EFFECTS OF CHITOSAN ON GENE EXPRESSION ......Research report Fluoride 47(4)320–332 October-December 2014 Effects of chitosan on gene expression related to the canonical Wnt signalling

Research reportFluoride 47(4)320–332October-December 2014

Effects of chitosan on gene expression related to the canonical Wntsignalling pathway in the femur of fluorotic mice

Huo, Bian, Hao, Wang

320320

EFFECTS OF CHITOSAN ON GENE EXPRESSION RELATED TO THE CANONICAL Wnt SIGNALING PATHWAY IN THE FEMUR

OF FLUOROTIC MICEMeijun Huo,a Shengtai Bian,a Junhu Hao,b Jundong Wanga,*

Taigu and Jinzhong, Shanxi, and Ningxia, People’s Republic of China

SUMMARY: To investigate the role of chitosan on the development of skeletalfluorosis, we focused on the expression levels of several genes related to thecanonical Wnt signaling pathway, which is fundamental to osteoblast commitmentand differentiation. Sixty-eight healthy, 28-day-old Kunming male mice wererandomly divided into 4 groups and administered various combinations of fluoride(F) and chitosan: Control group (distilled water and normal diet); F-exposed group(distilled water with 45 mg F–/L and normal diet); F+chitosan group (distilled waterwith 45 mg F–/L and diet with 5% chitosan); Chitosan-treated group (distilled waterand diet with 5% chitosan). After 100 days, total RNA isolation was performed fromfemur samples of all mice, and the gene expression of Wnt3α, Lrp5, GSK-3β, β-Catenin, and RANKL were observed using real-time PCR. Compared with the controlgroup, the F-exposed group had elevated expression of the Wnt pathway-relatedgenes Lrp5, GSK-3β, β-Catenin and RANKL. The results for the F+chitosan groupshowed that chitosan could block the elevations in the gene expressions of Lrp5,GSK-3β, and β-Catenin induced by the excessive F. The findings suggested that Fcould inhibit the activation of the canonical Wnt pathway in bone formation. In turn,chitosan can improve, to a certain extent, the suppression of the Wnt signalingresulting from F by regulating the expression of related genes. This may provide abasis for the treatment and prevention of fluorosis.

Keywords: β-catenin; Bone formation; Chitosan; Femur; Fluorosis; Skeletal fluorosis; Wnt.

INTRODUCTION

A healthy environment is the key for well-being.1,2 Fluorine is extensivelydistributed in nature, is a common mineral that is widely used in many industrialprocesses, and is present in many foods and water sources.3-7 Further, it is clearthat fluoride (F) has stimulatory effects on the proliferation of osteoblasts, thebone-forming cells.8,9 However, natural F levels above the currentlyrecommended range for organisms may increase the risk for severe fluorosis. Inrecent years, increased numbers of fluorosis cases have been reported in manyparts of the world, including Mexico, Brazil, China, Vietnam, and Thailand, wherethe F level in the drinking water is higher than the WHO guideline value (above1.5 mg/L).2,7 Fluorosis in India is endemic and as many as 19 states and 230districts have been affected.2

Historically, a variety of approaches have been made to understand the action ofF in cells, tissues, and organisms. Several theories have been proposed to explainthe mechanism by which F acts to stimulate bone cell proliferation anddifferentiation but most are contradictory and not yet understood.10 Collectively, it

aShanxi Key Laboratory of Environmental Veterinary Medicine, Shanxi Agricultural University;bNingxia Entry-Exit Inspection and Quarantine Bureau, Ningxia; *For correspondence:Professor Jundong Wang, Shanxi Key Laboratory of Environmental Veterinary Medicine, ShanxiAgricultural University, Taigu, Shanxi 030-801, People’s Republic of China; E-mail:[email protected]




321321

suggested that understanding F by subcellular signaling mechanisms is ofparamount importance.11 Differentiation of osteoblasts from mesenchymal cellsrequires a series of key signals such prostaglandin E2 (PGE2), IGF-1, parathyroidhormone (PTH), bone morphogenic proteins (BMPs), as well as wingless proteins(Wnt) (Figure.1). All of these signals help to induce mesenchymal cells into pre-osteoblast and then into mature osteoblasts, which are cuboid-shaped cells thatproduce the bone matrix. Recent studies have established that Wnt-mediatedsignals have important roles in bone remodeling in both physiological andpathological conditions.12

