Effects of Cyclosporin, Phenytoin,and Nifedipine on the Synthesisand Degradation of Gingival Collagen inTufted Capuchin Monkeys (Cebusapella): Histochemical and MMP-1and -2 and Collagen I GeneExpression AnalysesClaudia M. Kanno,* Jose A. Oliveira,† Jose F. Garcia,‡ Alvimar L. Castro,§ and Marcelo M. Crivelini§

Background: The purpose of this experimental study was to evaluatethe collagen fiber distribution histologically after phenytoin, cyclo-sporin, or nifedipine therapy and to correlate it with collagen I andmatrix metalloproteinase (MMP)-1 and -2 gene expression levels.

Methods: Gingival samples from the canine area were obtained from12 male monkeys (Cebus apella). The mesial part of each sample wasassessed by reverse transcription-polymerase chain reaction, whereasthe distal part was processed histologically for picrosirius red and hema-toxylin and eosin stainings, as well as for collagen IV immunostaining.One week after the first biopsy, the animals were assigned to three groupsthat received daily oral dosages of cyclosporin, phenytoin, or nifedipinefor 120 days. Additional gingival samples were obtained on days 52and 120 of treatment from two animals from each group on the oppositesides from the first biopsies.

Results: Picrosirius red staining showed a predominance of maturecollagen fibers in the control group. Conversely, there was an enlarge-ment of areas occupied by immature collagen fibers in all groups atdays 52 and 120, which was not uniform over each section. There wasa general trend to lower levels of MMP-1 gene expression on day 52and increased levels on day 120. Phenytoin led to increased levels ofMMP-2 and collagen I gene expression on day 120, whereas the oppositewas observed in the nifedipine group.

Conclusion: Cyclosporin, phenytoin, and nifedipine led to phased anddrug-related gene expression patterns, resulting in impaired collagenmetabolism, despite the lack of prominent clinical signs. J Periodontol2008;79:114-122.

KEY WORDS

Collagen type I; cyclosporin; gingival overgrowth/chemically induced;matrix metalloproteinase; nifedipine; phenytoin.

Drug-induced gingival over-growthhasbeendescribedin association with several

drugs but more frequently withthe anticonvulsant phenytoin,the immunosuppressant cyclo-sporin, and the calcium channelblocker nifedipine.1 Althoughthese drugs have different phar-macological mechanisms, theclinical and histologic featuresof drug-induced gingival enlarge-ments are similar. Clinically,gingival enlargement begins inthe interdental papillae, whichenlarge and coalesce, interfer-ing with dental occlusion attimes.1 Microscopic analysismay reveal redundant tissue ofapparently normal compositionor with an increased amount ofcollagen and number of fibro-blasts. The overlying surfaceepithelium may demonstraterete pegs elongating into theunderlying lamina propria.1

Despite the increased amountof collagen in the extracellular

* Post-Graduation Program, Dental School of Aracxatuba, Sao Paulo State University, Aracxatuba, SP,Brazil.

† Department of Basic Sciences, Dental School of Aracxatuba, Sao Paulo State University.‡ Department of Animal Production and Health, Veterinary Medicine School of Aracxatuba, Sao Paulo State

University.§ Department of Oral Pathology, Dental School of Aracxatuba, Sao Paulo State University.

doi: 10.1902/jop.2008.070267

Volume 79 • Number 1

114

matrix (ECM), previous studies showed a decrease incollagen synthesis after the administration of nifedi-pine,2,3 cyclosporin,4 and phenytoin.5 These resultssuggest that collagen fiber accumulation may be at-tributed to a decrease in its degradation rather thanto an increase in collagen synthesis.

Collagen turnover and remodeling mechanismsare regulated predominantly by cellular endocytosis4

and proteolytic enzymes of the matrix metalloprotein-ase (MMP) family.6 Members of this enzyme familyspecifically trigger the collagen digestion processand, in conjunction, can degrade all structural com-ponents of ECM.7

Previous studies5,8,9 on gingival overgrowth patho-genesis focused on MMP production or its gene ex-pression by fibroblasts in vitro, with contrastingresults. Different cell culture conditions or cell strainshave been considered the main reason for such con-troversial results.10 However, there is a large body ofevidence to suggest that the pathogenesis of gingivalovergrowth involves fibroblasts as well as severalcellular groups in a defined sequence of biologicevents.10-14 In addition, gene expression patterns ob-served in vitro often differ significantly from those ob-served in vivo.15 Therefore, important new insightsinto gingival overgrowth pathogenesis may be gainedwith in vivo studies using a standardized time of anal-ysis after the beginning of drug administration. Thepurpose of the present study was to analyze the histo-logic patterns of collagen fiber distribution in the gin-giva of tufted capuchin monkeys (Cebus apella)exposed to cyclosporin, nifedipine, or phenytoinand to correlate them with MMP-1 and -2 and collagenI gene expression.

