Effects of heat shock on ovary development and hsp83 expression in Tribolium castaneum (Coleoptera: Tenebrionidae)

A r t i c l e

EFFECTS OF HEAT SHOCK ONOVARY DEVELOPMENT ANDHSP83 EXPRESSION IN Triboliumcastaneum (COLEOPTERA:TENEBRIONIDAE)

Jingjing Xu, Juan Shu, Xiaotian Qiu, Zhipeng Wang,Fuping Zhao, Zhe Zhang, and Qin ZhangState Key Laboratories for AgroBiotechnology, Key Laboratory of AnimalGenetics and Breeding of the Ministry of Agriculture of China, Collegeof Animal Science and Technology, China Agricultural University,Beijing 100193, China

Heat shock affects reproductive performance in insects includingTribolium castaneum. In this study, the effects of heat shock on ovarydevelopment and hsp83 expression in T. castaneum were investigated.Two lines of T. castaneum, H line and C line, from the same basepopulation were established and maintained for five successive genera-tions. In each generation, the newly hatched beetles (within 3 h aftereclosion) in the H line were treated with a heat shock at 401C for 1 h, andthose in the C line were raised at normal temperature (301C) as controltreatment. Four traits related to ovary development were measured for thebeetles of the fifth generation: days from eclosion to laying the first eggs(To), days from eclosion to laying the first hatchable eggs (Th), ovariolesize on the third day after eclosion, and pupal mass of their offspring.The results showed that the beetles of the H line had a significantly longerpre-oviposition period (0.6 more days) and smaller ovariole size thanthose of the C line. No significant difference in pupal mass was observed.Applying heat shock to the offspring of the fifth generation of both linesled to significantly higher hsp83 expression in offspring of the C linethan in offspring of the H line. Within each line, the hsp83 expressionlevel in offspring with heat shock was significantly higher than that of

Grant sponsor: National Key Basic Research Program of China; Grant number: 2006CB102104; Grant sponsor:Key project of the National Natural Science Foundation of China; Grant number: 30430500.Correspondence to: Qin Zhang, Ph.D., College of Animal Science and Technology, China AgriculturalUniversity, Beijing 100193, China. E-mail: [email protected]

ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 70, No. 3, 204–216 (2009)

Published online in Wiley InterScience (www.interscience.wiley.com).

& 2009 Wiley Periodicals, Inc. DOI: 10.1002/arch.20294

offspring without heat shock, but the difference in the C line was muchlarger than that in the H line. We infer from these results that a tradeoffbetween heat resistance, registered as hsp83 expression, and ovariandevelopment operates under heat stress in T. castaneum. �C 2009 WileyPeriodicals, Inc.

Keywords: heat shock; heat shock protein; ovary development; Triboliumcastaneum

INTRODUCTION

Heat shock influences reproduction in many insect species (Neuer et al., 1999, 2000;Gruntenko et al., 2003, Huang et al., 2007). Male sterility at extreme temperature is acommon phenomenon and the thermal thresholds leading to sterility vary acrossspecies and lines within species. For example, in Drosophila melanogaster the thermalthreshold is 231C in heat-sensitive lines and 311C in heat-tolerant lines (David et al.,2006; Chakir et al., 2002). Temperature also strongly affects the duration of the pre-oviposition period in both males and females. In D. buzzatii, males reared constantly at311C became fertile after emergence much later than those reared at normaltemperature (Vollmer et al., 2004). In yellow dung fly (Scathophaga stercoraria L.),Blanckenhorn and Henseler (2005) reported that the insects spent more time to reachovarian maturation at warmer temperatures (4251C) than at the normal temperature(201C). Studies in Bactrocera oleae also showed that the duration of ovarian maturationincreased at a higher temperature (Fletcher and Kapatos, 1983; Tzanakakis andKoveos, 1986). In Telenomus theophilae, both ovariole length and mature egg sizedecrease significantly when reared at 311C from the first day after emergence,compared with those reared at 251C and 281C (Liu et al., 2006). In silkworm, maturelarvae or pupae exposed to 321C from the beginning of cocooning or the first day afterpupation led to hindered growth and development of ovaries. The ovaries weresmaller and they contained smaller amounts of soluble protein compared to ovariestaken from adults reared at 261C. These differences were negligible for silkwormsexposed to 321C from the sixth day after pupation (Ye et al., 2000). High temperaturealso affects the reproductive performance of T. castaneum remarkably (Mahroof et al.,2005a). Their fecundity, egg-to-adult survival, and adult progeny productiondecreased after males, females, or both males and females were exposed to 501C.