Meanwhile, a large number of studies have focused on the treatment offluorosis, such as alleviating bone pain, increasing bone density, and improvingthe calcium and vitamin D balances.14, 5 As discussed above, F is part of theenvironment. Yin et al. found that mature Adélie penguins, have an exceptionallyhigh fluoride concentration in their bones, up to 9,000 µg/g, but no signs ofskeletal fluorosis.16 Nearly two-thirds of total fluoride existed in an organic form,mostly in a fluorinated chitin state which was explained by 81.79% of Adéliepenguins’ diet being krill, which has a very rich chitin content.16 This suggests thechitin may absorb the inorganic fluorine and stabilize it in the fluorinated chitin,which might prevent abnormal mineralization of bone by decreasing excessivebone mineral density and improving bone histomorphometry.16

Figure 1. Signal-transduction pathways that regulate osteoblast function.13




322322

Chitin is a naturally abundant mucopolysaccharide, and chitosan is the N-deacetylated derivative of chitin with excellent properties such asbiocompatibility, biodegradability, non-toxicity, adsorption properties, andmore.17 In the present study, the effect of chitosan on the bone changes in Ftoxicity in mice were examined by measuring the expression levels of the Wntsignaling-associated genes, including Wnt3α, Lrp5, GSK-3β, β-Catenin andRANKL, with real time quantitative PCR, in order to provide a possible basis forthe treatment and prevention of fluorosis.

MATERIALS AND METHODS

Animals: Sixty-eight healthy, 28-day-old Kunming male mice, each weighingabout 18 g, were randomly divided into 4 groups of 17 each: Control group(distilled water and normal diet); F-exposed group (distilled water with 45 mg F–/L and normal diet); F+chitosan group (distilled water with 45 mg F–/L and dietwith 5% chitosan); and a Chitosan-treated group (distilled water and diet with 5%chitosan). All mice had free access to food and water under standard temperature(22–25ºC), 12/12-hr light/dark cycle, ventilation, and hygienic conditions. Withinthe experimental period, weights of mice were recorded every week and thedrinking and feeding situations were inspected every other day. After 100 days, allmice were sacrificed by cervical dislocation, and the femur samples obtained forstudy. The doses were chosen on the basis of the LD50 value of 54.4 mg F/kg bodyweight in male mice. The animals were kept for 100 days in order to assure thatthey were successfully exposed to F.18

The study design was approved by the Institutional Animal Care and UseCommittee of China. The mice and powdered feed were provided by theExperimental Animal Center of Shanxi Medical University of China.

Chemicals: Sodium fluoride was obtained from Tianda Chemical Factory(Tianjin, China). Chitosan was provided by Wolsen Biotechnology Co., Ltd(Xi’an, China). Trizol and the Two Step RT-PCR Kit were purchased from TakaraBiotechnology Company (Dalian, China). All the real-time PCR primers weresynthesized by Beijing AuGCT Biotechnology Co., Ltd (Beijing, China). All otherreagents used were of analytical grade.

Measurement of F concentration in femur: The F concentration (F–) in thefemurs was measured using the F electrode and Ray Magnetic PHS-3B pH meter(Shanghai Precision and Scientific Instrument Co., Ltd.; China). Determinationswere made by measuring the potential values using the pH meter, drawing astandard curve on semilogarithmic paper, and taking the F concentration as theabscissa and the potential value as the ordinate. After the potential values weremeasured, the F concentration was obtained from the standard curve. The Fcontent was calculated with the formula

VmC

X ×=




323323

where X represents F content in mg/kg; C represents F concentration in µg/mL;m represents sample quantity in g; and V represents sample volume in mL.

Seven parallel samples were tested for each group and the average, accurate to0.1mg/kg, taken as the result.

Total RNA extraction and QRT-PCR: Total RNA was extracted from fourrandom femur samples for each group using TRIzol reagent.

