Upload
others
View
8
Download
0
Embed Size (px)
Citation preview
Dynamics Of Major Withanolide Accumulation, With Respect To Ontogenic Expression Of Key Pathway Genes In In Vivo And In Vitro Leaves Of Indian Ginseng: Withania somnifera
Irene Mariam Roy
(12PBT007)
Thesis submitted to
Avinashilingam Institute for Home Science and Higher Education for Women, Coimbatore – 641 043
In Partial Fulfilment of the Requirement of the Degree of
Master of Science in Biotechnology
March, 2014
CCEERRTTIIFFIICCAATTEE
AACCKKNNOOWWLLEEDDGGEEMMEENNTT
ACKNOWLEDGEMENT
First and foremost I Thank God Almighty for his manifold blessings showered on
me for carrying out the study successfully.
I am most grateful to Ayya Avargal and Amma Avargal for creating a portal to
exhibit our abilities.
I express my deep sense of gratitude to Thiru. T.S.K. Meenakshi Sundaram,
Chancellor, Avinashilingam Deemed University for Women, Coimbatore, for all the
amenities provided for the conduct of the project.
I place my heartfelt thanks to Dr. Sheela Ramachandran, Vice Chancellor,
Avinashilingam Deemed University for Women, Coimbatore, for her support towards the
completion of this study.
I express my profound thanks to Dr. Gowri Ramakrishnan, Registrar,
Avinashilingam Deemed University for Women, Coimbatore, for providing me
opportunity to carry out my work.
I also wish to thank Dr. Paarvathi , Dean of Science, Avinashilingam Deemed
University for Women, Coimbatore for her kind help and competence to fill in.
I am indebted to Dr. S. Annapurani, Head of the Department of Biochemistry,
Biotechnology and Bioinformatics, Avinashilingam Deemed University for Women,
Coimbatore, for her constant motivation, encouragement and support in eliciting this
project in a facile manner.
I take this opportunity to express my indebtness and my deep sense of gratitude to
my guide Dr. K. Kalaiselvi, Assistant Professor, Department of Biochemistry,
Biotechnology and Bioinformatics, Avinashilingam Deemed University for Women,
Coimbatore, for her constant care, guidance, encouragement, amicable suggestions and
help for the successful completion of this project.
A special word of thanks to Pankajavalli T, Ph.D scholar, for her timely help,
support and source of inspiration throughout my project.
I am thankful for the aid rendered by Pradeepa. D, Preethi M.P, Rajalakshmi. P,
Parameshwari. D and Lavanya. K and all my other lab mates who at all times have been
with me for my problems and queries.
I will be failing in my duty if special mention is not made about the hearty help
and assistance received from my dear friends and colleagues and members of the staff of
the Department.
My heart has no bounds to thank my parents and my brother for their moral
support and good wishes for the successful completion.
IRENE MARIAM ROY
CCOONNTTEENNTTSS
CONTENTS
CHAPTER TITLE PAGE
NO. NO.
LIST OF TABLES
LIST OF FIGURES
LIST OF PLATES
1. INTRODUCTION 1
2. REVIEW OF LITERATURE 4
3. MATERIALS AND METHODS 18
4. RESULT AND DISCUSSION 26
5. SUMMARY AND CONCLUSION 45
BIBLIOGRAPHY 48
APPENDICES 55
LIST OF TABLES
TABLE
NO.
TITLE
PAGE NO.
3.1.
Primer Sequence of Pathway Genes
25
4.1.
In vivo Leaf morphology
28
4.2.
In vitro Leaf morphology
31
LIST OF FIGURES
FIGURE NO.
TITLE
PAGE NO.
2.1
Withanolide Structure
9
2.2
Withaferin A Structure
10
2.3
Withanolide A Structure
11
2.4
Biosynthesis through MVA and MEP Pathway
12
4.1
Expression of 3-Hydroxy-3-methylglutaryl coenzyme A reductase
33
4.2
Expression of Farnesyl Pyrophosphate Synthase
34
4.3
Expression of Squalene Epoxidase
35
4.4
Expression of Cycloartenol Synthase
35
4.5
Expression of Glucosyl Transferase
36
4.6
Comparative expression of five major pathway genes expressed in different phenophases
37
4.7
In vitro FPPS Quanification
38
4.8
Regression Graph for Withanolide A
42
4.9
Withanolide A Quantification
42
4.10
Regression Graph for Withaferin A
43
4.11
Withaferin A Quantification
43
LIST OF PLATES
PLATE NO.
TITLE
PAGE NO.
2.1
Withania somnifera
7
4.1
Different Stages of Field Grown Leaf
29
4.2
Growth stages of in vivo Withania somnifera
30
4.3
Different stages of in vitro Withania somnifera
31
4.4
RNA Quantification of in vivo and in vitro leaves
32
4.5
HPTLC Fingerprint of Withanolide A in white light
39
4.6
HPTLC Fingerprint of Withanolide A in 366 nm
39
4.7
HPTLC Fingerprint of Withaferin A in white light
40
4.8
HPTLC Fingerprint of Withaferin A in 366 nm
41
IINNTTRROODDUUCCTTIIOONN
1
1. INTRODUCTION
India is a land rich in a diverse amount of medicinal plants. These plants have
been under research to identify their core secondary metabolites. The secondary
metabolites can be alkaloids, flavanoids, steroids and steroidal lactones that have
immense therapeutic activity. The plants containing these novel compounds are thus used
since ages, by the Ayurvedic and Unani to the recent medical based companies for their
medicinal value leading to drug development.
Withania somnifera (Solanaceae) or Ashwagandha is a medicinal plant known for
several pharmacological properties attributed to its characteristic steroidal compounds,
called withanolides and glycowithanolides (Sangwan et al., 2008). Clinical trials and
animal research support the use of Ashwagandha for anxiety, cognitive and neurological
disorders, inflammation, and Parkinson’s disease. Ashwagandha is a small, woody shrub
in the Solanaceae family that grows about two feet in height. It can be found growing in
Africa, the Mediterranean, and India. However, the primary alkaloids of both the wild
and the cultivated species appear to be the same. The leaves and roots are the main
portion of the plant used therapeutically.
The secondary metabolites produced by various parts of Withania sp. are of high
therapeutic value out of which some are under major studies. Leaf is one part that
contains Withanolides and is the aerial part that can be ingested orally. It is used in
Ayurvedic formulations from ancient times. Withaferin A is the first natural steroidal
lactone of the withanolides which has been isolated from W. somnifera leaves and stems
(Proksa et al., 1986). These secondary metabolites are synthesized via mevalonate
(MVA) and 2-C-methyl-D-erythritol-4-phosphate (MEP) pathways. There are many key
pathway genes that are involved in this pathway acting as major roles in synthesis of
Withanolides like Farnesyl pyrophosphate, Glucosyl transferase, Squalene epoxidase, 1-
Deoxy-D-xylulose 5-phosphate reductoisomerase etc. MVA metabolic pathway is
associated with the cytoplasm whereas the MEP pathway is associated with the
chloroplast. Yang et al., (2012) have suggested that the MVA pathway plays a major role
2
in cell growth. Thus the MVA pathway is taken for studies related to different ontogenic
stages in plant growth.
Monitoring the pattern of gene expression under various physiological and
pathological conditions is a critical step in understanding these biological processes and
for potential interventions (Chen et al., 2000). Large-scale sequencing of cDNAs
randomly picked from libraries has proven to be a very powerful approach to discover
(putatively) expressed sequences that can be involved in the identification and cloning of
genes holding specific job. Identification of genes has proven extremely powerful for
studying the genetic architecture of complex traits as well as the relation between the
synthesis of large amount of secondary metabolites like Withanolides. Modern
sophisticated techniques have come up like quantitative Real Time PCR, High
performance Thin Layer Chromatography, Primer designing by In silico tools, that have
made the gene isolation, expression, quantitative analysis and characterization less time
consuming obtaining results of high resolution.
Mainly focusing on the classical pathway, detailed research should be carried out
to identify the various major pathway genes and their relation to secondary metabolite
synthesis. In an attempt to understand genes involved, an EST library was constructed
with 1047 cDNAs in leaf (Senthil et al., 2010). In continuation of the same, five genes
involved in biosynthetic pathway were selected from the library, sequences retrieved and
used for study. As a first on record work on multiple pathway genes in in vivo leaves with
respect to in vitro leaves, the present study is initiated with the following objectives:
1) To analyse the expression of 5 key pathway genes – HMGR, FPPS, SE, CAS and GT
in in vivo grown leaves at different ontogenic stages.
2) To identify the major gene in vivo and comparison with the same in vitro gene
expression for metabolite synthesis in Withania somnifera leaves.
3) To develop a HPTLC finger print for in vivo leaves and compare it with in vitro
leaves.
3
RREEVVIIEEWW OOFF LLIITTEERRAATTUURREE
4
2. REVIEW OF LITERATURE
The use of medicinal plants for the cure of diseases and the mental health is well
studied since time immemorial especially in the Ayurveda. The use of Herbs for the
treatment of diseases has been used as an alternative to the increased cost of chemical
drugs in all parts of the world mainly by the developing countries. The medicinal plants
are rich in secondary metabolites and essential oils of therapeutic importance. The
important advantages claimed for therapeutic uses of medicinal plants in various ailments
are their safety besides being economical, effective and their easy availability (Verma et
al., 2011). Plant cell culture technologies were introduced at the end of the 1960’s as a
possible tool for both studying and producing plant secondary metabolites. Different
strategies, using an In vitro system, have been extensively studied to improve the
production of plant chemicals (Winters., 2006)
Withania somnifera Dunal also called as Ashwagandha or Indian Ginseng is
widely used in Ayurvedic medicine, the traditional medical system of India. It is an
ingredient in many formulations prescribed for a variety of musculoskeletal conditions
(e.g., arthritis, rheumatism), and as a general tonic to increase energy, improve overall
health and longevity, and prevent disease in athletes, the elderly, and during pregnancy.
