughout the cytoplasm (Fig. 6A,H). The profile of FLAG:Lft

staining detected varied depending upon the expression level and

the region of the disc. When expressed in the wing imaginal disc

under ptc-Gal4 control, strong cytoplasmic staining of FLAG:Lft

was detected in the wing pouch, but in parts of the wing hinge

FLAG:Lft was preferentially detected at the sub-apical membrane

(Fig. 6A,B,E). Because Ds is expressed at high levels in the wing

hinge and low levels in the wing pouch, these differences suggest

that the localization of FLAG:Lft to the sub-apical membrane

RESEARCH ARTICLE Development 136 (19)

Fig. 3. Genetic interaction between lft and fat1. (A,B) Adult malewings from fat1 and fat1 lftTG2. L2 identifies the second longtidudinalvein, which is often affected in these double mutants. (C-F) Close upsof the wing, just proximal to the anterior cross-vein. Hair polarity isconsistently disturbed in this region in fat1 lftTG2 double mutants (bluearrow in F), subtle effects were occasionally observed in fat1 (E), and noeffect was observed in lftTG2 (D). (G-J) Close ups of the distal coxa. Hairpolarity is consistently disturbed in this region in fat1 lftTG2 doublemutants (blue arrows in J), subtle effects were occasionally observed infat1 (I), and no effect was observed in lftTG2 (H). (K-N) Adult maleprothoracic legs, with leg segments identified (co, coxa; tr, trochanter;fe, femur; ti, tibia; ta, tarsus). The femur, tibia and tarsal segments areobviously shorter and wider in fat1 lftTG2 double mutants, and there areonly four tarsal segments (N); fat1 and lftTG2 single mutants have veryweak effects (L,M).

DEVELO

PMENT

could depend upon the availability of its binding partners. Indeed,

localization of FLAG:Lft to the sub-apical membrane was

reduced in fat or ds mutant clones (see Fig. S5 in the

supplementary material). Conversely, when fat or ds were

overexpressed under ptc-Gal4 control, FLAG:Lft levels were

substantially increased (Fig. S5 in the supplementary material).

Thus, Lft and its binding partners, Fat and Ds, have reciprocal

effects on the levels and localization to the sub-apical membrane

of one another.

lft and ds have additive effects on FatAlthough the lft mutant phenotype is relatively mild, the Fat ligand

ds also has a mutant phenotype that appears weaker than that of fatmutants. Intriguingly, lft and ds are expressed in partially

complementary domains in wing discs, as ds is expressed at highest

levels in proximal cells, whereas lft expression is highest in distal

cells. Thus, we explored the consequences of loss of both lft and ds.

ds mutant animals [dsUA071/Df(2L)ED94] can survive to adulthood,

but ds lft double mutant flies [dsUA071 lftTG2/Df(2L)ED94 lftTG2] did

not survive. To determine whether an additive phenotype of lft and

ds could also be detected for wing growth, we examined imaginal

discs in which their levels were reduced by RNAi. By expressing

UAS-RNAi transgenes specifically in the posterior (P) half of the

disc under en-Gal4 control and comparing the relative sizes of the

anterior (A) and P compartments, we could control for variations in

developmental stage that might otherwise confound precise

measurements of disc growth. In wild type, the P compartment of

the wing disc was 80% of the size of the A compartment. Expression

of lft RNAi under en-Gal4 control resulted in a modest, but

statistically significant, increase in the relative size of the P

compartment, to 87% of A compartment size (Fig. 7B,E).

Expression of ds RNAi alone resulted in a large increase in P

compartment size, to 140% of A compartment size (Fig. 7C,E). Co-

expression of lft and ds RNAi lines enhanced the overgrowth of the

P compartment to 178% of A compartment size (Fig. 7D,E). Thus,

lft and ds have additive effects on wing disc growth.