MATERIALS AND METHODS

Twelve healthy male tufted capuchin monkeys (C.apella), obtained from the Tufted Capuchin MonkeyProcreation Center, Dental School of Aracxatuba, wereused in the present study. The animals were kept in in-dividual metal cages under constant temperature andhumidity conditions. Prior to surgery, the animalswere sedated with ether inhalation and anesthetizedwith intraperitoneal injection of sodium thionembutali

(30 mg/kg body weight). Routine dental infiltrationanesthesia was used at the surgical sites. The exper-imental protocol was approved by the Committee ofEthics in Animal Experiments of the Dental Schoolof Aracxatuba (protocol 41/03).

Surgical sites were classified according to the sul-cus bleeding index16 and the gingival index.17 Gingi-val samples consisting of free and attached gingivawere obtained from the right superior canine area ofall animals; this constituted the control group (N =12). Samples were obtained through vertical incisionsup to the mucogingival junction, including the canine

mesial and distal papillae. Each sample was dividedinto two pieces. The mesial portion was frozen imme-diately in liquid nitrogen, whereas the distal part wasfixed in 10% buffered formalin solution.

One week after the first gingival sampling, the ani-mals were randomly assigned to three experimentalgroups. Each group consisted of three subadult ani-mals and one adult animal, according to Gilmore’s18

criteria. Group 1 was treated with daily oral dosagesof cyclosporin,¶ 5 mg/kg, whereas group 2 receivedphenytoin,# 7.5 mg/kg. One week later, the dosageof both medications was increased to 15 mg/kg.Group 3 received daily oral dosages of nifedipine,**40 mg/kg, during the entire experimental period. Thedrugs were diluted in yogurt and provided once a day.

Gingival specimens were obtained from the leftsuperior canine area of one subadult animal and oneadult animal from each group on day 52. The exper-imental period ended on day 120, when samples wereobtained from the left superior canine area of all ani-mals not subjected to biopsy on day 52. No specificcriterion described previously was used to determinethe periods of analysis because this primate specieshas not been used in studies on gingival overgrowth.The biopsies taken on days 52 and 120 followed thesame protocol of the first sampling procedure andwere performed on the opposite side to avoid interfer-ence from wound healing.

Gingival Morphologic and Histometric AnalysesFormalin-fixed gingival samples were embedded inparaffin and sectioned in the bucco-lingual transverseplane. Six-micrometer sections were stained with he-matoxylin and eosin for morphologic analyses of theepithelial and connective changes induced by thedrugs, according to the histologic features describedby Neville et al.1 Picrosirius red staining was used forthe assessment of collagen fibers according to themethods described by Junqueira et al.19 with modifica-tions. Briefly, the sections were deparaffinized, hy-drated, and immersed in 0.1% solution of sirius redF3BA in saturated aqueous picric acid for 1 hour. Thestained sections were washed in two baths of 0.5% ace-tic acid solution for 1 minute. After dehydration, thesections were cleared, mounted in resinous medium,and analyzed under a polarizing microscope.††

For the collagen IV study, 3-mm sections weredeparaffinized and subjected to pepsin digestionfor 60 minutes at 37�C for antigen retrieval, before be-ing immunostained. Overnight incubation in mousemonoclonal anticollagen type IV‡‡ primary antibody

i Thiopental, Abbott Laboratories, Abbott Park, IL.¶ Sandimmun Neoral, Novartis Pharma, Basel, Switzerland.# Apothicario, Aracxatuba, SP, Brazil.** Apothicario.†† Axiophot, ZEISS DSM-940 A, Oberkochen, Germany.‡‡ Dako, Glostrup, Denmark.

J Periodontol • January 2008 Kanno, Oliveira, Garcia, Castro, Crivelini

115

was carried out at 4�C at a dilutionof 1:100. Sections were washedin Tris buffered saline and incu-bated with streptavidin complexedwith biotinylated horseradish per-oxidase§§ for 30 minutes, followedby the use of diaminobenzidine aschromogen.

Histologic sections were ana-lyzed at ·200 magnification. Threeconnective tissue sites with corre-sponding areas of 600,000 mm2

were analyzed: subjacent to oralepithelium (OE), subjacent tosulcular epithelium (SE), and mid-dle-deep area (MD) (Fig. 1B).