Based on the available rat sequences in Genbank for Wnt3α, Lrp5, GSK-3β, β-Catenin, RANKL, and β-actin, the primers for QRT-PCR were designed usingPrimer 3.0 software (Table 1). The eight pairs of primers were tested for theirspecificity by the conventional reverse transcription polymerase chain reaction(RT-PCR) before being used in the QRT-PCR studies. Melting curve analysis wasperformed following QRT-PCR.

.

Table 1. Primer sequences with their corresponding PCR product sizes

Gene name Primer sequences(5’-3’) Accession no. Product sizes

β-act in GATCATTGCTCCTCCTGAGC ACATCTGCTGGAAGGTGGAC NM_007393 83

Wnt3a GGCATGGAGAAGAACTCAGG CTTGAAGAAGGGGTGCAGAG NM_009522 126

Lrp5 CCTGGAGCTGTTGAGTGACA GAGTGGGATAGCCACATCGT NM_008513 124

GSK-3β CAAGCAGACACTCCCTGTGA ATGTCTCGATGGCAGATTCC NM_019827 99

β-Catenin

GCTTCTGGGTTCCGAT GATA TGGCACACCATCATCTTGTT NM_007614 99

RANKL

GCAGAAGGAACTGCAACACA ATTGATGGTGAGGTGTGCAA AF019048 133




324324

The RT-PCR assays were performed in a 10 µL reaction mixture (Table 2).

QRT-PCR was performed in a total reaction volume of 20 µL per well by usingthe Two Step RT-PCR Kit and the Mx3000PTMQRT-PCR system (Stratagene,USA) (Table 3).

The reaction conditions for the first step were 37ºC for 15 min and 85ºC for 5sec. The reaction conditions for the second step were as follows: after initialdenaturation at 95ºC for 15 sec, 50 PCR cycles were started with thermocyclingconditions at 61ºC for 15 sec, 72ºC for 6 sec, 95ºC for 60 sec, 55ºC for 30 sec, andthen 95ºC for 30 sec, followed by the reaction melting curve analysis to verify thespecificity of the amplified products.

Table 2. System constitutors of RT-PCR reaction (First step)

Reagents Volume (µL)

5×Prime ScriptTM Buffer 2

Total RNA 1

RNase RNase Free dH20 7

Total 10

Table 3. Sys tem constitutors of RT-PCR reaction (Second step)

Reagents Volume (µL)

SYBR Premix Ex TaqTM (2×) 10

PCR Forward Primer 0.8

PCR Reverse Primer 0.8

ROX Reference Dye I I (50×) 0.4

cDNA 2

RNase Free dH2O 6

Total 20




325325

The relative quantification of mRNA abundance for each target gene wasperformed using the comparative ∆∆CT method expression with the house-keeping gene β-actin as a calibrator. The amplified products were analyzed by1.5% agarose gel electrophoresis.

Statistical analysis: The data area is expressed as mean±SEM. SPSS19.0software (SPSS, Inc., Chicago, IL, USA) was used to analyze all gene expressionlevels. Differences of p<0.05 were considered statistically significant.

RESULTS

Effects on mice growth: The mice in the control group were in good nutritionalstatus with well developed figures, soft and silky coats, and square white teeth. Incontrast to the control group, F caused the mice to develop rough coats and roughteeth with dark brown stains. The mice in the F+chitosan group showed some poordevelopment. There were no significant differences in the chitosan-treated group.Figure 2 is displays the male mice incisors from the different groups.

Effects on body weight gain: As Figure 3 suggests, the mice in each groupgained weight over time. There was essentially no difference for the body weightchange between the control and experimental groups.

Figure 2. Male mice incisors from each group. A: control group; B: F-exposed group; C: F+chitosan group; D: chitosan group.




326326

Content of bone fluorine: Compared to the control group, significant increases infemoral bone F content were observed after exposure to F and F+chitosan(p<0.001) (Figure 4).

Body weight (g)

Time (weeks)

Control F-exposed

F+chitosan

Chitosan

Figure 3. Dynamic observation of body weights of mice of each group (n=17; mean±SEM).

Control F-exposed F+chitosan Chitosan Groups

Figure 4. Concentration of bone F in each group (n=7; mean±SEM). Compared to control: *p<0.001.