Many pharmacological studies have been conducted to investigate the properties of
ashwagandha in an attempt to authenticate its use as a multi-purpose medicinal agent
(Mishra et al., 2000)
5
This chapter deals with the review of earlier work carried out in various aspects
like growth, gene expression, secondary metabolites, pharmacological properties and uses
of Withania somnifera.
2.1 Withania somnifera:
2.1.1 Taxonomical Classification
2.1.2 Morphology and Characteristics
2.2 Review on In vivo and In vitro leaves of Withania somnifera
2.3 Bioactive components in Withania somnifera
2.4 Pathway genes in secondary metabolite synthesis
2.5 Techniques for Gene Expression analysis
2.6 Secondary metabolite accumulation study
2.1 Withania somnifera:
Withania somnifera, known commonly as Ashwagandha, Indian ginseng, poison
gooseberry, or winter cherry, is a plant in the Solanaceae or nightshade family. The genus
Withania comprises 23 species including W. somnifera and W.coagulans (L.) Dunal, both
are high in medicinal value and extensively used in Ayurvedic formulations as
“Rasayana”. Its roots and leaves are used in a number of preparations for their anti-
inflammatory, anticonvulsive, antitumor, immunosuppressive and antioxidant properties
besides for promoting vigor and stamina. The berries are used as a substitute for rennet,
to coagulate milk in cheese making. Ashwagandha, in Sanskrit means "horse's smell,"
probably originating from the odor of its root which resembles that of a sweaty horse. In
Tamil, it is called Amukkrang Kilangu and is used in several medicines. The species
name somnifera means "sleep-inducing" in Latin, indicating that to it are attributed
sedating properties, but it has been also used for sexual vitality and as an adaptogen
(Verma et al., 2011).
6
2.1.1 Taxonomical Classification: Withania somnifera (Dunal).
Kingdom : Plantae, Plants
Subkingdom : Tracheobionta
Super division : Spermatophyta
Division : Angiosperma
Class : Dicotyledons
Order : Tubiflorae
Family : Solanaceae
Genus : Withania
Species : somnifera Dunal
(Gupta and Rana., 2007)
2.1.2 Morphology and Characteristics:
Withania somnifera (L.) grows as a stout
shrub that reaches a height of 170 cm. It bears
yellow flowers and red fruit, though its fruit is
berry-like in size and shape (Alam P et al.., 2012). It
can be found growing in Africa, the Mediterranean,
and India. An erect, evergreen, tomentose shrub, 30-
150 cm high, found throughout the drier parts of
India in waste places and on bunds. Roots are stout
fleshy, whitish brown and leaves simple ovate,
glabrous, those in the floral region smaller and
opposite. Flowers are greenish or lurid yellow,
small about 1 cm long; few flowers (usually
about 5) born together in axillary, umbellate
cymes (short axillary clusters). Fruits are
PLATE 2.1 Withania somnifera
7
globose berries, 6 mm in diameter, orange red when mature, enclosed in the inflated and
membranous persistent calyx. Seeds are yellow, reniform and 2.5 mm in diameter. The
roots are the main portions of the plant used therapeutically. The bright red fruit is
harvested in the late fall and seeds are dried for planting in the following spring (Uddin et
al., 2012, Gupta and Rana., 2007). In India, it is widely grown in the provinces of
Madhya Pradesh, Uttar Pradesh, plains of Punjab and northwestern parts of India like
Gujarat and Rajasthan. It is widely cultivated in India and throughout the Middle East,
and in Eastern Africa (Rahman et al., 1993).
Many pharmacological studies have been carried out to describe multiple
biological properties of W. somnifera (Mishra et al., 2000). These studies have shown
that the plant preparation has anticancer (Mohan et al., 2004), anti-inflammatory,
antistress and immunomodulatory (Rai et al.., 2003), adaptogenic (Gupta and Rana.,
2007) and antioxidant activity.
2.2 Review on In vivo and In vitro leaves of Withania somnifera
2.2.1 In vivo Leaves of Withania somnifera:
The leaves of the plant are bitter in taste and used as an antihelmintic. The
infusion is given in fever. Bruised leaves and fruits are locally applied to tumors and
tubercular glands, carbuncles and ulcers. The leaves are used as a vegetable and as fodder
for livestock (Kirtikar et al., 1991). The crude preparation of the plant has been found to
be active against a number of pathogenic bacteria (Mrijalili et al., 2009). The leaves of
the plant (Indian chemotype) are reported to contain 12 withanolides, 5 unidentified
alkaloids (yield, 0.09%), many free amino acids, chlorogenic acid, glycosides, glucose,
condensed tannins, and flavonoids (Khare., 2007). Withaferin A, a steroidal lactone is the
most important withanolide isolated from the extract of the leaves of Withania somnifera
(Uddin et al., 2012)
2.2.2 In vitro leaves of Withania somnifera:
In vitro micro propagation technology has sound and extensive potential for
commercial rapid multiplication of plants because it is a quick method, allows round the
year propagation of identical plants, and produces plants free from diseases (Kumar et al.,
8
2013). Among different plant parts of Withania, leaf extracts had the highest total
phenolic content, followed by root, and stem. In vitro grown plants had higher phenolic
content than greenhouse grown plants (Dewir et al., 2010). It is also abstracted by Doma
et al., (2012) that leaves contain more of withaferin A and withanolide A than roots.
According to Dhar et al. the concentrations of withanolide A, withanone and withaferin
A along with expression levels of all the five genes were appreciably higher in the leaves
than in roots.
2.3 Bioactive components in Withania somnifera:
Withania somnifera (L.) Dunal is used in more than 100 formulations in
Ayurveda, Unani and Siddha and is therapeutically equivalent to ginseng (Sangwan et al.,
2004). It is one of the most valuable medicinal plants synthesizing a large number of
pharmacologically active secondary metabolites known as Withanolides. They are the
C28-steroidal lactones derived from triterpenoids and Glycosylated steroidal lactones
called withanosides, present in roots and leaves. Withanosides are steroidal lactones with
one or more glucose units attatched to C-3 or C-27 positions (Chaturvedi et al., 2012).
Withanolides, a class of phytosteroids deriving their name from Withania, are a novel
group of C-28 steroidal lactones built on an intact or rearranged ergostane framework in
which C-22 and C-26 are oxidised to form a six membered d-lactone ring (Mrijalili et
al., 2009). Putatively, withanolides (C-30) are synthesized via both mevalonate (MVA)
and non mevalonate (DOXP) pathways through cyclization of 2,3 oxidosqualene to
FIGURE 2.1 Withanolide structure ( Mrijalili et al., 2009)
9
cycloartenol (Dhar et al., 2013). The biological activities of withanolides, especially of
the dominant withanolide A and withaferin A, have been studied extensively and, more
recently, have been shown to have anti-cancerous activity (Praveen et al., 2010).
Withaferin A:
Withaferin A (4β,27-dihydroxy-1-oxo-5β,6β-epoxywitha-2-24 dienolide, (Figure
2.2) was the first member of this group of compounds to be isolated from the well-known
South-Asian medicinal plant, W. somnifera (Mrijalili et al., 2009). Lavie’s group (Lavie
et al., 1965) elucidated the structure of withaferin A in leaves of this plant, which is
mainly valued for its anti-cancerous properties. The yields of withaferin A from intact
plants of Withania spp. (Israel Chemotype) are 0.2-0.3% of DW of leaves (Abraham A et
al., 1968). Gupta et al., 1996 have performed a quantitative analysis of Indian
chemotypes of W. somnifera by TLC densitometry and observed that withaferin A is
totally absent in roots, stems, seeds and persistent calyx of fruits of intact plants but
present in leaves (1.6%). It is thermostable and slowly inactivated at pH 7.2. It is
insoluble in water and is administered in the form of suspension. For its separation, the
leaves are extracted with cold alcohol; the extract is purified and dried, and finally
crystallized from aqueous alcohol (yield, 0.18% air dry basis). The yield of this
compound from the South-African plants is reported to be as high as 0.86 percent (Uddin
et al., 2012).
FIGURE 2.2 Withaferin A Structure (Mirjalili et al., 2009)
10
Withanolide A:
Withanolide A is the second type of withanolides studied in Withania
somnifera. Sangwan et al., (2008) studies unequivocally demonstrate that root-contained
withanolide A is independently and inherently de novo synthesized within the roots of the
plant from primary isoprenogenic precursors. The concentration of withanolide A in
different organs of Withania somnifera demonstrated that the content of withanolide A
were significantly present. The maximum concentration of the withanolide A was
obtained in shoot tip (386 /g g-1 DW), followed by leaves, nodes, whole plant, internode,
roots and flowers - 342, 272, 206, 102, 56 and 35 /g g-1 DW (Praveen et al., 2010).
2.4 Pathway genes in secondary metabolite synthesis:
The bioactive compounds are controlled by the expression of various genes
participating in the two major pathways – The classical cytosolic mevalonate (MVA)
pathway and plastid localized 2-Cmethyl-D-erythritol-4-phosphate (MEP) pathway. It is
considered that the accumulation of secondary metabolites is directly related to the
pathway genes expressing various enzymes. According to Razdan et al., (2012), the plant
is well characterized in terms of its chemistry and pharmacology, but very little is known
about the pathway involved in the biosynthesis of withanolides. Biochemical and
FIGURE 2.3 Withanolide A Structure (Gupta and Rana., 2007)
11
molecular studies have been initiated which led to characterization of few genes/enzymes
from this important plant (Ohyama et al., 2008). Recently, attempts to initiate the
elucidated biosynthetic pathway leading to biosynthesis of withanolides (Sharma et al.,
2007; Madina et al., 2007; Senthil et al., 2010; Niu et al., 2014) as well as efficient
transformation system of W. somnifera has been developed. However, none of the genes
involved in the biosynthesis of isoprenoids have been characterized as yet (Gupta et al.,
2013).