The response of cells or organisms to heat shock and other stressors is connectedto the induction of heat shock proteins (HSPs). In addition to their roles in protectingcells from stress, almost all HSPs are constitutively expressed in organisms at normalconditions, where they function as chaperones to ensure the correct folding of proteinsand assist the translocation of proteins across intracellular membranes (Neupert, 1997;Hartl and Hayer-Hartl, 2002; Nollen and Morimoto, 2002). HSPs can be divided intoseveral families including HSP90, 70, 60, 40, and small HSPs (sHSPs) according totheir molecular weight and homology of amino acid sequences (Feder and Hofmann,1999; Sørensen et al., 2003). Recently the role of HSP90 in development has attractedinterest (Ding et al., 1993; Yoo et al., 1998; Ohsako et al., 1995; Yue et al., 1999; Inoueet al., 2006). In D. melanogaster, HSP90 is required in vivo as a member of a chaperonecomplex for activating the ecdysone receptor (Arbeitman and Hogness, 2000). hsp

Heat Shock Effect on Ovary Development in Tribolium � 205

Archives of Insect Biochemistry and Physiology

expression level and the consequential phenotype variations such as stress tolerance,fecundity, and longevity in Drosophila are correlated (Feder and Hofmann, 1999;Hoffmann et al., 2003).

Although the effect of heat stress on reproduction performance has beeninvestigated widely in many insect species, how heat stress affects ovarian developmentis still unclear. In this study, we used T. castaneum as a model system to investigate theeffect of heat shock on ovarian development and the expression of the hsp83 gene (thehomologue of hsp90 in T. castaneum).

MATERIALS AND METHODS

Materials

Four hundred pupae were taken from a Tribolium line that has been kept in ourlaboratory for more than 40 years, and their pupal eclosion time was recorded(checking for eclosion every hour). Male and female adults were randomly paired formating if the difference of their eclosion time was less than 3 h. Seventy families wereestablished as the base population.

The beetles were kept in vials (diameter: 9.8 mm, height: 110 mm, all with 2 gmedium [defined below] and one pair per vial) in dark and ventilated chambers at30–321C and 60–70% RH. Standard medium was prepared every 4 weeks with 80%flour (heated for 6 min by microwave), 10% dried yeast (stored at 41C), and 10% driedmilk powder (stored at 41C).

The base population was randomly divided into two lines, H line and C line. Bothlines reproduced for five successive generations. In each generation within each line,6–10 females along with their mates were selected randomly from 30–50 families andmated randomly to produce individuals of the next generation. No artificial selectionwas applied in both lines. In each generation, the newly hatched beetles (within 3 hafter eclosion) in the H line were put into a 401C culture box for 1 h, and then culturedat normal temperature (301C). In the C line, the beetles were cultured at normaltemperature and served as controls.

Traits Measured

Four traits related to ovarian development were measured on individuals of the fifthgeneration of the H and C lines. The first trait was days from eclosion to laying the firsteggs (To). The couple in a vial was removed to a new vial every day from the 3rd dayuntil the 8th day after eclosion and the emptied vial was checked for the presence ofeggs in the medium. On the 8th day, the couple was moved to a brown bottle to layeggs. The second trait was days from eclosion to laying the first hatchable eggs (Th)and was measured by observing in which vial the larva were hatched first. The thirdtrait was pupal mass of the offspring. Because the pupal period lasts 5–7 days, it wasnot feasible to measure the weight at the same pupal stage for all individuals. Thepupal period was divided into two phases according to the pigmenting in the pupaleyes, namely P1: no or only small scattered black pigment deposition in eyes; and P2:large flaking black pigment deposition in eyes. Ovariole size was the fourth trait. Onthe third day after eclosion, the two ovaries of each beetle were isolated (Trauner andBuning, 2007) in phosphate buffer solution (pH 5 7.4) on an Olympus SZX7dissecting microscope. The ovaries were photographed with an Olympus C7070