*Femoral bone F content (µg F/g)

*




327327

Effects on Wnt and Bmp signaling-associated gene expression: After the 100-day treatment with F and chitosan at different concentrations, the mRNA levels ofthe related genes in the Wnt signaling pathway changed markedly (Figure 5). Inthe F-exposed group, compared with the control group, the mRNA levels of Lrp5,GSK-3β, β-Catenin, and RANKL in the mice femurs increased while that forWnt3 decreased. For the F+chitosan group, compared to the control group, themRNA expressions of Lrp5, GSK-3β, and β-Catenin were similar, the level forWnt3 decreased, and that for RANKL increased. For the F+chitosan group,compared to the F-exposed group, the expression of Wnt3 was unchanged whilethat of RANKL increased. For the chitosan group, compared to the control group,the mRNA expression of Wnt3, Lrp5, GSK-3β, and β-Catenin were decreasedwhile that for RANKL was increased.

DISCUSSION

Bone is a major site of F accumulation in the body and excessive F disrupts thebalance of bone deposition and remodelling activities and is linked to skeletaldisease, including osteoporosis, osteomalacia, and osteopetrosis.19 In addition, Fis a potent regulator of the hypothalamic-pituitary-thyroid axis, is able to act as aTSH analogue, and can modulate thyroid hormone production.19 Dental fluorosismay occur in both human and mammals, with exposure to high levels of F whilethe teeth are developing. The first 6 to 8 yr appear to be the critical period of riskin humans.11 Dental fluorosis is characterized by teeth staining and pitting of theteeth, with enamel damage in more severe cases. Chronically high levels of Fexposure may cause skeletal fluorosis with joint stiffness and pain, structural bonechanges, ligament calcification, and muscle impairment and pain.20 As shown inFigure 2, the incisors in the F-exposed group developed an intermediate degree ofdental fluorosis with brittleness, brown staining, and increased wear in contrast tothe unaffected teeth in the control group which were smooth, glossy, and palecreamy white in colour.

Relative expression

Gene

Figure 5. Effects of chitosan and fluoride on the related gene expression of Wnt signaling pathway (n=4; mean±SEM). Compared to control: *p<0.001.

*




328328

The predisposition to developing fluorosis may be increased in the presence ofother conditions, such as malnutrition with deficiency of calcium, vitamins D,vitamin A or a low protein-energy diet.19

An interesting phenomenon has been observed in mature Adélie penguins(Pygoscelis adeliae) who do not show signs of skeletal fluorosis despite havinghigh bone F levels as a result of their F-rich chitosan krill diet. The krill critin crustcontains approximately 3,028~3,828 µg F/g. The exceptional F tolerance of thepenguins is attributed to the form of their bone F storage with two-thirds of Fbeing stored in the organic phase as fluorinated chitin derivatives. In addition,chitin could reduce the adverse effect caused by high F exposure.16 Julshamn et al.also reported that Atlantic salmon (Salmo salar) given F-rich krill meal diets (upto 350 µg F/g) showed a high tolerance of dietary F. The F concentration in themuscle, whole body, and bones of Atlantic salmon is not influenced by the dietaryF level in the short term.21 Therefore, how chitin affects the action of F in bonecells has become a research hotspot.

Chitin is the secondmost abundant naturalbiopolymer aftercellulose, and can befound in manyorganisms ranging fromfungi to crustaceans(e.g., crabs, lobsters andshrimps) andinsects.22,23 It is a β(1→4)-linked glycan,composed of 2-acetamido-2-deoxy-β-d-glucose (N-acetylglucosamine),which is mostly unableto be used by the bodybecause of itsinsolubility in acids,bases, and water.23

Thus, variousphysiological effects ofchitin are shown bychitosan.24 Chitosan, isthe deacetylated (tovarying degrees) formof chitin and is solublein dilute acids (Figure6).

Figure 6. Manufacturing process for chitin and chitosan.25




329329

Chitosan is safe, non-toxic, and biodegradable in normal body constituents, so anumber of commercial and possible biomedical uses of chitosan have receivedconsiderable attention in recent years.23

It is well known that chitosan has strong ability to bind cations. A study foundthat the bone-mineral density (BMD) of 15 elderly osteoporosis-suffererssignificantly improved after taking CaCO3-chitosan oral liquid for 55 days. Thisinformation suggested that chitosan can promote the absorption of calcium bymaking Ca2+ soluble in the intestines through chelating Ca2+ at a low pH, 26 whichstablizes F, and prevents the accumulation of CaF2 in the skeleton and the releaseof free F ions.