Sangwan et al., (2008) have shown the study of various genes that include
HMGR, FPPS, SS, SE, and GT. The relative transcript profiles of identified genes at
various ontogenetic stages illustrated significant variation in leaf and root tissues and
were largely concurrent with the alteration in withanolide pool. Comparatively, the
concentrations of withanolide A, withanone and withaferin A along with expression
levels of all the five genes were appreciably higher in the leaves than in roots (Dhar et al.,
2013)
FIGURE 2.4 Biosynthesis through MVA and MEP Pathway
12
3-Hydroxy-3-methylglutaryl coenzyme A reductase catalyzes irreversible
conversion of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) into mevalonic acid
that constitutes the key regulatory step of isoprenogenesis leading to the synthesis of IPP
and its isomer, DMAPP, the progenitors of homologous series of isoprenoids (Chappell
J., 1995). Akhtar et al., (2013) have characterized the gene encoding 3-hydroxy-3-
methylglutaryl coenzyme A reductase (HMGR; EC 1.1.1.34). The 1,728-bp full-length
cDNA of Withania HMGR (WsHMGR) encodes a polypeptide of 575 amino acids. The
amino acid sequence homology and phylogenetic analysis suggest that WsHMGR has
typical structural features of other known plant HMGRs. HMGR is one of the most
highly regulated enzymes that have been identified (Goldstein and Brown, 1990). The
activity of HMGR is regulated by the concentration of the products of the MVA pathway
(Nakanishi et al.., 1988). Although PqHMGR transcripts have been detected in various
tissues, they are particularly abundant in leaves than in any other parts (Wu et al., 2012).
In plants, sterols are biosynthesized by Mevalonate (Dewick, 2001) and non-
mevalonate pathways (Rohmer, 1999). They occur in highly diversified skeletal and
structural forms that are finally glycosylated. Most of the higher plant sterols possess b-
OH group at C-3 (A-ring) and are transformed into their glycoconjugates by sterol
glucosyltransferases (SGTs). Quantitation of the SGTL1 transcript (EC 2.4.1.173 - sterol
3beta-glucosyltransferase, a family of SGT in Withania somnifera) revealed that it was
expressed at significantly higher level in roots (3.13- fold) and leaves (2.21-fold) as
compared to that in stem. Developmentally, SGTL1 transcript accumulated at a higher
level in mature leaves (2.41-fold) than in the young leaves and seedlings. The full length
cDNA sequence of SGTL1 represents 2532 bp, comprising untranslated regions (UTRs)
of 337 and 89 bp at the 5' and 3' ends, respectively. The amino acid sequence deduced
from the 2103 bp open reading frame (ORF) showed homology (67-45%) to the reported
plant SGTs (Sharma et al., 2007). A sterol glucosyltransferase specific to 3β-hydroxy
position has been purified from the leaves of W. somnifera. Its substrate specificity for
both phytosterols and steroidal sapogenins has been reported recently (Madina et al.,
2007).
The first oxygenation step in phytosterol and triterpenoid biosynthesis is
performed by squalene epoxidase (SE, EC 1.14.99.7), which catalyzes the epoxidation of
13
the double bond of squalene to form 2, 3-oxidosqualene (Laden et al., 2000). A full
length SE gene (WsSQE) of 1,956 bp was cloned which contained an open reading frame
of 1,596 bp, encoding a protein of 531 amino acids with a predicted molecular mass of
57.67 kDa and theoretical PI of 8.48 (Razdan et al., 2012). This enzyme is a
noncytochrome-P450 type monooxygenase, takes part in a process to form a hydroxyl
group that is characteristic of sterols and triterpenols, and functions as a rate-limiting step
in the sterol biosynthesis (Hidaka et al., 1990; Abe and Prestwich., 1999) Being a rate
limiting enzyme, overexpression of SE may have an important role in the regulation of
phytosterols and steroidal lactones in W. somnifera.
Phytosterols, such as campesterol and sitosterol, are biosynthesized via
cycloartenol and catalyzed by cycloartenol synthase (CAS) in higher plants (Ohyama et
al. ,2008). Cycloartenol synthase, (S)-2,3-epoxysqualene mutase (cyclizing, cycloartenol
forming), EC 5.4.99.8 must break 11 bonds and form 11 new ones to transform the
acarbocyclic epoxysqualene to the plant sterol precursor cycloartenol, a pentacyclic
triterpene that contains nine chiral centers (Corey et al., 1993). According to Basyuni et
al., 2007, the open reading frames of CAS from two species, K. candel and R. stylosa
consisted 2,277bp, encoding 758 amino acid residues containing the concensus sequences
of motifs for cycloartenol synthase.
Farnesyl pyrophosphate synthase (FPPS EC 2.5.1.10) catalyzes the production of
farnesyl pyrophosphate (FPP), which is a key precursor for many sesquiterpenoids such
as floral scent and defense volatiles against herbivore attack (Lan et al., 2013). Farnesyl
diphosphate catalyzes the sequential condensations of dimethylallyl diphosphate and
geranyl diphosphate with isopentenyl diphosphate to produce FPP. FPPS belongs to the
family of short-chain prenyltransferases that also includes GPP synthase (GPPS), and the
GPPS catalyzes a head-to-tail of IPP and DMAPP to form GPP (Xiang et al., 2010). The
fulllength cDNA of Withania somnifera FPPS (WsFPPS) of 1,253 bps encodes a
polypeptide of 343 amino acids. The amino acid sequence homology and phylogenetic
analysis suggest that WsFPPS has close similarity to its counterparts from tomato
(SlFPPS) and capsicum (CaaFPPS). According to the gene characterization done by
Gupta et al., (2011), FPPS is found to act as the key enzyme in the pathway of
biosynthesis of isoprenoids.
14
2.5 Techniques for Gene Expression analysis:
Identification of genes has proven extremely powerful for studying the genetic
architecture of complex traits. Quantitative expression studies can reveal regulatory
variation in genes for complex traits. It is important to discover genes to define and
investigate the regulatory elements for mutation, biosynthesis of pharmaceutically
important compounds. The starting point for the meaningful genetic manipulation of a
metabolic pathway in medicinal plants is, availability of cloned genes, development of
facile gene transfer and expression technology to allow over expression or down-
regulation of genes involved in anabolic or catabolic processes in the pathway (Capell
and Christou, 2004). High throughput techniques are available for isolation,
identification, sequencing and characterization of genes from plants. Bioinformatics tools
and databases are flooded with informational data important for research. Such
techniques are highly beneficial for trancriptome study. Transcriptome analysis of Panax
ginseng roots showed totally 6,757 EST obtained from cDNA libraries. Clustering of
those ESTs returned 1,037 contigs and 3,445 singlets for a total of 4,482 putative
unigenes. Using bioinformatics tools, 85% of the EST sequence was well annotated. The
unique transcripts were functionally classified by using Gene Ontology hierarchy, Kyoto
Encyclopedia of Genes and Genomes (KEGG), KEGG orthology (KO) and structural
domain data from biological database (Sathiyamoorthy et al., 2009).
A cDNA library of Withania somnifera was constructed (first on record) from
samples of the 2-months-old, in vitro cultured leaves and roots, which generated 1,047
leaf cDNA and 1,034 root cDNA clones representing 48.5% and 61.5% unique
sequences. About 70% encoded proteins found similar (E-value C10-14) to characterized
or annotated proteins from the NCBI non-redundant database and diverse molecular
functions and biological processes based on gene ontology (GO) classification. An effort
made to gain more information on the genes involved in withanolides biosynthesis.
Highly expressed transcripts, with a particularly high abundance of cytochrome p-450
(0.85% in leaf) were noticed. Pfam analysis revealed the presence of functional domains
in selected sequences (Senthil et al., 2010). Gupta et al., (2013) have studied
on transcriptome sequencing of Withania leaf (101L) and root (101R) which specifically
synthesize withaferin A and withanolide A, respectively. Pyrosequencing yielded
15
8,34,068 and 7,21,755 reads which got assembled into 89,548 and 1,14,814 unique
sequences from 101L and 101R, respectively. A total of 47,885 (101L) and 54,123
(101R) could be annotated using TAIR10, NR, tomato and potato databases. Gene
Ontology and KEGG analyses provided a detailed view of all the enzymes involved in
withanolide backbone synthesis.
The real-time, fluorescence-based reverse transcription polymerase chain reaction
(RT PCR) is one of the enabling technologies of the genomic age and has become the
method of choice for the detection of mRNA (Bustin et al., 2005). Quantitative PCR
allows the researcher to view the entire reaction and product being generated throughout
all stages of the reaction. In its simplest and cheapest form, real time PCR employs the
DNA binding dye, SYBR Green. SYBR Green binds to the minor groove of double
stranded DNA and fluoresces at a much higher intensity when bound to double-strand
DNA when compared with the dye in free solution. As the amplification reaction
proceeds and more double-stranded amplicons are produced, the SYBR Green dye
fluorescence signal will increase and can be detected (Denman and Mcsweeney, 2005). In
the papers of Dhar et al., 2013, Expression profile of five genes namely squalene
synthase (WsSQS), squalene epoxidase (WsSQE), cyloartenol synthase (WsCAS),
cytochrome P450 reductase 1 (WsCPR1) and cytochrome P450 reductase 2 (WsCPR2)
was studied using semi-quantitative PCR method at five developmental phases.