The colors of the collagen fibersstained with picrosirius red andvisualized under the polarizingmicroscope depend on the fiberthickness and vary in ascendingorder of maturation grade fromgreen to yellow, orange, and red.The spatial distribution of fibersof different thickness was assessedwith the color threshold function ina software programii by identifyingareas of different hues, which al-lowed the quantification of areasoccupied by different colors. Theobtained data were transformedinto percentages.

Reverse Transcription-Polymerase ChainReaction (RT-PCR) AssayTotal RNA was extracted from frozen tissues with re-agent¶¶ and treatedwithDNAase toavoidcontaminat-ing genomic DNA. Each total RNA sample (750 ng)was processed for the synthesis of cDNA using the re-verse transcription (RT) method## according to themanufacturer’s instructions. Subsequently, cDNAsamples were amplified by conventional polymerasechain reaction (PCR) using MMP-1 and -2 and collagenI–specific primers. These primers were designedbased on the alignment of previously described hu-man sequences. The primer for b-globin, used as en-dogenouscontrolof thesemiquantitativeanalysis,wasdesigned fromthesequencedescribed for C. apella.Allnucleotide sequences were accessed from the Na-tional Center for Biotechnology Information. Dataconcerning the primer sequences, as well as their an-nealing temperatureandnumberof cycles required foramplification, are shown in Table 1.

b-globin cDNA was amplified in duplex assays withMMP-2 and collagen I primers, whereas the MMP-1primer was assayed individually because it was not

compatible with the housekeeping amplification.The number of cycles was determined within the linearrange of the amplification curve for each gene. The re-action mixture was composed of 500 ng cDNA, 2 mMMgCl2, 0.21 mM deoxynucleotide triphosphate,***2.5 ml 10· PCR buffer,††† and 1 U Taq DNA polymer-ase‡‡‡ in duplex assays (and 0.5 U Taq DNA polymer-ase in single gene amplifications), with ultrapurewater§§§ to achieve a final volume of 25 ml. Ultrapurewater was substituted for cDNA volume in negativecontrols.

The cycling parameters consisted of denaturationfor 45 seconds at 94�C and annealing for 40 seconds(see parameters in Table 1), followed by 40 secondsof extension at 72�C. All assays were preceded by ini-tial denaturation for 5 minutes at 94�C and ended witha final extension phase of 7 minutes at 72�C.

Figure 1.Effects of phenytoin on the gingiva of an adult C. apella monkey. Clinical (A) and histologic (B)aspects of normal gingiva before treatment. Note the predominance of mature collagen fibers.Clinical (C) and histologic (D) aspects after 52 days of treatment. Note the predominance ofimmature collagen fibers. (Picrosirius red; original magnification ·100; bar = 100 mm.)OE = oral epithelium; SE = sulcular epithelium; MD = middle-deep area.

§§ Dako.ii QWin Image Processing and Analysis System, Leica Microsystems,

Heerbrugg, Switzerland.¶¶ TRIzol, Invitrogen Life Technologies, Carlsbad, CA.## SuperScript II kit, Invitrogen Life Technologies.*** Amersham Biosciences, Piscataway, NJ.††† Invitrogen Life Technologies.‡‡‡ Invitrogen Life Technologies.§§§ Invitrogen Life Technologies.

Collagen Metabolism in Drug-Induced Gingival Overgrowth Volume 79 • Number 1

116

All assays included control and treated groups andwere carried out in duplicate for all samples on two sep-arate occasions. Two microliters of each PCR productwere electrophoresed on 8% polyacrylamide gel andstained in green dyeiii 1:10,000 for 3 minutes at roomtemperature. Gels were photographed and digitized intriplicate under ultraviolet light. Band intensities weremeasured using a computerized densitometer¶¶¶ andexpressed as arbitrary units. The mean intensity ofthe band relative to the target gene expression wasdivided by the housekeeping value.

PCR products of expected sizes had their DNA se-quence determined### to confirm gene specificity.

Data AnalysisThe correlation between data obtained from the ana-lyses of sulcus bleeding index and gingival index wascalculated in relation to MMP-1 and -2 gene expres-sion values.

RESULTS

Clinical AspectsGingival enlargement was observed in all subadult an-imals in a variety of severities that did not seem to berelated to the different drugs or to the gingival scores.Clinical modifications could not be observed clearly inadult animals because the band of attached gingivawas much thinner than in subadult animals.