206 � Archives of Insect Biochemistry and Physiology, March 2009


camera (200� ; Olympus, Tokyo, Japan) interfaced with a phase contrast microscope(Leica DM 2000; Leica Microsystems GmbH, Wetzlar, Germany). Photographs wereprocessed with Adobe Photoshop CSs and the ovariole length (measured from the tipof ovariole to entrance of side oviduct) and width (measured at the widest position ofthe ovariole) were measured (Yang et al., 2007) and adjusted for the slightly differentmagnification of the camera using the eyeshot diameter as a landmark. For eachbeetle, six ovarioles (three from each ovary) were measured, and the averages of thesix measurements were used for analysis.

Investigation of hsp83 Expression Using Semi-Quantitative PCR and Real-Time Semi-Quantitative PCR

For semi-quantitative PCR, 30 newly hatched female adults (within 3 h after eclosion)were taken randomly from the offspring of the fifth generation of the C and H lines.They were from 6 families, 3 from each line and 5 full sibs in each family. All of themwere exposed to 401C for 1 h and then recovered at 301C for 1, 4, 8, 12, and 16 h,respectively, 6 beetles (3 from each line) for each time point. The beetles were frozen inliquid nitrogen and stored at �801C prior to RNA extraction. Total RNA was isolatedfrom whole body using TRIzol (Invitrogen, Carlsbad, CA) reagent following themanufacturer’s instructions and was purified using RQ RNAse free DNAse (Promega,Madison, WI) to eliminate any remaining DNA. RT-PCR was conducted with 2 mg totalRNA, random primers, anchored poly (dT)-primers, and M-MLV reverse transcriptase(Promega, Madison, WI) following the manufacturer’s instructions. Semi-quantitativeRT-PCR (25 cycles) was done following the procedure described by Marone et al.(2001).

For real-time semi-quantitative PCR, 30 newly hatched adults were takenrandomly from the offspring of the fifth generation of each line. Within each line,the 30 beetles were divided into two groups. The beetles of one group were treatedwith heat shock at 401C for 1 h and then recovered at 301C for a time period for whichthe semi-quantitative PCR revealed the highest expression level. The beetles of theother group were not treated with heat shock. Real-time semi-quantitative PCR wascarried out for all four groups with SYBRs Green qPCR SuperMix (AppliedBiosystems, Foster City, CA) in a volume of 15 mL reaction mixtures and using thehsp83 gene (GenBank accession no.EF633444) specific primers (Table 1) and rps3(ribosomal protein S3) as a house-keeping gene (Mahroof et al., 2005b). Amplificationwas performed under thermal cycling conditions (Applied Biosystems, 7900HT) asfollows: 2 min at 501C, 10 min at 951C, and 40 cycles (15 s at 951C and 1 min at 621C foreach cycle). The hsp83 mRNAs of the control were examined in every PCR plate tocorrect the systematic error. Relative quantification of expression was determinedusing the comparative CT method (Gore and Schal, 2005).

Table 1. Primers (Designed With Oligo 6) Used in Real-Time Semi-Quantitative PCR

Primer name Direction (50-30) Fragment Length (bp) Sequence

Ribosomal protein S3 Forward 157 GCAAGTTTGTTGGCGATGGCRibosomal protein S3 (rps3) Reverse CTCCCCCAATACACGGTCAGhsp83 Forward 107 CGCAGTTCATTGGCTATCCChsp83 Reverse GTCTTCGCCTTCTTCCTCCT



Statistical Analysis

Linear model analysis. The following linear models were used to test the heat shockeffects on the five traits:

For To,

yij ¼ mþ li þ aj þ eij

where yij is an observed value on To, m is the overall mean, li is the ith (i 5 1,2,) lineeffect, aj is the random effect of the jth individual for which the full pedigreeinformation (from the base population to the fifth generation) was considered toaccount for the relationship between individuals, and eij is the residual error.