2.6 Secondary metabolite accumulation study
Chromatography is essentially a group of techniques used for separation of the
constituents of mixture by continuous distribution or adsorption of analyte between two
phases. Among various chromatographic analytical techniques, HPTLC has a firm place
as a reliable method for analysing several samples of divergent nature and composition at
the same time (Sripathi et al., 2011). High Performance Thin Layer Chromatography is
one of the modern sophisticated techniques that can be used for wide diverse
applications. It is a simple and powerful tool for high‐resolution chromatography and
trace quantitative analysis is made possible. It is most widely used for quick and easy
determination of quality, authenticity and purity of the crude drugs and market
formulations (Mamatha, 2011). Different solvents of varying polarity have been applied
16
for the extraction, and methanol was found suitable for the most efficient extraction of
andrographolide derivatives (Saxena et al., 2000). Quantification of withaferin-A was
done on both chloroform and hydroalcoholic fraction along with methanolic extract by
using solvent system toluene: ethyl acetate: formic acid in the ratio of (5: 5: 1) (Prasad et
al., 2010). Shetty and Nareshchandra, (2012) have revealed that HPTLC fingerprints of
mother plants and their regenerants produce variability in their chemical constituents.
Jirge et al., 2011 have validated a High Performance Thin Layer Chromatography
method for simultaneous estimation of two biomarkers present in Ashwagandha viz.,
withaferin A and beta‐sitosterol‐D‐glucoside. HPTLC method can be used to determine
batch to batch variations and routine analysis by herbal manufacturers of Ashwagandha
formulations. It has been observed that Camag linomat HPTLC system equipped with an
automatic TLC sampler, TLC scanner, and integrated software was used for the
secondary metabolite analysis of most of the plant samples. Alam P et al., 2012 have
concluded that the HPTLC method was found to be specific and accurate and can be used
for qualitative estimation of crude extract of Withania and its polyherbal formulations.
HPTLC method is especially suitable for the fingerprinting and high throughput analysis
of botanical samples and herbal formulations.
17
MMAATTEERRIIAALLSS AANNDD MMEETTHHOODDSS
18
3. MATERIALS AND METHODS:
The work “Dynamics of major Withanolide accumulation, with respect to
ontogenic expression of key pathway genes in in-vivo and in-vitro leaves of Indian
ginseng: Withania somnifera” was carried out with the objective of identifying the
expression levels of various withanolide pathway genes in in vivo shoots with respect to
withanolide A and withaferin A accumulation. The materials used and experimental
procedures employed in the present study are described under the following headings.
3.1 Materials:
3.1.1 Plant materials
3.1.2 Chemicals
3.2 Methods:
3.2.1 Cultivation of Withania somnifera seeds and its sampling
3.2.2 In vitro culture studies of Withania somnifera
3.2.2.a Preparation of Media
3.2.2.b Culturing of Withania somnifera in vitro leaves
3.2.3 Gene Expression Studies
3.2.3.a RNA isolation
3.2.3.b cDNA synthesis and quantification
3.2.3.c Quantitative real time PCR
3.2.4 HPTLC analysis of secondary metabolites
3.2.4.a Extraction of Secondary Metabolite
3.2.4.b HPTLC Analysis
19
3.1 Materials:
3.1.1 Plant Material:
Initial stage shoots (1 month) to old matured shoots (6 month) were obtained from
in vivo grown plantlets of Withania somnifera Jawahar 20 seeds which were sown and
maintained in the fields.
In vitro leaves were obtained from 30D, 45D and 60D old shoots grown in vitro under
maintained standardized conditions.
3.1.2 Chemicals:
HIMEDIA and FISHER chemicals were used for this study unless otherwise
mentioned. RNA and protease free water was used for the entire work. Reagents used for
RNA isolation were purchased from Bangalore GeNei. cDNA synthesis and PCR studies
were carried out using kits from Invitrogen (Superscript Vilo) and Sigma Aldrich.
3.2 Methods:
3.2.1 Cultivation of Withania somnifera seeds and its sampling:
The Jawahar 20 seeds of Withania somnifera were sown in the fields of
Avinashilingam University in the 1st week of August. The rainy season is the optimum
sowing season for the plant. The field was watered as required ensuring moisture and
standard cultivation practices were followed, with respect to weeding. The leaves from
saplings were collected at monthly intervals from one month after sowing until mature
six months.
3.2.2 Invitro culture studies of Withania somnifera:
3.2.2.a Preparation of Media:
Full Murashige and Skoog medium (MS) (Murashige and Skoog, 1962) were used
for all the plant tissue culture experiments. (Appendix 1: Composition of stock
solution)
The macro, micronutrients, vitamins and myo-inositol were taken from the stock
solutions according to the requirement along with sucrose. The pH of the media was
adjusted to 5.8. Solidifying or gelling agent (agar, 0.8%) was added to the media and
20
steamed to melt. It was then dispensed in clean culture bottles (30 ml per bottle) and
autoclaved at 15 lbs pressure at 121ºC for 20 minutes.
3.2.2.b Culturing of Withania somnifera in vitro leaves:
Simultaneously to the field grown plantlets of Jawahar 20, seeds were also
germinated in vitro. The seeds were washed in tap water for about 10 minutes. After
repeated washing, seeds were washed twice in distilled water and soaked overnight for
imbibitions. Water was decanted and the seeds were cleansed in 5% Tween 20 for 5
minutes, followed by wash in sterile distilled water. Finally the seeds were surface
sterilized in a laminar airflow chamber using 0.1% mercuric chloride for 2-3 minutes
with occasional swirling. Washed thrice with sterile distilled water and then inoculated in
half MS solid basal medium supplemented with 2% sucrose for germination. The
inoculated bottles were incubated in dark at 25˚C. Shoots obtained from in vitro
germinated seedlings were cultured in basal MS media without any hormonal
intervention and were maintained at 25˚ C for 16 hours photoperiod.
3.2.3 Gene Expression Studies:
Previous studies have shown that biochemical and molecular studies have been initiated
which led to the characterization of few genes/enzymes from this important plant.
3.2.3.a RNA isolation and quantification:
100 mg of fresh plant leaf tissues were taken and homogenized in a sterile pestle
and mortar with 1ml of Trizol reagent. The content was transferred to a 2ml sterile
eppendorf tube and incubated at room temperature for 30 mins. It was further centrifuged
at 12000 rpm for 20 mins at 4°C. The supernatant was transferred into a new eppendorf
tube, 200µl of chloroform was added into it and let to stand at room temperature for 2-3
mins. The tubes were vortexed and then centrifuged at 12000 rpm for 15 mins at 4°C. To
the supernatant, 500 µl of Isopropyl alcohol was added and let to stand at room
temperature for 10 mins. The centrifugation step was carried as earlier for 10 mins after
which the supernatant was discarded and the pellet was washed using 50µl of 70% ice-
cold ethanol. Again it was centrifuged at 8000 rpm for 5 mins at 4°C. The ethanol was
discarded and repeated the washing step. The pellet was air dried not more than 10 mins
21
and finally dissolved the RNA in 30 µl protease and nuclease free water and stored at -
20°C.
The intact quality of isolated RNA was visually checked in 1.2% formaldehyde
Agarose using Lambda DNA as the control. RNA was first treated with DNase (1:10
ratio) and incubated at 37°C for 1 hr. Added 0.5 µl of RNA loading dye to 2 µl of RNA
and kept for heat inactivation at 65°C water bath for 5 mins. Immediately quenched in ice
for 5 mins and resolved the RNA in Formaldehyde Agarose gel. The purity of the RNA
was checked using Biospec Nano (Shimadzu) based on which the amount of RNA for
cDNA synthesis was calculated (per microgram concentration).
3.2.3.b cDNA synthesis and quantification:
cDNA synthesis was carried out using Superscript Vilo cDNA synthesis kit from
Invitrogen by applying the following PCR conditions.
PCR reaction:
25 °C for 10 mins
45 °C for 60 mins
85 °C for 5 mins
Quality check was carried out in 1.3% Agarose along with DNA ladder. The cDNA was
diluted to 1:9 ratio for further qRT-PCR quantification.
3.2.3.c Quantitative real time PCR:
Real-time quantitative PCR was performed using 100 ng of cDNA in a 10μl
reaction volume using Luminoct SYBR® Green Master Mix (Sigma Aldrich). The
expression of genes involved in Withanolide biosynthesis - HMGR, CAS, SE, FPPS, and
GT were analysed using gene specific primers which were designed using the online
software Primer 3 (Rozen and Skaletsky, 2000) identified by previous researches in the
lab (Table 3.1). Primers were designed for GAPDH which was used as control to ensure
that equal amount of cDNA was used in all the reactions.
22
MASTER MIX: 10 µl
SyBR green – 5µl
Left Primer – 1µl (5pm/µl)
Right Primer – 1µl (5pm/µl)
Template – 1.5µl (100 ng)
Nuclease Free water – 1.5µl
The thermal cycler conditions (recommended by the manufacturer):
95°C – 5:00 min
94°C – 00:30 min
60°C – 00:30 min
72°C – 5:00 min
The fluorescent product was detected at the last step of each cycle.
3.2.4 HPTLC analysis of secondary metabolites:
3.2.4.a Extraction of Secondary Metabolites:
For quantitative HPTLC analysis of withanolides, the plant material (1 month to 5
month Leaf samples) was extracted thrice with methanol by sonication. 1 g of the dried
leaves were weighed, mixed with 1 ml of ammonia and incubated for 20 mins at room
temperature. About 50 ml Methanol was added and sonicated for 20 mins to disrupt the
cells. The sonicated sample was then kept in a shaker for 2 hrs at 150 – 200 rpm. Further
the extracts were filtered using a Wattmann Filter paper1. The flow through is then stored
in fridge. The above experiment was repeated thrice mixing all the three flow through.
The flow through was concentrated using Flash Evaporator (Equitron) at 150 rpm. The
extractive value was calculated using standard procedures.