Despite the stabilizing of F, chitosan may also promote bone formation.24,27

Chitosan has played a major role in bone tissue engineering over the past severalyears. Chitosan powder has been reported to accelerate bone regeneration in rattibia and has been used as a biomaterial to accelerate human bone healing.28-30

During the process of bone remodeling and fracture repair, Wnt proteins arecurrently considered to be key components that encode a highly conserved class ofsignaling factors that control cell growth and differentiation.31 The role of Wntproteins in osteophyte formation has been studied. Wnt proteins are expressed inhuman joints and act synergistically with BMPs in bone formation.32

Wnts act on osteoblast precursor cells and promote their differentiation intomature osteoblasts by the β-catenin-dependent canonical pathway.13 The Wntpathway could cause an accumulation of β-catenin in the cytoplasm and itseventual translocation into the nucleus to act as a transcriptional coactivator oftranscription factors that belong to the TCF family, which can activatetranscription of Wnt target genes. Without Wnt signaling, β-catenin, an integral E-

Figure 7. Canonical Wnt signaling in osteoblasts.




330330

cadherin cell-cell adhesion adaptor protein and transcriptional co-regulator, wouldnot accumulate in the cytoplasm because of the need for coordinatedphosphorylation by the APC/Axin/GSK-3β-complex (Figure 7).34 However, assoon as Wnt binds Frizzled and LRP-5/6, the destruction complex functionbecomes disrupted, which promotes the accumulation of β-catenin inosteoblasts.33,34The ligand Wnt3a, a member of the Wnt family and important fornormal developmental processes, has been implicated in the regulation ofosteoblast differentiation and the level of bone mass and bone strength. The co-receptors LRP5 and LRP6 trigger displacement of the multifunctional kinaseGSK-3β from a regulatory APC/ Axin/GSK-3β-complex.34,35 The accumulated β-catenin enters into the nucleus, along with T-cell factor/lymphoid enhancer factor(TCF/LEF), and induces the expression of target genes. In addition, Receptoractivator of NF-κB ligand (RANKL) is a cytokine that responds to boneresorption-stimulating factors, such as parathyroid hormone (PTH) and 1α,25-dihydroxyvitamin D3 [1α,25(OH)2D3]. Osteoblasts also express a negativeregulator of bone resorption, osteoprotegerin (OPG), which inhibits the interactionbetween RANK and RANKL by acting as a decoy receptor of RANKL. Thus, thecanonical pathway in osteoblasts suppresses osteoclastogenesis through down-regulation of the RANKL/OPG ratio. In addition, all the genes play an importantrole in the Wnt signaling pathway and are involved with skeletal homeostasis andmetabolism. Through their complex interactions and mutual contact they allow abalance to occur.36

In this experiment, when the F-exposed group was compared to the controlgroup, a decreased expression of Wnt3α was induced by F, which reduced thebinding affinity of ligand Lrp5 and caused its abundant expression. GSK-3βstimulated the phosphorylation of β-catenin, preventing the arrival of β-catenininto the nucleus. Phosphorylated β-catenin is degraded through the ubiquitin-proteosome pathway, which reduced the combination of TCF/LEF and targetgenes. In this case, the up-regulation of RANKL expression in osteoblasts resultedin the inhibition of bone formation. Thus, clinical signs of F toxicity were apparentin the F-exposed group of mice. After adding chitosan, the inhibition of the boneformation induced by F was relieved to some extent. The action of chitosan was toactivate the canonical pathway through the formation of a complex of Wnt3a,Frizzled, and Lrp5. This complex in turn inhibited the activity of GSK-3β byphosphorylation resulting in increased levels of β-catenin in the osteoblasts whichmoved into the nuclei. Chitosan can balance the F-induced differential expressionof genes related to the canonical Wnt signaling pathway in the femurs of mice.