For Th,

yij ¼ mþ li þ aj þ bxij þ eij

where yij is an observed value on Th, xij is the corresponding observation on To, b is theregression coefficient. The other terms are the same as in the model for To.

For pupal mass,

yijkl ¼ mþ li þ sj þ pk þ al þ lsij þ lpik þ eijkl

where yijkl is an observation on pupal weight, sj is the jth (j 5 1, 2) gender effect, pk is kth(k 5 1, 2) pupal phase effect, lsij is the interaction effect between li and sj, and lpik isthe interaction effect between li and pk. The other terms are the same as in the modelfor To.

For ovariole length and width,

yij ¼ mþ li þ eij

where yij is an observation on ovariole length or width, li is the ith group (H line and Cline) effect.

For hsp83 expression

yijkm ¼ mþ li þ tj þ gk þ ltij þ lgik þ tgjk þ eijkm

where yikmj is the log-transformed expression level of hsp83 determined by qPCR, li isthe ith line (H line or C line) effect, tj is the jth treatment (with or without heattreatment) effect, ltij is the interaction between line and treatment effect, lgik is theinteraction between line and gender effect, and tgjk is the interaction betweentreatment and gender effect.

The PEST program (Kovac and Groeneveld, 1990) was employed for the linearmodel analysis for To, Th, and pupal mass. The ovariole length and width and thehsp83 expression were analyzed using SPSS version 13.0.

Survival analysis for To and Th. For To and Th, a survival analysis was performed using theCox-regression method. The factors considered were the same as those in thecorresponding linear models for To and Th, except that the random individual effect wasdeleted. The Wald test (Agresti, 1990) was conducted to test the significance of thedifference between the H and C lines. The analysis was performed using SPSS version 13.0.

For the significance tests of all the above analyses, a P valueo0.05 infers asignificant difference between two groups being compared.



RESULTS

Linear Model Analysis for To, Th, Pupal Mass, and Ovariole Length and Width

The estimates of the contrasts between the H and C lines for To, Th, and pupal mass fromthe linear model analysis are 0.6170.30, 0.1770.28, and 0.1170.15, respectively. Incomparison with the C line, the H line had significantly longer duration from eclosion tolaying the first eggs. However, the differences in the duration from eclosion to laying thefirst hatchable eggs and the pupal weight between the two lines were not significant.

The least square means of ovariole length of the two samples from the H and Clines are 0.4170.02 and 0.5070.02, respectively. For ovariole width, the correspond-ing least square means are 0.1170.00 and 0.1270.00. The C line had significantlylonger and wider ovarioles than the H line (Fig. 1).

Survival Analysis for To and Th

The survival functions for To, i.e., the cumulative proportions of individuals not layingeggs from the 3rd until the 8th day after eclosion, in the H and C lines are shown inFigure 2. During this period, the cumulative proportion decreased from 70 to 0.2% inthe C line and from 79 to 2% in the H line. The major differences between the two linesoccurred on the 3rd–5th day. The cumulative proportions on the three days were 70, 25,and 6%, respectively, in the C line, and 79, 39, and 14%, respectively, in the H line. Inother words, in the C line, 30, 75, and 94% female beetles laid eggs after 3, 4, and 5 daysafter eclosion, respectively, whereas in the H line the corresponding proportions were 21,61, and 86%. The estimated difference between the two lines is about 0.4 d, which issignificant by the Wald test. Similarly, the survival functions for Th, i.e., the cumulativeproportions of individuals not laying hatchable eggs from the 3rd until the 8th day aftereclosion, in the H and C lines are shown in Figure 3. The cumulative proportion duringthis period decreases from 76 to 5% in the C line and from 79 to 9% in the H line. Theestimated difference between the two lines is about 0.2 d, which is also significant.