40 cycles
Extractive Value = Final Weight (FW) - Initial Weight (IW)
23
3.2.4.b HPTLC Analysis:
HPTLC was carried out using the methanolic leaf extracts of Withania somnifera
which were sprayed to 20*10cm Silicon aluminium Thin layer chromatographic plates as
6mm bands, under a stream of nitrogen gas, by means of a CAMAG Linomat V
semiautomatic sample applicator fitted with a 100µl Hamilton HPTLC syringe. The
mobile phase was prepared adding Toluene: Ethyl Acetate: Formic acid in a ratio of
5: 5: 1. The chromatographic twin trough chamber (CAMAG 20*10) was saturated with
mobile phase for 30 min at room temperature (25ºC±2). The samples were separated on
TLC plates kept in the mobile phase until the solvent reaches few centimeters below the
upper end. It was then dried and the banding patterns were visualized in 254nm, 366nm
and white light using a visualize (CAMAG) and the Rf value was calculated.
Densitometric scanning was performed using Camag TLC scannerIII at an absorbance of
520nm for Withanolide A and at 223nm for Withaferin A after derivatization as the
bioactive compounds are clearly visualized and clear peaks are obtained at particular
spectrum only. The plate was derivatized using Anisaldehyde Sulphuric Acid. The
concentration of the compound separated by chromatography, were determined from the
intensity of diffusely reflected light and evaluated by comparing the peak areas with
linear regression. The quantitative value of the two compounds, withanolides A and
withaferin were saved for comparative analysis.
24
TABLE 3.1 Primer Sequence of pathway genes
Primer
name
Primer sequence Amplicon
size
Ws GT
Forward primer- 5' GTTTTCCTTCTTGCCGAGTG 3' Reverse Primer – 5' AGGTCCCAGTCCCTTTTCAT 3'
183
Ws HMGR
Forward primer – 5' TGCTGCCAATATCGTCTCTG 3‘ Reverse Primer – 5' CCGTCACTGATAGCCTCCAT 3'
105
Ws FPPS
Forward primer – 5' TCGGGGGCTATCTGTTATTG 3' Reverse primer – 5' CTCGGACGTGTATGGGAGTT 3’
165
Ws SE
Forward primer – 5’- AGGGACCTGAGGAGCAAC-3’ Reverse primer– 5’-GGCTGATCCATCACCAATCT-3’
146
Ws CAS
Forward primer – 5' GCCTGGCTTGATTATTGCTC 3' Reverse Primer – 5' CACCCACCATCACTGTTCTG 3'
117
GAPDH
Forward primer – 5' CTCCATCACAGCCACTCAGA 3' Reverse Primer – 5' GGTAGCACTTTCCCAACAGC 3'
129
25
RREESSUULLTTSS AANNDD DDIISSCCUUSSSSIIOONN
26
4. RESULTS AND DISCUSSION
The results obtained during the course of the present study entitled
“Dynamics of major Withanolide accumulation, with respect to ontogenic
expression of key pathway genes in in-vivo and in-vitro leaves of Indian ginseng:
Withania somnifera” are presented and discussed under the following subheadings.
4.1 Plant growth analysis
4.1.1 In vivo culture of Withania somnifera
4.1.2 In vitro culture of Withania somnifera
4.2 Gene Expression Studies
4.2.1 In vivo expression study
4.2.1.a Expression pattern of 3-Hydroxy-3-methylgutaryl coenzyme A
reductase (HMGR)
4.2.1.b Expression pattern of Farnesyl di phosphate Synthase (FPPS)
4.2.1.c Expression pattern of Squalene Epoxidase (SE)
4.2.1.d Expression pattern of Cycloartenol Synthase (CAS)
4.2.1.e Expression pattern of Glucosyl Transferase (GT)
4.2.2 Comparison of FPPS Gene Expression - In vivo and In vitro
4.3 Secondary Metabolite Accumulation
4.3.1 Quantitative analysis of secondary metabolite accumulation
4.4 Conclusion
27
4.1 Plant growth analysis:
4.1.1 In vivo culture of Withania somnifera:
The Jawahar 20 seeds were sown using standard cultivation practices during the
1st week of August (early sowing season). Plantlets were obtained after one month from
the day of sowing. Uniform plants reaching the size of about 5cm from the ground were
obtained. Flowering depicts the onset of the second month of growth. The plants were
about 10 cm in height. Next phenophase is observed during the Green berry stage
followed by the fourth month of yellow berry. Plants have shown an increase in their
height attaining 14cm in the 3rd month and 16 cm in the 4th month. Finally the fifth life
stage shows withering of leaves and wrinkled brown colored berries. The plant size was
found to be static at this point as the shrub has shown no increase in height. Leaves taken
during these stages show morphological size variations from which gene expression
studies were carried out.
TABLE 4.1: In vivo Leaf Morphology
S.No.
Stages
Size of the
Leaf
(cm)
Height of the
Plant (cm)
1. Plantlet – 30 days 1.5 - 2.2 5-6.5
2. Flowering(yellow green) – 60 Days 2.0 - 3.1 10-15
3. Berry stage (Green) – 90 Days 2.8 - 4.5 18-20
4. Fruit Ripening (Yellow) – 120 Days 3.4 - 5.9 25-30
5. Withering – 150 Days 3.6 - 8 30-32
28
PLATE 4.1 Different Stages of Field Grown Leaf
60 DAY OLD LEAF
30 DAY OLD LEAF
120 DAY OLD LEAF
90 DAY OLD LEAF
150 DAY OLD LEAF
29
PLATE 4.2 Growth stages of in vivo Withania somnifera
1 Month Stage Flowering Stage
Green Berry Stage Yellow Berry Stage
Withering Stage
30
4.1.2 In vitro culture of Withania somnifera:
The Jawahar 20 seeds inoculated in vitro, germinated in 2 weeks. These plantlets
were subcultured in full MS Media and the leaves were collected in three stages. During
the 1st month the plant was small upto a size of 2.5cm. The leaves were tiny and light
green. The second stage taken is the 45 day old plant grown to a size of 4 cm. The plants
produced flower buds of green to yellow green colour. The leaves were double the size
with proper ovate shape and a darker green colour. The final stage is the matured 2 month
old plants. These plants have a thicker green stem and have grown upto a height of 7-
7.2cm. The leaves were big and ovate with attaining the dark green colour similar to the
field grown plants.
TABLE 4.2 In vitro leaf Morphology
S.No. Stages Size of the
Leaf
(cm)
Height of the
Plant (cm)
1. Plantlet – 1 month old 05-0.8 2.5-4.5
2. Flowering – 45 day old 1-1.6 4-8.5
3. Maturation – 2 month old 2.2-2.8 7.2-10.6
30 DAY OLD 45 DAY OLD 60 DAY OLD
PLATE 4.3 Different stages of in vitro Withania somnifera
31
4.2 Gene Expression Studies:
RNA was isolated from the in vivo and in vitro leaves of Withania somnifera. It
was visually checked in 1.2% formaldehyde Agarose gel in which two clear bands of
RNA isolated is documented.
PLATE 4.4 RNA Quantification of in vivo and in vitro leaves
1 M FG 2 M FG 3 M FG 4 M FG 5 M FG
Fig 1. In vivo Leaf RNA Fig 2. In vitro Leaf RNA
1 M IV 2 M IV 3 M IV
Figure 1 : Figure 2 : Lane 1 - 1 Month In vivo Leaf Lane 1 – 1 Month In vitro LeafLane 2 - 2 Month In vivo Leaf Lane 2 – 2 Month In vitro LeafLane 3 - 3 Month In vivo Leaf Lane 3 – 3 Month In vitro LeafLane 4 - 4 Month In vivo LeafLane 5 - 5 Month In vivo Leaf
4.2.1 In vivo expression study:
The biosynthesis of Withanolides is on the whole under the transcriptional control
of Mevalonate pathway in which the key pathway genes express for various enzymes.
Differential expression analysis suggests that most of the genes involved in triterpenoid
biosynthesis show more expression in leaf as compared to root. Similar observation have
been made for Withania HMGR, FPPS, DXS and DXR in previous studies (Gupta et al,
2013). Thus further gene expression studies are required to clearly identify its metabolic
relation with the withanolides accumulation.
The main genes focused on were Hydroxymethylglutaryl CoA Reductase
(HMGR), Farnesyl Pyrophosphate synthase (FPPS), Squalene epoxidase (SE),
Cycloartinol synthase (CS) and Glucosyl transferase (GT). Quantitative RT-PCR was
32
performed with using the total RNA isolated from the leaves of Withania somnifera as
template.
4.2.1.a Expression pattern of 3-Hydroxy-3-methylglutaryl coenzyme A reductase
HMGR:
3-Hydroxy-3-methylgutary coenzyme A reductase (HMGR, EC 1.1.1.34)
catalyzes the synthesis of mevalonate which is a result of NAD(P)H-dependent reduction
of HMG-CoA. There were significant linear variations in the transcript profile of HMGR
in the different developmental stages of leaf where the maturation stage shows the
highest expression. Wu et al., (2012) reported PqHMGR is differentially expressed
among tissues, with a strong expression in the leaf.
FIGURE 4.1 Expression of 3-Hydroxy-3-methylglutaryl coenzyme A reductase
4.2.1.b Expression pattern of Farnesyl diphosphate Synthase (FPPS):
FPPS and squalene synthase (SqS) constitute key steps en route to production of
the progenitor(s) of withanolide biosynthesis. Farnesyl diphosphate (FPP), which is
synthesized by catalytic action of the enzyme farnesyl diphosphate synthase (FPPS),
serves as a substrate for first committed reaction of several branched pathways
0
1
2
3
4
5
6
7
8
9
10
1M FG L 2M FG L 3M FG L 4M FG L 5M FG L
Rela
tive
Gen
e ex
pres
sion
Tissue stages
HMGR
33
(Chappell,1995). Based on the expression results of the plant leaves, FPPS has shown a
linear increase till the fourth month after which it has reduced to a minimal amount. This
is the most highly expressed gene in the leaves and can be further related to the
accumulation of Withaferin A compound. From the result, greatest change was observed
in the expression of FPPS transcripts compared to the rest of the pathway genes in leaves.