We also examined lft and ds mutant clones for their effects on Fat

protein staining. Mutation of ds had distinct effects on Fat in

different regions of the disc. In the wing pouch, Fat staining

appeared modestly elevated and slightly more diffuse within dsmutant clones (Fig. 5L). Nonetheless, preferential localization to the

sub-apical membrane, which visibly outlines cells, remained. By

contrast, in the wing hinge, Fat staining remained strong within dsmutant clones, but appeared diffusely distributed on the apical

surface (Fig. 5K). This diffuse staining was surrounded by a one-

cell-wide halo depleted of Fat staining, which presumably reflects a

re-localization of Fat to the membrane at the outer edge of the clone,

where it could be bound by Ds in neighboring wild-type cells (Cho

and Irvine, 2004; Ma et al., 2003; Strutt and Strutt, 2002). lft mutant

clones resulted in a strong reduction in Fat staining in the wing

pouch, but the Fat protein that remained appeared to localize

normally (Fig. 5H). lft mutant clones had no obvious effect on Fat

staining in the hinge (Fig. 5G). In both the wing hinge and the wing

pouch, ds lft double mutant clones exhibited additive effects on Fat

staining. Fat was diffusely localized in the wing hinge and levels

were reduced (Fig. 5I); Fat levels were also greatly reduced in the

wing pouch (Fig. 5J). Similarly, fat and lft had additive effects on Ds

localization in the wing pouch, as lft mutant clones reduced Ds levels

in the wing pouch, fat mutant clones resulted in diffuse apical

localization, and fat lft double mutant clones exhibited Ds staining

that was both reduced and diffuse (see Fig. S6 in the supplementary

material).

lft interacts genetically with fatThe mild phenotype of lft mutants, despite the substantial reduction

in Fat protein levels, suggests that Fat protein is normally present in

excess. However, we reasoned that if further reductions in Fat

activity could be achieved, such that its levels were closer to the

minimal thresholds needed for normal development, then lft mutants

should exhibit stronger phenotypes. This was explored by

investigating the phenotypes of animals doubly mutant for lftTG2 and

a weak allele of fat, fat1. The distance between cross-veins was

greatly reduced in fat1 lftTG2 double mutants (Fig. 3B). In addition

the posterior cross-vein was incomplete, and the L2 longitudinal

vein was often both incomplete and associated with ectopic vein

material, phenotypes that are not observed in either single mutant.

Leg growth is only very subtly affected in either lftTG2 or fat1 single

mutants, but fat1 lftTG2 double mutants had shorter legs, and

individual leg segments, including the femur and tibia were both

shorter and broader (Fig. 3K-N). In addition, fat1 lftTG2 double

mutants had only four tarsal segments instead of the usual five (Fig.

3N), a phenotype that is characteristic of mutations in fat pathway

genes. Finally, we did not observe PCP phenotypes in lft mutants,

and fat1 mutants had only very subtle PCP phenotypes (Fig. 3)

(Fanto et al., 2003), but obvious PCP phenotypes were observed in

fat1 lftTG2 double mutants in both wings and legs (Fig. 3F,J). Thus,

under sensitized conditions, an influence of lft mutations on Fat

signaling can be detected in multiple organs, and for both growth

and PCP phenotypes.

3229RESEARCH ARTICLEModulation of Fat signaling by lowfat

Fig. 4. lft expression. In situ hybridization to Drosophila tissues.(A,B) Wing discs; arrow points to DV boundary. (C,D) Eye discs; arrowpoints to morphogenetic furrow. (E) Larval brain and CNS. A, C and Eare wild-type tissues; B and D are lftTG2 mutant tissues, which serve asnegative controls.

DEVELO

PMENT

3230

Human LIX1L is a functional homolog ofDrosophila LftLft protein appears to be highly conserved with two human

homologs, LIX1 and LIX1L. Although LIX1L differs from Lft and

LIX1 in that it has a longer, unconserved, N-terminal region, within

the central conserved region (amino acids 24-257 of Lft), Lft is more

similar to LIX1L (75% amino acid identity) than it is to LIX1 (57%

identity), or even than LIX1 is to LIX1L (61% identity; see Fig. 1A).