hsp83 Expression Determined by Semi-Quantitative PCR and Real-Time Semi-Quantitative PCR

The hsp83 expression in experimental beetles after a heat shock is shown in Figure 4.The offspring from the C line had a significantly higher expression level than those

Figure 1. Ovariole sizes (1:600) of female beetles of the C and H lines. a: C line; b: H line. OL, ovariolelength; OW, ovariole width.



from the H line at 1, 4, and 8 h of recovering after heat shock. At 12 and 16 h, theexpression levels were nearly the same in the two groups.

Since the semi-quantitative PCR analysis indicated that at 1 h of recovering afterheat shock the hsp83 expression level was the highest, this time point was chosen forfurther analysis. Significant differences in hsp83 expression were found between the C

Figure 2. Survival function for days from eclosion to laying the first eggs (To) measured for female beetlesof the C and H lines: cumulative proportions of individuals not laying eggs from the 3rd to the 8th day aftereclosion.

Figure 3. Survival function for days from eclosion to laying the first hatchable eggs (Th) measured forfemale beetles of the C and H lines: cumulative proportions of individuals not laying hatchable eggs from the3rd to the 8th day after eclosion.



and H lines (LSM: 2.90 vs. 1.80), between treatments with and without heat shock(LSM: 3.75 vs. 0.95), and between females and males (LSM: 3.24 vs. 1.46). Significantinteractions between treatment and gender (Figure 5) and between treatment and line(Fig. 6) were observed. The interaction between line and gender was not significant.After heat shock treatments, female adults had a much higher hsp83 expression levelthan males (LSM: 5.44 vs. 2.06), and the C line had a higher expression level than theH line (LSM: 4.80 vs. 2.70). For the offspring without heat treatment, no significantdifference was found between the two sexes and between the two lines. It should benoted that for each of the paired comparisons, the influences of other factors had beenadjusted, since these comparisons were based on a multiple factor analysis of variance.

DISCUSSION

The effect of heat shock on reproductive performance in insects has been widelyreported. In T. castaneum, most of the studies were focused on the fecundity, fertility,and progeny production at temperatures of 44–501C (e.g., Saxena et al., 1992;Arbogast, 1981; Mahroof et al., 2005a). Howe (1965) revealed that 401C is the upperphysiological limit for T. castaneum. Mahroof et al. (2005b) found that when exposed to401C, the expression of the hsp70 I gene increased by 1.1- to 2.0-fold in young larvae,old larvae, pupae, and adults of T. castaneum compared with the control (exposed to231C). This indicates that heat treatment at 401C could also lead to heat stress in T.castaneum. In this study, we investigated the effect of heat shock at 401C on theduration of pre-reproductive period, ovariole size, and pupal mass in T. castaneum. Theanalysis was first based on linear models for all traits. Since the time from eclosion tolaying eggs can also be considered as survival data with censored observations (theobservations after 8 days after eclosion were censored), survival analysis was also

Figure 4. Expression of hsp83, revealed by semi-quantitative PCR, in newly hatched (within 3 h aftereclosion) female adults (offspring of the fifth generation of the H and C lines) treated with heat shock at 401Cfor 1 h and then recovered at 301C for 1, 4, 8, 12, and 16 h, respectively. A: Expression of hsp83 and rps3(housekeeping gene); C and H denote the C and H line, respectively. B: Relative expression level of hsp83normalized by amount of rps3. Histogram bars with different letters are significantly different.



Figure 5. Relative expression levels of hsp8, revealed by real time semi-quantitative PCR, in newly hatched(within 3 h after eclosion) male and female beetles (offspring of the fifth generation of the H and C lines)treated with or without heat shock at 401C for 1 h and recovered at 301C for 1 h. H-M, males with heat shock;H-F, females with heat shock; N-M, males without heat shock; N-F, females without heat shock. Histogrambars with different letters are significantly different. The line effect was adjusted in the comparisons.