Expression of WsFPPS in leaf was maximum for different chemotypes of Withania
somnifera (Gupta et al., 2011).
FIGURE 4.2 Expression of Farnesyl Pyrophosphate Synthase
4.2.1.c Expression pattern of Squalene epoxidase (SE):
Squalene epoxidase expressed its highest in the fourth field grown leaf. The third
month had shown a comparative lesser expression but the expression levels in the rest of
the month leaves and the in vitro was very meager. Earlier studies have reported that
higher expression of Squalene epoxidase corroborates well with the higher expression of
Withanolide in leaves (Razdan et al., 2012). Even though, the in vitro expression of SE
was very less in leaves, it also goes in a similar behavior expressing more in the 45th day
old leaf and then reducing back to a smaller amount. Principally, squalene epoxidase (EC
1.14.99.7) functions as a rate-limiting step in catalyzing the stereospecific epoxidation of
squalene to 2, 3-oxidosqualene (Dhar et al.,2013 and Han et al., 2010).
0123456789
10
1M FG L 2M FG L 3M FG L 4M FG L 5M FG L
FPPS
Gen
e Ex
pres
sion
Tissue stage
FPPS
34
FIGURE 4.3 Expression of Squalene Epoxidase
4.2.1.d Expression pattern of Cycloartenol synthase (CAS):
Phytosterols, such as campesterol, steroid lactones, sitosterol, are biosynthesized
via cycloartenol and catalyzed by cycloartenol synthase (CAS) in higher plants. It acts as
an intermediate in the Pathway biosynthesis. Unlike FPPS and SE, CAS expression was
reported to be enhanced based on the increasing phenophase with the maximum
expression in the maturation stage of the plant.
FIGURE 4.4 Expression of Cycloartenol Synthase
0
1
2
3
4
5
6
7
8
9
10
1M FG L 2M FG L 3M FG L 4M FG L 5M FG L
SE G
ene
Expr
essi
on
Tissue stage
SE
0123456789
10
1M FG L 2M FG L 3M FG L 4M FG L 5M FG L
CAS
Gen
e Ex
pres
sion
Tissue stage
CAS
35
4.2.1.e Expression pattern of Glucosyl Transferase (GT):
The expression of Glucosyl Transferase in the initial plantlets were higher
compared to the next stage but further exhibited up regulation with each progressing
phenophase. Sharma et al., (2007) have shown that SGTL1 transcript accumulated at a
higher level in mature leaves (2.41-fold) than in the young leaves and seedlings.
FIGURE 4.5 Expression of Glucosyl Transferase
Thus an overall expression analysis of the various genes in the leaf tissues of different
plant growth stages indicates that Farnesyl pyrophosphate (FPPS) is the most up-
regulated gene in the leaves. Also the level of expression is maxiimum in the 4th month of
plant growth that is the leaves from the yellow berry stage.
Therefore FPPS gene can be focused upon to compare its expression with the in
vitro FPPS gene to compare the efficacy of the in vitro plant for the synthesis of
secondary metabolites.
0
1
2
3
4
5
6
7
8
9
10
1M FG L 2M FG L 3M FG L 4M FG L 5M FG L
GT
Gen
e Ex
pres
sion
Tissue stage
GT
36
FIGURE 4.6 Comparative expression of five major pathway genes expressed in different
phenophases
4.2.2 Comparison of FPPS Gene Expression - In vivo and In vitro:
Due to the indiscriminate collection of huge amount of this plant by local
herbalists, Ayurvedic and Unany companies, this plant species is on the verge of
extinction. Under such a situation it is important to develop the techniques for rapid mass
propagation of this species to meet up the commercial need, research use and also for
protecting the genetic erosion (Kumar et al., 2013)
0
1
2
3
4
5
6
7
8
9
10
HMGR GT SE CAS FPPS
Rela
tive
Gen
e Ex
pres
sion
Key Pathway Genes
1M FG L
2M FG L
3M FG L
4M FG L
5M FG L
37
FIGURE 4.7 In vitro FPPS Quanification
Comparing the In vivo expression of FPPS with the in vitro leaf expression, it can be
evaluated that the expression patterns of both show high similarity. The FPPS gene is
highly expressed in the 4th month and the 45th day old leaves. After which the expression
decreases in the maturation stage. To add on, the expression level in in vitro leaves is
above 6 which is on par with the field grown expression.
4.3 Secondary Metabolite Accumulation:
The HPTLC analysis of the in vivo and in vitro leaves of Withania somnifera,
were performed using the solvent system Toluene: Ethyl acetate: Formic acid (5:5:1) in
order to check the accumulation of two main secondary metabolites: Withanolide A and
Withaferin A using its pure standard. The results revealed that among the different stages
of in vivo leaves of Withania somnifera, 4th yellow berry stage showed various spots
indicating an increased number of phytoconstituents as well as higher accumulation of
the two constituents. The banding pattern of Withanolide A was less compared to the
accumulation of Withaferin A depicting that leaves contain more of Withaferin A. The
qualitative evaluation of the plate was done by determining the migrating behavior of the
separated substances calculated as the Retention factor (Rf). Similar validation of a High
Performance Thin Layer Chromatography method for simultaneous estimation of two
biomarkers present in Ashwagandha viz., withaferin A and beta‐sitosterol‐D‐glucoside
was done by Jirge et al., (2011).
0
2
4
6
8
10
30 DO R 45 DO R 60 DO R
in v
itro
FPPS
gen
e ex
pres
sion
Tissue stage
In vitro FPPS Expression
FPPS
38
1 2 3 4 5 6 7 8 9 10 11 12
LANE1-4 – Withanolide A Standard5 - 1 Month Field grown Leaf 10 - 1 Month In vitro Leaf6 - 2 Month Field grown Leaf 11 - 45 Day old In vitro Leaf7 - 3 Month Field grown Leaf 12 - 2 Month In vitro Leaf8 - 4 Month Field grown Leaf9 - 5 Month field grown Leaf
PLATE 4.5 HPTLC Fingerprint of Withanolide A in white light
1 2 3 4 5 6 7 8 9 10 11 12LANE1-4 – Withanolide A Standard5 - 1 Month Field grown Leaf 10 - 1 Month In vitro Leaf6 - 2 Month Field grown Leaf 11 - 45 Day old In vitro Leaf7 - 3 Month Field grown Leaf 12 - 2 Month In vitro Leaf8 - 4 Month Field grown Leaf9 - 5 Month field grown Leaf
PLATE 4.6 HPTLC Fingerprint of Withanolide A in 366 nm
39
Visualizing the the plate, well defined bands were obtained in which the amount of
withanolides compared to the standard is very low in field grown as well as in in vitro
leaves.
In the withaferin A plate the field grown leaves have shown considerable amount of
banding pattern with an increase in accumulation with each stage till the 4th month and
further a drop in the colour development in the 5th month. In vitro leaves have also shown
in like manner to the in vivo leaves.
1 2 3 4 5 6 7 8 9 10 11 12
LANE1-4 – Withaferin A Standard5 - 1 Month Field grown Leaf 10 - 1 Month In vitro Leaf6 - 2 Month Field grown Leaf 11 - 45 Day old In vitro Leaf7 - 3 Month Field grown Leaf 12 - 2 Month In vitro Leaf8 - 4 Month Field grown Leaf9 - 5 Month field grown Leaf
PLATE 4.7 HPTLC Fingerprint of Withaferin A in white light
40
1 2 3 4 5 6 7 8 9 10 11 12
LANE1-4 – Withaferin A Standard5 - 1 Month Field grown Leaf 10 - 1 Month In vitro Leaf6 - 2 Month Field grown Leaf 11 - 45 Day old In vitro Leaf7 - 3 Month Field grown Leaf 12 - 2 Month In vitro Leaf8 - 4 Month Field grown Leaf9 - 5 Month field grown Leaf
PLATE 4.8 HPTLC Fingerprint of Withaferin A in 366 nm
4.3.1 Quantitative analysis of secondary metabolite accumulation:
Quantitative analysis using HPTLC Camag scanner have produced various peaks
related to the amount of metabolite accumulation. Based on the amount of accumulation,
the tracts were scanned and the peaks were displayed. The amount of withanolide A and
withaferin A in each of the stage samples were quantified in comparison with the peak
area of the standards using an evaluation mode and at multilevel calibration modes and a
linear regression graph was obtained using CAMAG software.
41
FIGURE 4.8 Regression Graph for Withanolide A
FIGURE 4.9 Withanolide A Quantification
The peak area analysis revealed the concentration of Withanolide A along the different
phenophase out of which 2 month in vivo leaves show the highest accumulation of
0
10
20
30
40
50
60
1M FG 2M FG 3M FG 4M FG 5M FG 30 DO 45 DO 60 DO
With
anol
ide
A (µ
g/g)
Leaf Tissue
Withanolide A
42
56µg/g concentration. In vitro leaves in their 45 day stage have shown up regulated
accumulation (22µg/g) in parallel to the in vivo 2 months.
FIGURE 4.10 Regression Graph for Withaferin A
FIGURE 4.11 Withaferin A Quantification
0
500
1000
1500
2000
2500
3000
3500
4000
1M FG 2M FG 3M FG 4M FG 5M FG 30 DO 45 DO 60 DO
With
afer
in A
(µg/
g)
Leaf Tissue
Withaferin A
43
Withaferin A was shown to increase in a linear form showing the highest
accumulation during the 4th month stage. Similar pattern was also observed in
accumulation pattern of main withnolides from chemotypes of Withania somnifera one of
which contained highest level of its main withanolide (withaferin A) (Gupta et al., 2011).