The functional significance of these sequence similarities was

examined both in vitro and in vivo.

In co-immunoprecipitation experiments, human LIX1 and

LIX1L expressed in Drosophila S2 cells bound to the cytoplasmic

domains of Fat and Ds (Fig. 1D). LIX1 and LIX1L binding

appeared similar to Lft binding, and involved the same C-terminal

region of Fat. LIX1, but not Lft or LIX1L, also appeared to be

unstable when expressed without a binding partner in S2 cells, as

it was barely detectable when co-expressed with GFP, but was

readily detected when co-expressed with Fat or Ds (Fig. 1D). We

also examined the ability of these proteins to bind to the

cytoplasmic domain of human FAT4, which within its

cytoplasmic domain is the closest of the four human FAT proteins

to Drosophila Fat. LIX1, LIX1L and Lft could all co-precipitate

FAT4 (Fig. 1D).

The interaction between LIX1 and LIX1L and Drosophila Fat

was also investigated by comparing their influence on Fat protein

levels to that of Lft. Transgenes expressing FLAG-tagged lft, LIX1and LIX1L under UAS control were inserted into the same

chromosomal location using phiC31-mediated integration (Groth et

al., 2004), such that their expression levels would be similar.

Expression of LIX1L under ptc-Gal4 control resulted in an

RESEARCH ARTICLE Development 136 (19)

Fig. 5. Influence of lftmutation on Fat and Ds.Imaginal discs stained for Fat(red) or Ds (magenta); mutantclones are marked by absenceof GFP (green). Panels markedprime show single channel ofthe image to the left.(A) Wild-type wing disc; Fatstaining is elevated along theDV boundary (arrow).(B) lftTG2 mutant wing disc;Fat staining is reducedcompared with that in wildtype. (C) Wild-type eye disc;Fat staining is elevated alongthe morphogenetic furrow(arrow). (D) lftTG2 mutant eyedisc; Fat staining is reducedcompared with that in wildtype. (E,E�) Eye disc with lftTG2

mutant clone. (F,F�) Wing discwith lftTG2 mutant clones.(G-H�) Wing discs with lftTG2

mutant clones, focused onhinge (G,G�) or pouch (H,H�).(I-J�) Wing discs with dsUA071

lftTG2 double mutant clones,focused on hinge (I,I�) orpouch (J,J�). (K-L�) Wing discswith dsUA071 mutant clones,focused on hinge (K,K�) orpouch (L,L�).

DEVELO

PMENT

upregulation of Fat protein staining, both in the wing hinge and in

the wing pouch, similar to the effects of Lft (Fig. 6C,F). Expression

of LIX1 also resulted in an upregulation of Fat protein staining in

the hinge, but actually decreased Fat protein staining in the wing

pouch (Fig. 6D,G). This apparently complex effect could be

interpreted as indicating that LIX1 has weak Lft-like activity. Hence,

we suggest that in the hinge, where Lft levels are lower, LIX1

elevates Fat levels by providing partial Lft activity, but in the pouch,

where Lft levels are higher, it decreases Fat levels by competing with

Lft. Like Drosophila FLAG:Lft, FLAG:LIX1 and FLAG:LIX1L

could be detected at the sub-apical membrane, overlapping Fat and

Ds staining (Fig. 6C-G). However, in the case of LIX1L, but not

LIX1, we also detected strong cytoplasmic staining. Indeed, under

identical expression and staining conditions, LIX1 protein was

barely detectable in the wing pouch (Fig. 6G), suggesting that, as in

S2 cells, it is unstable when not associated with a binding partner.