Gene Expression and Histologic AnalysesControl group. The OE area characteristically wascomposed of dense connective tissue, whereas theMD was occupied by loose connective tissue associ-ated with thick blood vessels. The severity of thechronic inflammation varied in the SE area. Picrosiriusred staining showed a predominance of mature colla-gen fibers, visualized as orange or red colors (Figs.1B, 2B, and 3E). The collagen fibers were not distrib-

uted uniformly in the subadult samples and werescarcer in MD compared to OE areas. This featurewas not observed in adult animals. Some thin andscarce green fibers could be observed in MD and SEareas of some specimens.

MMP-1 gene expression showed an interindividualvariation that did not correlate with sulcus bleeding in-dex or gingival index in any experimental period.MMP-2 and collagen I gene expressions were moreuniform among the samples and, similar to MMP-1,did not correlate with clinical gingival scores.

The percentage values relative to areas occupiedby different colors obtained after picrosirius red stain-ing are represented in Figure 4. Mean values of thesemiquantitative analysis of gene expression werecompared between groups (Fig. 5).

Day 52. No modification in the fiber distributionpattern was observed in hematoxylin and eosin–stained sections in any experimental group. The dis-tribution of blood vessels was more scattered thanin the control group, as indicated by immunohisto-chemical staining for collagen IV. In all groups, thepicrosirius red technique revealed an increase ingreen- and yellow-stained fibers, considered imma-ture collagen fibers, especially in the MD area (Figs.1D, 3F, and 4). This pattern was not related to age.There was a tendency for lower levels of MMP-1 geneexpression. MMP-2 and collagen I gene expressionsshowed drug-related patterns (Fig. 5).

Day 120. There were no specific drug-related pat-terns for the distributions of fibers, blood vessels, orcells. Increased amounts of collagen fibers were ob-served in the MD area in sections stained with

Table 1.

PCR Primer Data

Gene Primer Sequence

Predicted Size

(bp) Concentration

Annealing

Temperature

Cycles

(N)

MMP-1 S: 59GTGATGAAGCAGCCCAGATG39 308 12 pmol 56�C 32A: 59CCTGGTTGAAAAGCATGAGC39

MMP-2 S: 59GGAGGAGAAGGCTGTGTTCTT39 347 10 pmol 61�C 27A: 59TTTGGTTCTCCAGCTTCAGG39

Col Ia S: 59CCTGGAATGAAGGGACACAG39 209 1.5 pmol 60�C 29A: 59GCAGCACCAGTAGCACCATC39

b-globin S: 59ACTGCTGAAGAGAAATCTGC39 3 pmol 60�C 29A: 59CCCCAAAGGAGTCAAAGAAC39 130A: 59GAGTCAGGCCATCACTAAAG 220

bp = base pairs; S = sense; A = antisense; Col Ia = collagen type I alpha.

iii SYBR Green, Invitrogen Life Technologies.¶¶¶ Kodak Digital Science 1D Software, Eastman Kodak, Rochester, NY.### Dynamic ET Terminator kit, GE Healthcare – Amersham Biosciences,

Piscataway, NJ.

J Periodontol • January 2008 Kanno, Oliveira, Garcia, Castro, Crivelini

117

picrosirius red. There was a clear predominance ofyellow fibers, which were distributed uniformly inthe three analyzed areas. Phenytoin led to increasedlevels of MMP-2 and collagen I gene expression,whereas the opposite was observed in the nifedipinegroup.

The sequencing of RT-PCR products confirmedMMP-1 and -2 and collagen I DNA sequences with96% homology between humans and C. apella mon-key in MMP-1 and -2 DNA sequences and 91% homol-ogy for collagen I.

DISCUSSION

Studies have shown a wide range in the prevalence ofdrug-induced gingival overgrowth.20 Cyclosporin in-duced overgrowth in 13% to 81% of cases, whereasthe prevalences for nifedipine and phenytoin variedfrom 14.7% to 83% and from 0% to 100%, respec-tively.20 The absence of clinical signs in somepatients receiving therapy led to the concept of non-susceptible patients. According to this concept, thereare fibroblast subpopulations with heterogeneous re-sponses to drugs that induce gingival overgrowth.5,21

It is believed that non-susceptible patients do not havethe responding fibroblast subpopulation.22

The lack of objective parame-ters for the clinical diagnosis ofgingival overgrowth may be oneof the major causes of the differ-ences in prevalence rates. In addi-tion to the diagnosis subjectivity,morphological patterns are notcharacteristic in hematoxylin andeosin–stained histologic sections.However, data obtained in thepresent study indicated that thestudied drugs always led to modifi-cations of the ECM, even whenclinical signs were inconspicuous.The difference between suscepti-ble and non-susceptible patientsseems to be a reflection of the in-tensity of molecular events that al-ways occur. The dosage is anotherfactor to be considered. Daleyet al.23 observed gingival over-growth in all patients treated withcyclosporin at dosages >700 mg/day, although the severity var-ied. Therefore, it is possible thatgingival overgrowth develops inany patient as long as a minimumrequired dosage is reached. Olderage seems to be a modulating, butnot a precluding, factor becauseadult animals in the present study

also showed modifications in RT-PCR and picrosiriusred staining patterns, despite the lack of prominentgingival enlargement.