Figure 6. Relative expression levels of hsp83, revealed by real time PCR, in newly hatched (within 3 h aftereclosion) beetles (offspring of the fifth generation of the H and C lines) treated with or without heat shocktreatment at 401C for 1 h and recovered at 301C for 1 h. H-H, H line with heat shock; H-C, C line with heatshock; N-H, H line without heat shock; N-C, C line without heat shock. Histogram bars with different lettersare significantly different. The sex effect was adjusted in the comparisons.



employed for two traits, To (days from eclosion to laying the first eggs) and Th (daysfrom eclosion to laying the first hatchable eggs).

Both linear model analysis and survival analysis revealed that heat shock sloweddown the process from eclosion to oviposition of the newly hatched female beetles(within 3 h after eclosion) when exposed to 401C for 1 h. In corresponding to thedelayed oviposition, the ovarioles of the female beetles in the H line were significantlysmaller than those of beetles in the C line. These results suggest that heat shocktreatment slows down the ovarian development of female beetles. Blanckenhorn andHenseler (2005) reported that warmer ambient temperatures during adult stagesresulted in the smaller egg size of females in yellow dung fly. It could be imagined thatthe same would happen in T. castaneum. However, the decrease in the size of ovariolesmight not relate to the decrease in the size of all eggs, but to the resorption of a part ofthem resulting from an increase of 20-hydroxyecdysone titre under heat stress as itoccurs, e.g., in D. melanogaster (Gruntenko et al., 2003).

The process of ovarian development involves the production of vitelloginin, itstransportation and deposition into oocytes (Thomas et al., 1998; Schonbaum et al.,2000; Marinotti et al., 2005), and may require the participation of the HSP90 proteinas a member of a chaperone complex for activating the ecdysone receptor inD. melanogaster (Arbeitman and Hogness, 2000). Early studies also indicated that thehsp genes are related to thermal tolerance (Mitchell et al., 1979; Feder and Hofmann,1999; Huang and Kang, 2007). In this study, significantly higher hsp83 expression wasrecorded from experimental, compared to control, beetles. In females, hsp83expression was accompanied by the delayed ovarian development of female beetles.This suggests that in case of heat shock, hsp83 would act more on enhancing theresistance of beetles to stress by its higher expression and perhaps reduce its role as achaperone. A similar phenomenon was also observed by Wang et al. (2004) and Huanget al. (2007), who found a tradeoff between thermal protection and fecundity in theoverexpression of hsp26 and hsp27 in D. melanogaster and overexpression of hsp70 andhsp20 in L. huidobrensis, respectively. Tradeoffs between thermal resistance and otherconsequences have been widely reported in various organisms (Hoffmann et al., 2003),but the underlying mechanisms are less understood. Huang et al. (2007) suggestedthat it may be due to a reduction of energy support (Koehn and Bayne, 1989;Hoffmann, 1995) and usually results in a concomitant reduction in the synthesis ofother proteins (Parsell and Lindquist, 1994).

hsp83 expression in the offspring from the C line was much higher than those fromthe H line. Within each line, the hsp83 expression of the offspring treated with heatshock was higher than that of offspring without heat shock, but the difference in the Cline was much larger than that in the H line. It seems that after five successivegenerations of heat shock treatment, the beetles in the H line became less sensitive toheat stress as compared with those reared under normal conditions all along in the Cline. A possible reason for this is that under heat shock conditions the beetles with lowheat-tolerant ability would lose or reduce their fertility so that most offspring in thenext generation were from those with high heat-tolerant ability. Therefore, an indirectselection with respect to heat tolerance took place during the process, which led to therelative higher heat tolerance in the H line. This result supports indirectly theconclusion made by Feder and Hofmann (1999) that thresholds for hsp expression arecorrelated with levels of stress that they naturally undergo. However, whether thelong-term repeated stress in nature would produce a heritable effect on offspringneeds further study.



ACKNOWLEDGMENTS

This study was supported by the National Key Basic Research Program of China(Grant NO. 2006CB102104) and the Key project of the National Natural ScienceFoundation of China (Grant No. 30430500).