Finally, we examined the ability of human LIX1 and LIX1L to

rescue the lft mutant phenotype. Expression of LIX1 under tub-Gal4control exhibited only a partial rescue of lft (Fig. 2I,J). However,

LIX1L rescued the wing phenotype of lft mutants as well as did lftitself (Fig. 2H,J). Thus, human LIX1L is a functional homolog of

Drosophila Lft. The difference in the extent of rescuing activity for

LIX1 versus LIX1L correlates with their sequence similarity to Lft,

and with their distinct effects on Fat protein staining.

DISCUSSIONElucidation of the Fat signaling pathway requires the identification

and characterization of pathway components. Here, we have identified

Lft as a novel, highly conserved modulator of Fat signaling. lft mutants

display decreased levels of both Fat and Ds protein staining, and

presumably as a consequence exhibit a characteristic Fat pathway

phenotype in the wing. In addition, lft can genetically interact with

both fat and ds to cause more severe phenotypes. The lft mutant

phenotype resembles weak mutant alleles of fat or ds, and lft mutants

do not exhibit any additional phenotypes that could not be accounted

for by effects on Fat signaling. The expression of lft itself is modulated

by other signaling pathways, and differences in lft expression levels

correlate with differences in Fat and Ds protein levels both in wild-

3231RESEARCH ARTICLEModulation of Fat signaling by lowfat

Fig. 6. Influence of lft overexpression on Fatand Ds. (A-I�) Portions of wing imaginal discsexpressing lft or its human homologs, asindicated, under ptc-Gal4 control, and stained forLft, LIX1 or LIX1L (FLAG epitope tag, green), andFat (red) or Ds (magenta). Panels marked primeshow separate channels of the same disc.(A,I) Lower power views. Boxes in A indicate theapproximate locations of the close-up imagesdepicted in B-G; arrow in I highlightsupregulation of Ds in cells overexpressing Lft.(B-D) Close-ups of the hinge region of the wingdisc. (E-G) Close-ups of the pouch region of thewing disc. (H) Vertical section through the wingpouch, apical is at top. (J) Western blot of wingdiscs from the indicated genotypes; Tub (Tubulin)is a loading control.

DEVELO

PMENT

3232

type animals, and when lft levels are experimentally increased or

decreased. Thus, transcriptional regulation of lft defines a mechanism

for modulating Fat signaling.

Lft influences levels of both Fat and Ds. Because Fat and Ds in

turn can influence levels of Lft, and because Fat and Ds also

influence the localization of one another to the membrane, we

infer that for any one of these three proteins, the influence that it

has on the other two includes both direct effects, and indirect

effects mediated through the third protein. In addition, the net

effect observed for any one protein presumably also reflects the

consequences of feedback regulation of its own levels via the

other two proteins.

Given the substantial decrease in Fat staining in lft mutants, the

phenotype appears surprisingly mild. This observation suggests that

Fat is normally present in excess; for example, it could be that only

a fraction of Fat is normally active, and that levels of Fat are not

normally limiting for pathway activation. This hypothesis was

supported by the observation of enhanced Fat pathway phenotypes

in combination with fat1, and would be consistent with the

conclusion that Fat acts as a ligand-activated receptor, with only a

fraction of Fat normally being present in the active form (Feng and

Irvine, 2009; Sopko et al., 2009). Complicating this simple

explanation is the observation that the levels of the Fat ligand Ds

are also reduced in lft mutants. However, because Fat signaling is

influenced not only by the amount of Ds, but also by the pattern of

Ds (i.e. is Ds expression graded, and how steeply), Ds can have

positive or negative effects on Fat activity (Reddy and Irvine, 2008;

Rogulja et al., 2008; Willecke et al., 2008). Thus, we suggest that

the lft mutant phenotype might be relatively weak because

decreased Fat and Ds levels, which would be expected to decrease

Fat signaling, are partially offset by a flattening of the Fat and Ds

expression gradients, which would be expected to increase Fat-

Warts signaling (Reddy and Irvine, 2008; Rogulja et al., 2008;

Willecke et al., 2008).