The picrosirius red staining technique has beensuggested to assess time-related changes in collagenfiber organization and maturation, as well as its en-largement, in response to increased functional de-mand and age.24 Temporal modification in collagenfiber maturation has been correlated with color varia-tion from green to yellow, orange, and red.7,24,25 Nev-ertheless, there is no consensus about whether fibersvisualized in green represent collagen type III or im-mature collagen type I. Collagen type III is consideredan immature form of collagen, and its presence hasbeen correlated with the tissue-remodeling pro-cess.26,27 Therefore, it seemed pertinent to correlatefibers stained in green with areas of tissue repair, de-spite the indefinite nature of this collagen type.

There was an increase in immature collagen fibersinduced by all drugs used in the present study, similarto the results reported by Dayan et al.25 on gingivalovergrowth induced by oxodipin. Nevertheless, tissueremodeling did not occur uniformly throughout thehistologic sections. The MD area was the focus forthe remodeling process; this is where the highest

Figure 2.Effects of cyclosporin on the gingiva of a subadult C. apella monkey. Clinical (A) and histologic (B)aspects of normal gingiva before treatment. Note the predominance of mature collagen fibers.Clinical (C) and histologic (D) aspects after 120 days of treatment. Note the predominance ofimmature collagen fibers. (Picrosirius red; original magnification ·200; bar = 50 mm.)

Collagen Metabolism in Drug-Induced Gingival Overgrowth Volume 79 • Number 1

118

percentages of yellow and green fibers were observedon days 52 and 120. In normal gingiva, this area wasdescribed as a region with an increased concentra-tion of metalloproteinases28 and monocytes duringmaturation and differentiation processes.14 The MDarea also was analyzed in gingival overgrowths in-duced by nifedipine and phenytoin and was describedas being a site with higher concentrations of trans-forming growth factor-beta, a growth factor that actsas an initiator of the repair process.29

Romanos et al.30 studied fibronectin and collagentypes IV, V, and VI in gingival overgrowths inducedby nifedipine, cyclosporin, and phenytoin and ob-served characteristic distribution patterns of ECMcomponents. Collagen IV was found in the basal lam-ina of blood vessels and nerves, as well as in those

from epithelium, and correlatedwith epithelial and vascular prolif-eration. In the present study,changes in blood vessel distribu-tion and epithelial hyperplasiawere observed through hematoxy-lin and eosin and collagen IV im-munohistochemical stainings.However, these findings did notcorrelate clearly with a specificdrug-related pattern or with MMP-2gene expression levels, the en-zyme responsible for collagen IVdegradation.

Studies of gingival overgrowthdevelopment have focused on fi-broblast metabolism under in vitroconditions. Biologic mechanismsinvolved in gingival overgrowthare complex and consist of inter-actions between several growthfactors and cytokines that act ina cascade of biologic events indifferent cellular types.10-14 There-fore, because of the lack of mul-tiple cell-mediated interactions,genetic expression patterns ob-served in vitro may differ fromthose observed in vivo. In addition,the response of a determined celltype to biologic stimuli may be het-erogeneous, even under the samein vitro conditions.31 More specifi-cally, MMP gene expression byseveral cell types in culture maydiffer or be limited in relation tothe in vivo conditions.15 The al-tered enzyme production in vitromay be a consequence of cellexposure to a new environment,

induction to a wounding effect caused by the explan-tation, and/or the loss of normal tissue components.32

In vivo studies should consider other biologic factorsthat modify MMP gene expression, such as differentgrades of inflammation.