The accumulation of withaferin was found to be 3895µg/g in the highest stage. Thus
leaves are a good source of withaferin A compared to withanolides A.
4.4 Conclusion:
Therefore with the attained results a relation between the expression of FPPS and
the accumulation of Withaferin A in leaves can be put forth. The in vivo gene expression
is similar to in vitro expression suggesting that similar metabolites are synthesized in in
vitro leaves. Thus in vitro culturing can be supported to conserve the extinction of flora.
Based on the secondary metabolite accumulation study, withanolides A content is less in
leaves compared to Withaferin A which is consistent to related supporting studies.
44
SSUUMMMMAARRYY AANNDD CCOONNCCLLUUSSIIOONN
45
5. SUMMARY AND CONCLUSION
In the present study entitled “Dynamics of major Withanolide accumulation, with
respect to ontogenic expression of key pathway genes in in-vivo and in-vitro leaves of
Indian ginseng: Withania somnifera”, the analysis of gene expression and withanolide
accumulation was carried out in different phenophases of the plant, Ashwagandha
(Withania somnifera).
In vivo plants were grown in field and maintained for 5 months until withering.
Simultaneously in vitro plants were also cultured in Basal MS under lab conditions. Total
RNA was extracted from the leaves on each stages of field grown plants – 30 Day old
plantlet, 60 Days flowering, 90 Days green berry, 120 Days yellow berry and 150 Days
withering stage. In vitro plants mature in 60 days, thus three stages were taken for
isolation – 30 days, 45 days and 60 days old leaves. The size variation of the leaf and
height of the plant were observed to analyse the growth stages of Withania somnifera.
The in vitro plants were comparatively shorter. The RNAs obtained from leaves were
quantified and 1 µg of the purified RNA was reverse transcribed using Superscript Vilo
(Invitrogen) cDNA synthesis kit. Real-time quantitative PCR was performed using 100
ng of cDNA and primers of five key pathway genes, designed in previous researches in
lab using Luminoct SYBR® Green Master Mix (Sigma Aldrich).
Comparing the gene expression of the five key pathway genes - -Hydroxy-3-
methylgutary coenzyme A reductase (HMGR), Farnesyl diphosphate synthase (FPPS),
Squalene epoxidase (SE), Cycloartenol Synthase (CAS) and Glucosyl transferase (GT),
FPPS gene was the maximum expressed gene in the leaves producing maximum up
regulation in the 120 D old leaves further dropping down during withering. Thus FPPS
was further taken for comparison with the in vitro FPPS gene expression. In vitro FPPS
also showed similar gene expression showing maximum expression in 45 D old leaves
and thus metabolic synthesis can also be considered similar.
Next in line the two major withanolides, withanolide A and withaferin A were
quantified for its level of accumulation in leaves at each identified stage of plant growth.
The withanolide A and withaferin A content were analysed using HPTLC (Camag). The
46
HPTLC fingerprints showed that the expression of withaferin A is higher in leaves
compared to withanolide A. Withanolide A has shown meager accumulation in leaves.
The accumulation pattern of withaferin A in leaves is highly similar to the FPPS gene
expression showing maximum expression in 120 D old in vivo leaves and 45 D old in
vitro leaves. Thus the gene expression studies on relative expression of Farnesyl
diphoaphate synthase (FPPS) and withaferin A accumulation in in vitro and in vivo leaves
of Withania somnifera can be directly correlated. It can prove the efficacy of in vitro
plants to in vivo plants for the synthesis and extraction of large scale secondary
metabolites used in therapeutic purposes.
In the future prosective of Withania genomics, the regulation of this gene
expression in presence of an inhibitor should be performed to confirm its relation to
withaferin A synthesis. In vivo leaves being a good anti-cancer agent can initiate the
study on in vitro leaves for similar anti - cancer mechanism. Such studies will help in
deeper understanding of the withanolides biosynthesis as well as provide genetic source
for better biotechnological interventions in this plant.
47
BBIIBBLLIIOOGGRRAAPPHHYY
48
BIBLIOGRAPHY
o Abe I and Prestwich GD (1999) Squalene epoxidase and oxidosqualene:
lanosterol cyclase-key enzymes in cholesterol biosynthesis. In: Cane DE (ed)
Comprehensive natural products chemistry, isoprenoids including carotenoids and
steroids. Elsevier, Oxford, 2:267–29.
o Abraham A, Kirson I, Glotter E and Lavie D (1968) A chemotaxonomic study of
Withania somnifera (L.) Dun. Phytochemistry, 7:957-962.
o Akhtar N, Gupta P, Sangwan NS, Sangwan RS and Trivedi PK (2013) Cloning
and functional characterization of 3-hydroxy-3 methylglutaryl coenzyme A
reductase gene from Withania somnifera : an important medicinal plant.
Protoplasma, 250:613–622.
o Alam P, Gupta J, Firdouse S, Sultana A, Fathima N and Ummara, U (2012)
HPTLC Method for qualitative estimation of Withania somnifera Linn in
polyherbal formulation, Pharmacie Globale, 11:1-3.
o Basyuni M, Oku H, Tsujimoto E and Baba S (2007) Cloning and Functional
expression of Cycloartenol synthases from Mangrove species, Rhizophora stylosa
Griff. and Kandelia candel (L.) Druce. Biosci. Biotechnol. Biochem., 71:1788-
1792.
o Bustin SA, Benes V, Nolan T and Pfaffl MW (2005) Quantitative real-time RT-
PCR – a perspective. Journal of Molecular Endocrinology, 34:597–601.
o Capell T. and Christou P. (2004). Progress in plant metabolic engineering.
Current Opinion in Biotechnology, 15(2): 148-154.
o Chappell J (1995) The biochemistry and molecular biology of isoprenoid
metabolism. Plant Physiol., 107:1–6.
o Chaturvedi P, Mishra M, Akhtar N, Gupta P, Mishra P and Tuli R (2012) Sterol
glycosyltransferases-identification of members of gene family and their role in
stress in Withania somnifera. Mol. Biol. Rep., 39:9755–9764.
o Chen J, Janet DR, and Wang SM (2000) Generation of longer cDNA fragments
from serial analysis of gene expression tags for gene identification. Proc. Natl.
Acad. Sci., 97(1):349-353.
49
o Corey EJ, Matsuda SPT and Bartel B (1993) Isolation of an arabidopsis thaliana
gene encoding cycloartenol synthase by functional expression in a yeast mutant
lacking lanosterol synthase by the use of a chromatographic screen. Proc. Natl.
Acad. Sci., 90:11628-11632.
o Denman SE and Mcsweeney CS (2005) Quantitative (real-time) PCR. Methods in
Gut Microbial Ecology for Ruminants, (Australia): 105–115.
o Dewick PM (2001) in: Medicinal Natural Product: A Biosynthetic Approach,
second ed., Wiley, New York, 237–241.
o Dewir YH, Chakrabarty D, Lee SH, Hahn EJ and Paek KY (2010) Indirect
regeneration of Withania somnifera and comparative analysis of withanolides in
in vitro and greenhouse grown plants. Biologia. Plantarum, 54(2):357-360.
o Dhar N, Rana S, Bhat WW, Razdan S, Pandith SA, Khan S, Dutt P, Dhar RS,
Vaishnavi S, Vishwakarma R and Lattoo SK (2013) Dynamics of withanolide
biosynthesis in relation to temporal expression pattern of metabolic genes in
Withania somnifera (L.) Dunal: a comparative study in two morpho-
chemovariants. Mol. Biol. Rep., 40:7007-7016.
o Doma M, Abhayankar G, Reddy VD and Kishor PBK (2012) Carbohydrate and
elicitor enhanced withanolides (withaferin A and withanolides A) accumulation in
hairy root cultures of Withania somnifera (L.). Indian J. Exp. Biol., 50:484-490.
o Goldstein JL, Brown MS (1990) Regulation of the mevalonate pathway. Nature,
343 (6257):425–430
o Gupta AP, Verma RK, Misra HO, Gupta MM (1996) Quantitative determination
of withaferin A in different plant parts of Withania somnifera by TLC
densitometry. J. Med. Arom. Plant Sci., 18:788-790.
o Gupta GL and Rana AC (2007) Protective effect of Withania somnifera Dunal
root extract against protracted social isolation induced behavior in rats. Indian J.
Physiol. Pharmacol., 51(4), 345–353.
o Gupta GL and Rana AC (2007) Withania somnifera (Ashwagandha): A Review.
Pharmacogn Rev., 1:129-136.
o Gupta P, Akhtar N, Tewari SK, Sangwan RS, Trivedi PK (2011) Differential
expression of farnesyl diphosphate synthase gene from Withania somnifera in
50
different chemotypes and in response to elicitors. Plant Growth Regul., 65:93-
100.
o Gupta P, Goel R, Pathak S, Srivastava A, Singh SP, Sangwan RS, Asif MH,
Trivedi PK (2013) De Novo Assembly, Functional Annotation and Comparative
Analysis of Withania somnifera Leaf and Root Transcriptomes to Identify
Putative Genes Involved in the Withanolides Biosynthesis. PLoS ONE, 8(5):1-12
o Han JY, In JG, Kwon YS, Choi YE (2010) Regulation of ginsenosides and
phytosterol biosynthesis by RNA interferences of squalene epoxidase gene in
Panax ginseng. Phytochemistry, 71(1):36–46.
o Hidaka Y, Satoh T, Kamei T (1990) Regulation of squalene epoxidase in HepG2
cells. J. Lipid Res., 31, 2087–2094.
o Jirge SS, Tatke PA and SY Gabhe (2011) Development and validation of a novel
HPTLC method for simultaneous estimation of Beta – Sitosterol – D – Glucoside
and Withaferin A. Int. J. Pharm. Pharm. Sci., 3:227-230.
o Khare CP (2007) Indian Medicinal Plants–An Illustrated Dictionary. First Indian
Reprint, Springer (India) Pvt. Ltd., New Delhi, 717-718.
o Kirtikar KR, Basu BD (1991) Indian Medicinal Plants; Shiva Publishers:
Dehradun, India, 3:1783.
o Kumar OA, Jyothirmayee G, Tata SS (2013) In vitro conservation of Withania
somnifera(l) Dunal (Ashwagandha) – a multipurpose medicinal plant. J. Asian
Sci. Res., 3:852-861.
o Laden BP, Tang Y and Porter TD (2000) Cloning, heterologous expression, and
enzymological characterization of human squalene monooxygenase. Arch.