The observation that ds lft double mutants have more severe

phenotypes than do ds or lft single mutants indicates that ds and lftcan each independently influence Fat. lft and ds both influence Fat

levels and localization, but even in the absence of these two genes,

there was a visible difference in Fat protein staining between the

wing pouch and the wing hinge. This implies that there are

additional Fat regulators, and that the expression of these additional

Fat regulators is differentially distributed between the wing pouch

and the wing hinge. One additional Fat regulator that is differentially

expressed between the pouch and the hinge is Fj (Villano and Katz,

1995), although as Fj is thought to act by influencing Fat-Ds

interactions, it is not clear whether it could explain the differential

Fat staining observed.

It appears that Lft is a major contributor to the normal levels of

Fat. As Lft binds to the Fat cytoplasmic domain, it presumably

influences Fat protein levels through this direct binding. Different

molecular mechanisms for how Lft might influence Fat (and Ds)

levels can be envisioned. One attractive possibility, given that

Fat and Ds are transmembrane proteins, and that Lft could co-

localize with them at the sub-apical membrane, is an effect on

endocytosis, but it is also possible that Lft affects them in some

other way.

Because Lft is closely related to LIX1 and LIX1L, and indeed

LIX1L is functionally homologous to Lft, our studies of Lft identify

regulation of mammalian Fat and Ds homologs as the likely cellular

functions of LIX1 and LIX1L. Consistent with this inference, these

proteins could bind to the cytoplasmic domain of human FAT4, and

a BLASTP search with a short sequence motif of Fat common to Ds

and FAT4 (WEYLLNWGPSYENLMGVFKDIAELPD, Fig. 1C)

identifies these three proteins plus the mammalian Ds homologs

DCHS1 and DCHS2 as the five closest matches in protein databases.

This sequence motif also exhibits weak similarity to a region of E-

cadherin that has been identified as contributing to binding to β-

catenin (Clark et al., 1995; Huber and Weis, 2001), but there is no

obvious primary sequence similarity between Lft and β-catenin, and

Lft did not detectably affect E-cadherin staining.

Functional studies of LIX1 and LIX1L in vertebrates have not

yet been reported. However, feline LIX1 has been genetically

linked to feline spinal muscular atrophy (Fyfe et al., 2006). Direct

examination of human LIX1 in spinal muscular atrophy patients

did not reveal any mutations (Fyfe et al., 2006; Parkinson et al.,

2008). Nonetheless, the linkage of LIX1 and LIX1L to Fat

signaling suggests that other members of the Fat signaling

pathway should also be examined as potential candidate

susceptibility loci for this debilitating disease. Murine Fat4 has

been shown to be required for normal PCP in the ear and kidney

(Saburi et al., 2008); however, it is also highly expressed in the

nervous system, as are murine Lix1 and Dchs genes (Moeller et

al., 2002; Rock et al., 2005), consistent with the expectation that

these genes will interact in mammals, and might influence

nervous system development.

AcknowledgementsWe thank Adnan Riaz for assistance in characterizing TILLING alleles; QumiaoXu for assistance in characterizing the lft RNAi phenotype; the DevelopmentalStudies Hybridoma Bank, the Bloomington Stock Center, the Seattle TILLINGProject, M. Simon, C. Zuker, and the National Institute of Genetics (Japan) forantibodies and Drosophila stocks; and P. Francis-West for comments on themanuscript. This research was supported by the HHMI and by NIH grantGM078620. Deposited in PMC for release after 6 months.