MMP-1 has been correlated with tissue destruc-tion during periodontal disease.33,34 In the presentstudy, the control of periodontal irritants was notperformed because of difficulties imposed by theexperimental model. This variable was compen-sated for by the longitudinal protocol, in which thecontrol sample was collected from the same animalbefore treatment. Under these experimental condi-tions, there was no correlation between the clinicalparameters of the gingival condition and MMP-1 or-2 gene expression. Therefore, modifications in

Figure 3.Effects of nifedipine on the gingiva of a subadult C. apella monkey. Clinical aspects before (A) andafter 52 days of treatment (B). There were no morphologic differences between the control (C)and 52-day (D) samples (hematoxylin and eosin). Picrosirius red staining of sections in C (E) andD (F). (Original magnification ·100; bar = 100 mm.)

J Periodontol • January 2008 Kanno, Oliveira, Garcia, Castro, Crivelini

119

MMP gene expression during the experiment could notbe attributed to the periodontal status of the animal.

In young animals, there was a great variability inthe individual patterns of MMP-1 gene expression inthe control samples. This phenotypic diversity maybe attributed to the nucleotide polymorphism in thepromoter region of the MMP-1 gene of different fibro-blast subpopulations.8 Individual differences in theproportion of each fibroblast subpopulation may ac-count for the interindividual variation in MMP-1 ex-pression levels. The phenotypic differences amongfibroblast subpopulations also seem to be involvedin the development of gingival overgrowth. Cyclo-sporin8,21 and nifedipine3 may induce the selectiveproliferation of low MMP-1–producing fibroblasts, re-sulting in a phenotypically different population fromnormal gingiva. Older animals showed low levels of

MMP-1 gene expression, which in-dicated that age is a modifying fac-tor. Indeed, MMP genes areexpressed poorly in adult tissues,although they are upregulated dur-ing tissue repair, inflammation, tu-mor invasion, and metastasis.15

A tendency for lower levels ofMMP-1 gene expression occurredon day 52, and increased valuesoccurred on day 120. The increasein gene expression occurred inparallel with a higher density ofcollagen fibers, as observed his-tologically. Although proteolyticenzymes have been correlatedmainly with tissue degradation,as occurs in periodontal diseases,they also play an important rolein tissue repair. The cleavage ofECM molecules by proteases con-tributes to cell migration by clear-ing a path through the matrix,exposing molecular sites for cellu-lar binding and migration, promot-ing cell detachment that allowscellular movement, and releasingextracellular signals that stimulatecell migration.35 In this regard,MMP-1 gene expression has beencorrelated with repair in diseasedperiodontal tissues,33 which leadsto the conclusion that the develop-ment of gingival overgrowth mayconsist of biologic mechanismssimilar to tissuerepairor remodeling.

MMP-2 and collagen I genes didnot show expression patterns thatwere uniform between the three

drugs. Phenytoin induced a 36% increase in collagentype I gene expression on day 120 compared to theearlier period. Histologic sections of the phenytoingroup depicted an increased density of collagen fibersin comparison to other groups. Uzel et al.29 attributedthe fibrosis induced by phenytoin to higher levels ofconnective tissue growth factor compared to amountsin cyclosporin and nifedipine groups. However, the al-tered gene expression inferred from mRNA levels can-not be interpreted necessarily as a proportionalmodification in the tissue. From the gene expressionevent to the presence of the respective protein inthe extracellular environment, there is a range of con-trolling mechanisms that were not assessed in the pres-ent study.

The gene expression patterns observed in thisstudy indicated that the development of drug-induced

Figure 4.Percentages of different collagen fiber hues (green, yellow, orange, red) after picrosirius red stainingon days 0, 52, and 120 in cyclosporin (A), phenytoin (B), and nifedipine (C) groups.

Collagen Metabolism in Drug-Induced Gingival Overgrowth Volume 79 • Number 1

120

gingival overgrowth consists of different phases,which seems to justify all of the controversial datadescribed in the literature. Therefore, increased or de-creased levels of MMP-1 and -2 and collagen gene ex-pression may be observed according to the drug orphase of development studied. Similarly, histologicaspects change in accordance with the stage of le-sional development in which even transitory fibroblastproliferation may be observed.36,37 A long-term lon-gitudinal study37 reported a trend to return to normalvalues even with the maintenance of drug therapy.Additional experiments would be valuable to studythe long-term effects of drugs that induce gingivalovergrowth in tufted capuchin monkeys.

CONCLUSIONS

In tufted capuchin monkeys, cyclosporin, nifedipine,and phenytoin induced an increase in immature colla-gen fibers, independently of animal age, despite thelack of prominent clinical signs of gingival over-

growth. The drugs altered MMP-1 and -2 and collagengene expression in drug-related patterns. The colla-gen metabolism alteration exhibited different phasesand a non-uniform histologic pattern over the samesample.