LITERATURE CITED

Agresti A. 1990. Categorical data analysis. New York: John Wiley & Sons, 558p.

Arbeitman MN, Hogness DS. 2000. Molecular chaperones activate the Drosophila ecdysonereceptor, an RXR heterodimer. Cell 101:67–77.

Arbogast RT. 1981. Mortality and reproduction of Ephestia cautella and Plodia interpunctellaexposed as pupae to high temperature. Env Entomol 10:708–711.

Blanckenhorn WU, Henseler C. 2005. Temperature-dependent ovariole and testis maturationin the yellow dung fly. Ent Exp Appl 116:159–165.

Chakir M, Chafik A, Moreteau B, Gibert P, David JR. 2002. Male sterility thermal thresholds inDrosophila: D. simulans appears more cold-adapted than its sibling D. melanogaster. Genetica114:195–205.

David JR, Legout H, Moreteau B. 2006. Phenotypic plasticity of body size in a temperatepopulation of Drosophila melanogaster: when the temperature-size rule does not apply.J Genet 85:9–23.

Ding D, Parkhurst SM, Halsell SR, Lipshitz HD. 1993. Dynamic Hsp83 RNA localization duringDrosophila oogenesis and embryogenesis. Mol Cel Biol 13:3773–3781.

Feder ME, Hofmann GE. 1999. Heat-shock proteins, molecular chaperones, and the stress

response: evolutionary and ecological physiology. Annu Rev Physiol 61:243–282.

Fletcher BS, Kapatos ET. 1983. The influence of temperature,diet and olive fruits on thematuration rates of female olive flies at different times of the year. Ent Exp Appl33:244–252.

Gore JC, Schal C. 2005. Expression, production and excretion of Blag1, a major humanallergen, in relation to food intake in the German cockroach, Blattella germanica. Med VetEntomol 19:127–134.

Gruntenko NE, Bownes M, Terashima J, Sukhanova M, Raushenbach IY. 2003. Heat stressaffects oogenesis differently in wild-type Drosophila virilis and a mutant with altered juvenilehormone and 20-hydroxyecdysone levels. Insect Mol Biol 12:393–404.

Hartl FU, Hayer-Hartl M. 2002. Molecular chaperones in the cytosol: from nascent chain tofolded protein. Science 295:1852–1858.

Hoffmann AA. 1995. Acclimation: increasing survival at a cost. Trends Ecol Evol 10:1–2.

Hoffmann AA, Sørensen JG, Loeschcke V. 2003. Adaptation of Drosophila to temperatureextremes: bringing together quantitative and molecular approaches. J Therm Biol28:175–216.

Howe RW. 1965. A summary of estimates of optimal and minimal conditions for populationincrease of some stored product insects. J Stored Prod Res 1:177–184.

Huang LH, Kang L. 2007. Cloning and interspecific altered expression of heat shock protein

genes in tow leafminer species in response to thermal stress. Insect Mol Biol 16:491–500.

Huang LH, Chen B, Kang L. 2007. Impact of mild temperature hardening on thermotolerance,

fecundity, and Hsp gene expression in Liriomyza huidobrensis. J Insect Physiol 53:1199–1205.



Inoue T, Hirata K, Kuwana Y, Fujita M, Miwa J, Roy R, Yamaguchi Y. 2006. Cell cycle control bydaf-21/Hsp90 at the first meiotic prophase/metaphase boundary during oogenesis inCaenorhabditis elegans. Dev Growth Differ 48:25–32.

Koehn RK, Bayne BL. 1989. Towards a physiological and genetical understanding of theenergetics of the stress response. Biol J Linn Soc Lond 37:157–171.

Kovac M, Groeneveld E. 1990. Genetic and environmental trends in german swine herd bookpopulations. J Anim Sci 68:3523–3535.

Liu YH, Ye GY, Li XH. 2006. The effect of different temperature on ovarian development andoogenesis of Telenomus theophilae Wu Et Chen (Hymenoptera: Scelionidae). Nat EnemiesInsects 28:126–131.