Supplementary materialSupplementary material for this article is available athttp://dev.biologists.org/cgi/content/full/136/19/3223/DC1

RESEARCH ARTICLE Development 136 (19)

Fig. 7. Influence of lft and ds on disc growth. (A-D) Representativewing imaginal discs from experiments in which UAS-RNAi transgeneswere expressed under en-Gal4 control, in the presence of UAS-dcr2 (toenhance RNAi) and UAS-GFP (to mark the en-Gal4-expressing, P cells).(A) Control disc expressing only UAS-dcr2 and UAS-GFP. (B-D) Discsexpressing the indicated transgenes. (E) Quantitation of relative sizes(P/A size ratio); error bars indicate s.d. The number of discs measuredwas nine (control), eight (lft), 40 (ds) and 36 (ds lft). The differencebetween wild type (+) and lft was significant (Student’s t-test, P<0.05),and the difference between ds and ds lft was highly significant(P<10–10).

DEVELO

PMENT

ReferencesAdler, P. N., Charlton, J. and Liu, J. (1998). Mutations in the cadherin

superfamily member gene dachsous cause a tissue polarity phenotype byaltering frizzled signaling. Development 125, 959-968.

Baena-Lopez, L. A., Baonza, A. and Garcia-Bellido, A. (2005). The orientationof cell divisions determines the shape of Drosophila organs. Curr. Biol. 15, 1640-1644.

Bennett, F. C. and Harvey, K. F. (2006). Fat Cadherin modulates organ size inDrosophila via the Salvador/Warts/Hippo signaling pathway. Curr. Biol. 16, 2101-2110.

Casal, J., Struhl, G. and Lawrence, P. (2002). Developmental compartments andplanar polarity in Drosophila. Curr. Biol. 12, 1189-1198.

Cho, E. and Irvine, K. D. (2004). Action of fat, four-jointed, dachsous and dachsin distal-to-proximal wing signaling. Development 131, 4489-4500.

Cho, E., Feng, Y., Rauskolb, C., Maitra, S., Fehon, R. and Irvine, K. D.(2006). Delineation of a Fat tumor suppressor pathway. Nat. Genet. 38, 1142-1150.

Clark, H. F., Brentrup, D., Schneitz, K., Bieber, A., Goodman, C. and Noll, M.(1995). Dachsous encodes a member of the cadherin superfamily that controlsimaginal disc morphogenesis in Drosophila. Genes Dev 9, 1530-1542.

Dong, J., Feldmann, G., Huang, J., Wu, S., Zhang, N., Comerford, S. A.,Gayyed, M. F., Anders, R. A., Maitra, A. and Pan, D. (2007). Elucidation of auniversal size-control mechanism in Drosophila and mammals. Cell 130, 1120-1133.

Fanto, M., Clayton, L., Meredith, J., Hardiman, K., Charroux, B., Kerridge, S.and McNeill, H. (2003). The tumor-suppressor and cell adhesion molecule Fatcontrols planar polarity via physical interactions with Atrophin, a transcriptionalco-repressor. Development 130, 763-774.

Feng, Y. and Irvine, K. D. (2007). Fat and expanded act in parallel to regulategrowth through warts. Proc. Natl. Acad. Sci. USA 104, 20362-20367.

Feng, Y. and Irvine, K. D. (2009). Processing and phosphorylation of the Fatreceptor. Proc. Natl. Acad. Sci. USA 106, 11989-11994.

Fyfe, J. C., Menotti-Raymond, M., David, V. A., Brichta, L., Schaffer, A. A.,Agarwala, R., Murphy, W. J., Wedemeyer, W. J., Gregory, B. L., Buzzell, B.G. et al. (2006). An approximately 140-kb deletion associated with feline spinalmuscular atrophy implies an essential LIX1 function for motor neuron survival.Genome Res. 16, 1084-1090.

Garoia, F., Guerra, D., Pezzoli, M. C., Lopez-Varea, A., Cavicchi, S. andGarcia-Bellido, A. (2000). Cell behaviour of Drosophila fat cadherin mutationsin wing development. Mech. Dev. 94, 95-109.