Biochem. Biophys., 374:381–388.
o Lan J, Yu R, Yu Y and Fan Y (2013) Molecular cloning and expression of
Hedychium coronarium farnesyl pyrophosphate synthase gene and its possible
involvement in the biosynthesis of floral and wounding/herbivory induced leaf
volatile sesquiterpenoids. Gene, 518:360–367.
o Lavie D, Glotter E, Shvo Y (1965) Constituents of Withania somnifera Dun. Part
IV The structure of withaferin-A. J. Am. Chem. Soc., 30:7517-7531.
51
o Madina BR, Sharma LK, Chaturvedi P, Sangwan RS and Tuli R (2007)
Purification and characterization of a novel glucosyltransferase specific to 27β-
hydroxy steroidal lactones from Withania somnifera and its role in stress
responses. Biochimica et Biophysica Acta., 1774:1199–1207.
o Mamatha A (2011) Quantitative HPTLC analysis of andrographolide in
andrographis paniculata obtained from different geographical sources. Int. J.
Pharm. Pharm. Sci., 3:42-44.
o Mirjalili MH, Moyano E, Bonfill M, Cusido RM and Palazon J (2009) Steroidal
lactones from Withania somnifera, an ancient plant for novel medicine.
Molecules, 14:2373–2393.
o Mishra LC, Singh BB, Dagenais S (2000) Scientific basis for the therapeutic use
of Withania somnifera (Ashwagandha) a review. Altern. Med. Rev., 5:334–46.
o Mohan R, Hammers HJ, Bargagna-Mohan P, Zhan XH, Herbstritt CJ, Ruiz A
(2004) Withaferin A is a potent inhibitor of angiogenesis. Angiogenesis, 7:115–
122.
o Murashige T and Skoog F (1962) A revised medium for rapid growth and
bioassays with tobacco tissue cultures. Physiol Planta. 15: 472-497.
o Nakanishi M, Goldstein JL, Brown MS (1988) Multivalent control of 3-hydroxy-
3-methylglutaryl coenzyme A reductase. Mevalonate-derived product inhibits
translation of mRNA and accelerates degradation of enzyme. J Biol Chem.
263(18):8929–8937.
o Niu Y, Luo H, Sun C, Yang TJ, Dong L, Huang L and Chen S (2014) Expression
profiling of the triterpene saponin biosynthesis genes FPS, SS, SE, and DS in the
medicinal plant Panax notoginseng. Gene, 533:295–303.
o Ohyama K, Suzuki M, Kikuchi J, Saito K and Muranaka T (2008) Dual
biosynthetic pathways to phytosterol via cycloartenol and lanosterol in
Arabidopsis. Proc. Natl. Acad. Sci., 106:725-730.
o Prasad SK, Singh PN, Wahi AK, Hemalatha S (2010) Pharmacognostical
Standardization of Withania coagulans Dunal. Pharmacognosy J., 2(11):386-394.
52
o Praveen N, Naik PM, Manohar SH and Murthy HN (2010) Distribution of
Withanolide A content in various organs of Withania somnifera (l.) Dunal. Int. J.
Pharm. Bio. Sci., 1:1-5.
o Proksa B, Uhrin D, Fuska J (1986) Hydrolysis of withaferin A-4,27-diacetate,
Pharmazie., 41:282.
o Rahman AU, Abbas S, Shahwar DE, Jamal SA and Choudhary MI (1993) New
Withanolides from Withania Spp. J. Nat. Prod., 56:1000-1006.
o Rai D, Bhatia G, Sen T, Palit G (2003) Anti-stress effects of Ginkgo biloba and
Panax ginseng a comparative study. J. Pharmacol. Sci., 93:458–464.
o Razdan S, Bhat WW, Rana S, Dhar N, Lattoo SK, Dhar RS and Vishwakarma RA
(2012) Molecular characterization and promoter analysis of squalene epoxidase
gene from Withania somnifera (L.) Dunal. Mol. Biol. Rep., 40:905–916.
o Rohmer M (1999) The discovery of a mevalonate-independent pathway for
isoprenoid biosynthesis in bacteria, algae and higher plants. Nat. Prod. Rep.,
16:565–574.
o Rozen S. and Skaletsky H. (2000). Primer3 on the WWW for general users and
for biologist programmers. pp. 365-386.
o Sangwan RS, Chaurasiya ND, Lal P, Misra L, Tulib R and Sangwan NS (2008)
Withanolide A is inherently de novo biosynthesized in roots of the medicinal
plant Ashwagandha (Withania somnifera ). Physiol. Plant., 133:278–287.
o Sangwan RS, Lal P, Chaurasiya ND, Uniyal GC, Tuli R, Misra LN and Sangwan
NS (2004) Metabolic pathway of withanolide biosynthesis recruits both
mevalonate and non-mevalonate isoprenogenesis in Withania somnifera Dun.
(Ashwagandha). Chemistry Biology Interface Synergistic New Frontiers, 25–43.
o Sathiyamoorthy S., In J. G., Gayathri S., Kim Y. J. and Yang D. C. (2009).
Generation and gene ontology based analysis of expressed sequence tags (EST)
from a Panax ginseng CA Meyer roots. Molecular Biology Reports, 37(7): 1-8.
o Saxena S, Jain DC, Gupta MM, Bhakuni RS, Mishra HO and Sharma RP (2000)
High-Performance Thin-Layer Chromatographic Analysis of Hepatoprotective
Diterpenoids from Andrographis paniculata. Phytochem. Anal., 11:34-36.
53
o Senthil K, Wasnik NG, Kim YJ, Yang DC (2010) Generation and analysis of
expressed sequence tags from leaf and root of Withania somnifera (Ashwgandha).
Mol Biol Rep 37:893–902.
o Sharma LK, Madina BR, Chaturvedi P, Sangwan RS and Tuli R (2007) Molecular
cloning and characterization of one member of 3b-hydroxy sterol
glucosyltransferase gene family in Withania somnifera. Biochem. Biophys.,
460:48–55.
o Shetty D and Nareshchandra (2012) Comparative study of chemical variants in
regenerants and mother plants of Ashwagandha (W.somnifera (L) Dunal) by
HPTLC Finger printing. Int. J. Res. Ayu. Pharm., 3(5):717-719.
o Sripathi SK, Lalitha P and Poongothai G (2011) HPTLC Fingerprinting of
Extracts of Pisonia grandis (R.Br.). Int. J. Pharm. Sci. Res., 2:180-183.
o Uddin Q, Samiulla L, Singh VK and Jamil SS (2012) Phytochemical and
Pharmacological Profile of Withania somnifera Dunal: A Review. J. App. Pharm.
Sci., 2:170-175.
o Verma SK and Kumar A (2011) Therapeutic uses of Withania somnifera
(ashwagandha) with a note on withanolides and its pharmacological actions.
Asian J. Pharm. Clin. Res., 74:1-4.
o Winters M (2006) Ancient Medicine, Modern Use: Withania somnifera and its
Potential role in Integrative Oncology. Alt. Med. Rev., 11:269-277.
o Wu Q, Sun C, Chen S (2012) Identification and expression analysis of a 3-
hydroxy-3-methylglutaryl coenzyme A reductase gene from American ginseng.
Plant omics J., 5(4):414-420.
o Xiang L, Zhao K, Chen L (2010) Molecular cloning and expression of
Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible
involvement in the biosynthesis of floral volatile sesquiterpenoids. Plant Physiol.
Biochem., 48:845-850.
o Yang D, Du X, Liang X, Han R, Liang Z, Liu Y, Liu F, Zhao J (2012) Different
roles of the mevalonate and methylerythritol phosphate pathways in cell growth
and tanshinone production of Salvia miltiorrhiza hairy roots. Journal. Pone.,
7(11):1-9.
54
AAPPPPEENNDDIICCEESS
55
APPENDIX-I COMPOSITION OF MS MEDIUM
Ingredients Composition (mg/ L) Stock Solution (W/V) (g)
MS Macro I (10 X) 1000ml
NH4NO3 1650 16.5 KNO3 1900 19 MgSO4.7H2O 370.6 3.7 KH2PO4 170 1.7 100 ml MS Macro II (10 X) 1000 ml CaCl2.2H2O 439.8 4.398 100 ml Fe-Na EDTA (1000 X) 100 ml Fe-Na EDTA 36.7 36.7 1 ml Micro Nutrients (1000 X) 100 ml NaMoO4.7H2O 0.25 0.025 CuSO4.5H20 0.025 0.0025 CoCl2.2H2O 0.025 0.0025 MnSO4.4 H2O 13.2 1.32
ZnSO4.4H2O 8.6 0.86 H3BO3 6.2 0.62 1 ml KI (1000X)
0.83 100ml
Myo-Inositol (100 X) 100 ml
Myoinositol 100 1 10 ml MS Vitamins (1000 X) 100 ml
Nicotinic Acid 0.5 0.05 Pyridoxine HCl 0.5 0.05 Thiamine HCl 0.1 0.01 Glycine 2 0.2 1 ml
56