CONCLUSION

This study studied the role of chitosan29 on skeletal formation in F-exposed miceby detecting the expression levels of the Wnt signaling-associated genes, includingWnt3α, Lrp5, GSK-3β, β-Catenin, and RANKL. Our findings suggested that theactivation of the canonical Wnt pathway in bone formation of mice femur could besuppressed by F. However, to a certain extent, chitosan may ameliorate F-induceddamage by regulating the expression of the involved with the Wnt signaling.




331331

ACKNOWLEDGMENTS

We greatly the assistance with the paper from Taylor Wingo. This research wassupported by the Graduate Student Innovation Project of Shanxi Province (GrantNo. 20133059).

REFERENCES

1 Cohen S, Glass DC, Phillips S. Environment and health. In: Freeman HL, Levine S, ReederLG, editors. Handbook of Medical Sociology Englewood Cliffs, NJ, USA: Prentice-Hall;1979: pp. 134-49.

2 Saravanan S, Kalyani C, Vijayarani MP, Jayakodi P, Felix A, Nagarajan S, et al. Prevalenceof dental fluorosis among primary school children in rural areas of Chidambaram Taluk,Cuddalore District, Tamil Nadu, India. Indian J Community Med 2008;33(3):146-50.

3 Everett ET. Fluoride's effects on the formation of teeth and bones, and the influence ofgenetics. J Dent Res 2011;90(5):552-60.

4 Thangapandiyan S, Miltonprabu S. Epigallocatechin gallate supplementation protectsagainst renal injury induced by fluoride intoxication in rats: Role of Nrf2/HO-1 signaling.Toxicology Reports 2014;1:12-30.

5 Centers for Disease Control and Prevention. Ten great public health achievements—UnitedStates, 1900-1999. MMWR Morb Mortal Wkly Rep 1999;48(12):241-3.

6 Centers for Disease Control and Prevention. Achievements in public health, 1900–1999:family planning. Morbidity and Mortality Weekly Report 1999;48:1073-80.

7 Raghavan R, Bipin N, Abraham A. Prevalence of dental fluorosis and fluoride content ofdrinking water in rural areas of Malappuram district, Kerala. Int J Med Sci Public Health2014;3(1):27-30.

8 Fisher RL, Medcalf TW, Henderson MC. Endemic fluorosis with spinal cord compression: acase report and review. Arch Intern Med 1989;149(3):697-700.

9 Lundy MW, Stauffer M, Wergedal JE, Baylink DJ, Featherstone J, Hodgson SF, Riggs BL.Histomorphometric analysis of iliac crest bone biopsies in placebo-treated versus fluoride-treated subjects. Osteoporos Int 1995;5(2):115-29.

10 Lau KH, Goodwin C, Arias M, Mohan S, Baylink DJ. Bone cell mitogenic action offluoroaluminate and aluminum fluoride but not that of sodium fluoride involves upregulationof the insulin-like growth factor system. Bone 2002;30(5):705-11.

11 National Research Council of the National Academies. Fluoride in drinking water: ascientific review of EPA's Standards. Washington, DC, USA: National Academies Press;2006. pp. 104, 205-23.

12 Kobayashi Y, Maeda K, Takahashi N. Roles of Wnt signaling in bone formation andresorption. Japanese Dental Science Review 2008;44(1):76-82.

13 Logothetis CJ, Lin S-H. Osteoblasts in prostate cancer metastasis to bone. Nat Rev Cancer2005;5(1):21-8.

14 Jowsey J, Schenk RK, Reutter FW. Some results of the effect of fluoride on bone tissue inosteoporosis. J Clin Endocrin Metab 1968;28(6):869-74.

15 Spencer H, Lewin I, Fowler J, Samachson J. Effect of sodium fluoride on calciumabsorption and balances in man. Am J Clin Nutr 1969;22(4):381-90.

16 Yin XB, Chen LA, Sun LG, Wang M, Luo HH, Ruan DY, et al. Why do penguins not developskeletal fluorosis. Fluoride 2010;43(2):108-18.

17 Kumar MNVR. A review of chitin and chitosan applications. React Funct Polym2000;46(1):1-27.

18 Sun ZL, Niu RI, Su K, Wang B, Wang JM, Zhang JH, Wang J. Effects of sodium fluoride onhyperactivation and Ca2+ signaling pathway in sperm from mice: an in vivo study. ArchToxicol 2010;84(5):353-61.