ACKNOWLEDGMENTS

The authors thank Dr. Renato Herman Sundfeld, Den-tal School of Aracxatuba, Sao Paulo State University,for assistance with using the polarizing microscope;Dr. Jose Buratini Jr., Medicine School of Botucatu,Sao Paulo State University, and Dr. Sergio MoraesAoki, Veterinary Medicine School of Aracxatuba, SaoPaulo State University, for helpful suggestions onRT-PCR assays; and Ms. Erica de Souza Ribeiro, Vet-erinary Medicine School of Aracxatuba, Sao PauloState University, for assistance during the DNA se-quencing. The authors report no conflicts of interestrelated to this study.

REFERENCES1. Neville BW, Damm DD, Allen CM, Bouquot JE. Oral and

Maxillofacial Pathology. Philadelphia: W.B. Saunders;1995:129-132.

2. Kataoka M, Shimizu Y, Kunikiyo K, et al. Nifedipineinduces gingival overgrowth in rats through a reduc-tion in collagen phagocytosis by gingival fibroblasts.J Periodontol 2001;72:1078-1083.

3. McKevitt KMB, Irwin CR. Phenotypic differences ingrowth, matrix synthesis and response to nifedipinebetween fibroblasts derived from clinically healthy andovergrown gingival tissue. J Oral Pathol Med 1995;24:66-71.

4. Mariotti A, Hassell T, Jacobs D, Manning CJ, Hefti AF.Cyclosporin A and hydroxycyclosporine (M-17) affectthe secretory phenotype of human gingival fibroblasts.J Oral Pathol Med 1998;27:260-266.

5. Kato T, Okahashi N, Kawai S, et al. Impaired degra-dation of matrix collagen in human gingival fibroblastsby the antiepileptic drug phenytoin. J Periodontol2005;76:941-950.

6. Birkedal-Hansen H. Role of matrix metalloproteinasesin human periodontal diseases. J Periodontol 1993;64:474-484.

7. Montes GS, Junqueira LC. The use of the picrosirius-polarization method for the study of the biopathologyof collagen. Mem Inst Oswaldo Cruz 1991;86:1-11.

8. Hyland PL, Traynor PS, Myrillas TT, et al. The effectsof cyclosporin on the collagenolytic activity of gingivalfibroblasts. J Periodontol 2003;74:437-445.

9. Zebrowski EJ, Pylypas SP, Odlum O, Johnson RB.Comparative metabolism by fibroblast populationsexposed to cyclosporine. J Periodontol 1994;65:565-567.

10. Iacopino AM, Doxey D, Cutler CW, et al. Phenytoinand cyclosporine A specifically regulate macrophagephenotype and expression of platelet-derived growthfactor and interleukin-1 in vitro and in vivo: Possiblemolecular mechanism of drug-induced gingival hy-perplasia. J Periodontol 1997;68:73-83.

11. Pernu HE, Knuuttila MLE. Macrophages and lympho-cyte subpopulations in nifedipine- and cyclosporin

Figure 5.Mean (– SD) mRNA levels reflect the effects of cyclosporin (A),phenytoin (B), and nifedipine (C) on MMP-1 and -2 and collagentype I gene expression on days 0, 52, and 120.

J Periodontol • January 2008 Kanno, Oliveira, Garcia, Castro, Crivelini

121

A-associated human gingival overgrowth. J Periodon-tol 2001;72:160-166.

12. Nares S, Ng MC, Dill RE, Park B, Cutler CW, IacopinoAM. Cyclosporine A upregulates platelet-derived growthfactor B chain in hyperplastic human gingiva. J Peri-odontol 1996;67:271-278.

13. Plemons JM, Dill RE, Rees TD, Dyer BJ, Ng MC,Iacopino AM. PDGF-B producing cells and PDGF-Bgene expression in normal gingival and cyclosporineA-induced gingival overgrowth. J Periodontol 1996;67:264-270.

14. Nurmenniemi PK, Pernu HE, Laukkanen P, KnuuttilaMLE. Macrophage subpopulations in gingival over-growth induced by nifedipine and immunosuppressivemedication. J Periodontol 2002;73:1323-1330.

15. Birkedal-Hansen H. Proteolytic remodeling of extra-cellular matrix. Curr Opin Cell Biol 1995;7:728-735.

16. Muhlemann HR, Son S. Gingival sulcus bleeding – Aleading symptom in initial gingivitis. Helv OdontolActa 1971;15:107-113.