Giot, L., Bader, J. S., Brouwer, C., Chaudhuri, A., Kuang, B., Li, Y., Hao, Y. L.,Ooi, C. E., Godwin, B., Vitols, E. et al. (2003). A protein interaction map ofDrosophila melanogaster. Science 302, 1727-1736.

Gong, W. J. and Golic, K. G. (2003). Ends-out, or replacement, gene targeting inDrosophila. Proc. Natl. Acad. Sci. USA 100, 2556-2561.

Groth, A. C., Fish, M., Nusse, R. and Calos, M. P. (2004). Construction oftransgenic Drosophila by using the site-specific integrase from phage phiC31.Genetics 166, 1775-1782.

Huang, J., Wu, S., Barrera, J., Matthews, K. and Pan, D. (2005). The Hipposignaling pathway coordinately regulates cell proliferation and apoptosis byinactivating Yorkie, the Drosophila Homolog of YAP. Cell 122, 421-434.

Huber, A. H. and Weis, W. I. (2001). The structure of the beta-catenin/E-cadherincomplex and the molecular basis of diverse ligand recognition by beta-catenin.Cell 105, 391-402.

Ishikawa, H. O., Takeuchi, H., Haltiwanger, R. S. and Irvine, K. D. (2008).Four-jointed is a Golgi kinase that phosphorylates a subset of cadherin domains.Science 321, 401-404.

Ma, D., Yang, C. H., McNeill, H., Simon, M. A. and Axelrod, J. D. (2003).Fidelity in planar cell polarity signalling. Nature 421, 543-547.

Mao, Y., Rauskolb, C., Cho, E., Hu, W. L., Hayter, H., Minihan, G., Katz, F. N.and Irvine, K. D. (2006). Dachs: an unconventional myosin that functionsdownstream of Fat to regulate growth, affinity and gene expression inDrosophila. Development 133, 2539-2551.

Matakatsu, H. and Blair, S. S. (2008). The DHHC palmitoyltransferaseapproximated regulates Fat signaling and Dachs localization and activity. Curr.Biol. 18, 1390-1395.

Moeller, C., Yaylaoglu, M. B., Alvarez-Bolado, G., Thaller, C. and Eichele, G.(2002). Murine Lix1, a novel marker for substantia nigra, cortical layer 5, andhindbrain structures. Brain Res. Gene Expr. Patterns 1, 199-203.

Oh, H. and Irvine, K. D. (2008). In vivo regulation of Yorkie phosphorylation andlocalization. Development 135, 1081-1088.

Parkinson, N. J., Baumer, D., Rose-Morris, A. and Talbot, K. (2008). Candidatescreening of the bovine and feline spinal muscular atrophy genes reveals noevidence for involvement in human motor neuron disorders. Neuromuscul.Disord. 18, 394-397.

Rauskolb, C. and Irvine, K. D. (1999). Notch-mediated segmentation and growthcontrol of the Drosophila leg. Dev. Biol. 210, 339-350.

Reddy, B. V. and Irvine, K. D. (2008). The Fat and Warts signaling pathways: newinsights into their regulation, mechanism and conservation. Development 135,2827-2838.

Rock, R., Schrauth, S. and Gessler, M. (2005). Expression of mouse dchs1, fjx1,and fat-j suggests conservation of the planar cell polarity pathway identified inDrosophila. Dev. Dyn. 234, 747-755.

Rogulja, D., Rauskolb, C. and Irvine, K. D. (2008). Morphogen control of winggrowth through the Fat signaling pathway. Dev. Cell 15, 309-321.

Saburi, S., Hester, I., Fischer, E., Pontoglio, M., Eremina, V., Gessler, M.,Quaggin, S. E., Harrison, R., Mount, R. and McNeill, H. (2008). Loss of Fat4disrupts PCP signaling and oriented cell division and leads to cystic kidneydisease. Nat. Genet. 40, 1010-1015.

Silva, E., Tsatskis, Y., Gardano, L., Tapon, N. and McNeill, H. (2006). Thetumor-suppressor gene fat controls tissue growth upstream of expanded in theHippo signaling pathway. Curr. Biol. 16, 2081-2089.