19 Wang JM, Niu RY, Sun ZL, Lv LH, Smith GW, Wang JD. Effects of protein and calciumsupplementation on bone metabolism and thyroid function in protein and calcium deficientrabbits exposed to fluoride. Fluoride 2008;41(4):283-91.




332332

20 Yan D, Gurumurthy A, Wright M, Pfeiler TW, Loboa, EG, Everett ET. Genetic backgroundinfluences fluoride's effects on osteoclastogenesis. Bone 2007;41(6):1036-44.

21 Julshamn K, Malde MK, Bjorvatn K, Krogedal P. Fluoride retention of Atlantic salmon(Salmo salar) fed krill meal. Aquaculture Nutrition 2004;10(1):9-13.

22 Pierfrancesco M. Nanoparticles and nanostructures man-made or naturally recovered: thebiomimetic activity of chitin nanofibrils. J Nanomater Mol Nanotechnol 2012;1:2. Availablefrom: http://scitechnol.com/2324-8777/2324-8777-1-101.pdf

23 Shahidi F, Arachchi JKV, Jeon Y. Food applications of chitin and chitosans. Trends Food SciTechnol 1999;10(2):37-51.

24 Jayakumar R, Prabaharan M, Nair SV, Tokura S, Tamura H, Selvamurugan N. Novelcarboxymethyl derivatives of chitin and chitosan materials and their biomedicalapplications. Prog Mater Sci 2010;55(7):675-709.

25 Ilium L. Chitosan and its use as a pharmaceutical excipient. Pharm Res 1998;15(9):1326-31.

26 Xia W, Liu P, Zhang J, Chen J. Biological activities of chitosan and chitooligosaccharides. JFood Hydrocoll 2011;25(2):170-9.

27 Muzzarelli R, Mattioli-Belmonte M, Tietz C, Biagini R, Ferioli G, Brunelli MA, et al.Stimulatory effect on bone formation exerted by a modified chitosan. Biomaterials1994;15(13):1075-81.

28 Ezoddini-Ardakani F, Azam AN, Yassaei S, Fatehi F, Rouhi G. Effects of chitosan on dentalbone repair. Health 2011;3(04):200-5.

29 Seol YJ, Lee JY, Park YJ, Lee YM, Young-Ku, Rhyu IC, et al. Chitosan sponges as tissueengineering scaffolds for bone formation. Biotechnology Lett 2004;26(13):1037-41.

30 Venkatesan J, Kim SK. Chitosan composites for bone tissue engineering—an overview.Mar Drugs 2010;8(8):2252-66. HSS j 2008;4(1):66-70.

31 Issack PS, Helfet DL, Lane JM. Role of Wnt signaling in bone remodeling and repair. HSS J2008;4(1):66-70.

32 López-Larrea C, Díaz-Peńa R, editors. Molecular mechanisms of spondyloarthropathies.New York: Springer Science+Business Media, Landes Bioscience; 2009.

33 Gong Y, Slee RB, Fukai N, Rawadi G, Roman-Roman S, Reginato AM, et al. LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development. Cell 2001;107(4):513-23.

34 MacDonald BT, Tamai K, He X. Wnt/â-catenin signaling: components, mechanisms, anddiseases. Dev Cell 2009;17(1):9-26.

35 Little RD, Carulli JP, Del Mastro RG, Dupuis J, Osborne M, Folz C, et al. A mutation in theLDL receptor-related protein 5 gene results in the autosomal dominant high-bone-masstrait. Am J Hum Genet 2002;70(1):1-9.

36 Krishnan V, Bryant HU, Macdougald OA. Regulation of bone mass by Wnt signaling. J ClinInvest 2006;116(5):1202-9.

Copyright © 2014 The International Society for Fluoride Research Inc. www.fluorideresearch.org www.fluorideresearch.com www.fluorideresearch.net

Editorial Office: 727 Brighton Road, Ocean View, Dunedin 9035, New Zealand.

Documents

EFFECTS OF CHITOSAN ON GENE EXPRESSION ......Research report Fluoride 47(4)320–332 October-December 2014 Effects of chitosan on gene expression related to the canonical Wnt signalling