17. Loe H, Silness J. Periodontal disease in pregnancy. I.Prevalence and severity. Acta Odontol Scand 1963;21:533-551.

18. Gilmore RM. Mammalogy in an epidemiological studyof jungle yellow fever in Brazil. J Mammal 1943;24:144-162.

19. Junqueira LCU, Bignolas G, Brentani RR. Picrosiriusstaining plus polarization microscopy, a specific methodfor collagen detection in tissue sections. Histochem J1979;11:447-455.

20. Marshall RI, Bartold PM. A clinical review of drug-induced gingival overgrowths. Aust Dent J 1999;44:219-232.

21. Thomason JM, Sloan P, Seymour RA. Immunolocaliza-tion of collagenase (MMP-1) and stromelysin, (MMP-3)in the gingival tissues of organ transplant patients med-icated with cyclosporin. J Clin Periodontol 1998;25:554-560.

22. McGaw WT, Porter H. Cyclosporine-induced gingivalovergrowth: An ultrastructural stereologic study. OralSurg Oral Med Oral Pathol 1988;65:186-190.

23. Daley TD, Wysocki GP, Day C. Clinical and pharma-cologic correlations in cyclosporine-induced gingivalhyperplasia. Oral Surg Oral Med Oral Pathol 1986;62:417-421.

24. Rich L, Whittaker P. Collagen and picrosirius red stain-ing: A polarized light assessment of fibrilla hue andspatial distribution. Braz J Morphol Sci 2005;22:97-104.

25. Dayan D, Hiss Y, Hirshberg A, Bubis JJ, Wolman M.Are the polarization colors of picrosirius red-stainedcollagen determined only by the diameter of thefibers? Histochemistry 1989;93:27-29.

26. Sculean A, Junker R, Donos N, Berakdar M, Brecx M,Dunker N. Immunohistochemical evaluation of matrixmolecules associated with wound healing followingregenerative periodontal treatment in monkeys. ClinOral Investig 2002;6:175-182.

27. Werfully S, Areibi G, Toner M, et al. Tensile strength,histological and immunohistochemical observationsof periodontal wound healing in the dog. J PeriodontalRes 2002;37:366-374.

28. Meikle MC, Hembry RM, Holley J, Horton C, McFarlaneCG, Reynolds JJ. Immunolocalization of matrix metallo-proteinases and TIMP-1 (tissue inhibitor of metallopro-teinases) in human gingival tissues from periodontitispatients. J Periodontal Res 1994;29:118-126.

29. Uzel MI, Kantarci A, Hong H-H, et al. Connective tissuegrowth factor in drug-induced gingival overgrowth.J Periodontol 2001;72:921-931.

30. Romanos GE, Strub JR, Bernimoulin J-P. Immunohis-tochemical distribution of extracellular matrix proteinsas a diagnostic parameter in healthy and diseasedgingiva. J Periodontol 1993;64:110-119.

31. James JA, Irwin CR, Linden GJ. Gingival fibroblastresponse to cyclosporin A and transforming growthfactor b1. J Periodontal Res 1998;33:40-48.

32. Woolley DE, Davies RM. Immunolocalization of colla-genase in periodontal disease. J Periodontal Res 1981;16:292-297.

33. Romanelli R, Romanelli R, Mancini S, et al. Activationof neutrophil collagenase in periodontitis. Infect Im-mun 1999;67:2319-2326.

34. Kubota T, Nomura T, Takahashi T, Hara K. Expressionof mRNA for matrix metalloproteinases and tissueinhibitors of metalloproteinases in periodontitis-affected human gingival tissue. Arch Oral Biol 1996;41:253-262.

35. Alberts B, Johnson A, Lewis J, Raff M, Roberts K,Walter P. Molecular Biology of the Cell, 4th ed. NewYork: Garland Publishing; 2002:1065-1126.

36. Hassell TM, Roebuck S, Page RC, Wray SH. Quan-titative histopathologic assessment of developingphenytoin-induced gingival overgrowth in the cat.J Clin Periodontol 1982;9:365-372.

37. Spolidorio LC, Spolidorio DM, Holzhausen M. Effectsof long-term cyclosporin therapy on the periodontiumof rats. J Periodontal Res 2004;39:257-262.

Correspondence: Dr. Claudia M. Kanno, Dental School ofAracxatuba – Sao Paulo State University, Rua JoseBonifacio, 1193, CEP 16015-050, Aracxatuba, SP, Brazil.E-mail: cmkanno@foa.unesp.br.

Submitted May 9, 2007; accepted for publication July 16,2007.

Collagen Metabolism in Drug-Induced Gingival Overgrowth Volume 79 • Number 1

122