Simon, M. A. (2004). Planar cell polarity in the Drosophila eye is directed bygraded Four-jointed and Dachsous expression. Development 131, 6175-6184.

Sopko, R., Silva, E., Clayton, L., Gardano, L., Barrios-Rodiles, M., Wrana, J.,Varelas, X., Arbouzova, N. I., Shaw, S., Saburi, S. et al. (2009).Phosphorylation of the tumor suppressor fat is regulated by its ligand Dachsousand the kinase discs overgrown. Curr. Biol. 19, 1112-1117.

Steinhardt, A. A., Gayyed, M. F., Klein, A. P., Dong, J., Maitra, A., Pan, D.,Montgomery, E. A. and Anders, R. A. (2008). Expression of Yes-associatedprotein in common solid tumors. Hum. Pathol. 39, 1582-1589.

Strutt, D. (2008). The planar polarity pathway. Curr. Biol. 18, R898-R902.Strutt, H. and Strutt, D. (2002). Nonautonomous planar polarity patterning in

Drosophila: dishevelled-independent functions of frizzled. Dev. Cell 3, 851-863.Swindell, E. C., Moeller, C., Thaller, C. and Eichele, G. (2001). Cloning and

expression analysis of chicken Lix1, a founding member of a novel gene family.Mech. Dev. 109, 405-408.

Till, B. J., Reynolds, S. H., Greene, E. A., Codomo, C. A., Enns, L. C., Johnson,J. E., Burtner, C., Odden, A. R., Young, K., Taylor, N. E. et al. (2003). Large-scale discovery of induced point mutations with high-throughput TILLING.Genome Res. 13, 524-530.

Tyler, D. M. and Baker, N. E. (2007). Expanded and fat regulate growth anddifferentiation in the Drosophila eye through multiple signaling pathways. Dev.Biol. 305, 187-201.

Villano, J. L. and Katz, F. N. (1995). four-jointed is required for intermediategrowth in the proximal-distal axis in Drosophila. Development 121, 2767-2777.

Waddington, C. H. (1940). The genetic control of wing development inDrosophila. J. Genet. 41, 75-139.

Willecke, M., Hamaratoglu, F., Kango-Singh, M., Udan, R., Chen, C. L., Tao,C., Zhang, X. and Halder, G. (2006). The Fat Cadherin acts through the Hippotumor-suppressor pathway to regulate tissue size. Curr. Biol. 16, 2090-2100.

Willecke, M., Hamaratoglu, F., Sansores-Garcia, L., Tao, C. and Halder, G.(2008). Boundaries of Dachsous Cadherin activity modulate the Hippo signalingpathway to induce cell proliferation. Proc. Natl. Acad. Sci. USA 105, 14897-14902.

Yang, C., Axelrod, J. D. and Simon, M. A. (2002). Regulation of Frizzled by Fat-like Cadherins during planar polarity signaling in the Drosophila compound eye.Cell 108, 675-688.

Zeidler, M. P., Perrimon, N. and Strutt, D. I. (1999). The four-jointed gene isrequired in the Drosophila eye for ommatidial polarity specification. Curr. Biol. 9,1363-1372.

Zeng, Q. and Hong, W. (2008). The emerging role of the hippo pathway in cellcontact inhibition, organ size control, and cancer development in mammals.Cancer Cell 13, 188-192.

Zhao, B., Wei, X., Li, W., Udan, R. S., Yang, Q., Kim, J., Xie, J., Ikenoue, T., Yu,J., Li, L. et al. (2007). Inactivation of YAP oncoprotein by the Hippo pathway isinvolved in cell contact inhibition and tissue growth control. Genes Dev. 21,2747-2761.

3233RESEARCH ARTICLEModulation of Fat signaling by lowfat

DEVELO

PMENT