Mahroof R, Subramanyam B, Flinn P. 2005a. Reproductive performance of Tribolium castaneum(Coleoptera: Tenebrionidae) exposed to the minimum heat treatment temperature aspupae and adults. J Econ Entomol 98:626–633.

Mahroof R, Yan ZK, Neven L, Subramanyam B, Bai J. 2005b. Expression patterns ofthree heat shock protein 70 genes among developmental stages of the red flour beetle,Tribolium castaneum (Coleoptera: Tenebrionidae). Comp Biochem Physiol part A141:247–256.

Marinotti O, Nguyen QK, Calvo E, James AA, Ribelro JMC. 2005. Microarray analysis of genes

showing variable expression following a blood meal in Anopheles gambiae. Insect Mol Biol

14:365–373.

Marone M, Mozzetti S, Ritis DD, Pierelli L, Scambia G. 2001. Semiquantitative RT-PCR analysisto assess the expression levels of multiple transcripts from the same sample. Biol ProceedOnline 3:19–25.

Mitchell HK, Moller G, Peterson NS, Lipps-Sarimento L. 1979. Specific protection fromphenocopy. induction by heat shock. Dev Genet 1:181–192.

Neuer A, Spandorfer SD, Giraldo P, Jeremias J, Dieterle S, Korneeva I, Liu HC, Rosenwaks Z,Witkin SS. 1999. Heat shock protein expression during gametogenesis and embryogenesis.Infect Dis Obstet Gynecol 7:10–16.

Neuer A, Spandorfer SD, Giraldo P, Dieterle S, Rosenwaks Z, Witkin SS. 2000. The role of heatshock proteins in reproduction. Hum Reprod Update 6:149–159.

Neupert W. 1997. Protein import into mitochondria. Annu Rev Biochem 66:863–917.

Nollen EA, Morimoto RI. 2002. Chaperoning signaling pathways: molecular chaperones asstress-sensing ‘heat shock’ proteins. J Cell Sci 115:2809–2816.

Ohsako S, Bunick D, Hayashi Y. 1995. Immunocytochemical observation of the 90 KD heatshock protein (HSP90): high expression in primordial and pre-meiotic germ cells of maleand female rat gonads. J Histochem Cytochem 43:67–76.

Parsell DA, Lindquist S. 1994. Heat shock proteins and stress tolerance. I: Morimoto RI,Tissieres A, Georgopoulos C, editors. The biology of heat shock proteins andmolecular chaperones. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.p 457–494.

Saxena BP, Sharma PR, Thappa RK, Tikku K. 1992. Temperature induced sterilization forcontrol of three stored grain beetles. J Stored Prod Res 28:67–70.

Schonbaum CP, Perrino JJ, Mahowald AP. 2000. Regulation of the vitellogenin receptor duringDrosophila melanogaster oogenesis. Mol Biol Cell 11:511–521.

Sørensen, JG., Kristensen, Loeschcke, V. 2003 The evolutionary and ecological role of heatshock proteins. Ecol Lett 6:1025–1037.

Thomas W, Sappington PH, Koller CN, Raikhel AS. 1998. Activation in vitro ofvitellogenin uptake by the oocytes of the mosquito, Aedes aegypti. Physiol Entomol23:158–164.



Trauner J, Buning J. 2007. Germ-cell cluster formation in the telotrophic meroistic ovary ofTribolium castaneum (Coleoptera, Polyphaga, Tenebrionidae) and its implication on insectphylogeny. Dev Gene Evol 217:13–27.

Tzanakakis ME, Koveos DS. 1986. Inhibition of ovarian maturation in the olive fruit fly underlong photophase and an increase of temperature. Ann Ent Soc Am 79:15–18.

Vollmer J, Sarup P, Kaersgaard CW, Dahlgaard J, Loeschcke V. 2004. Heat and cold-inducedmale sterility in Drosophila buzzatii: genetic variation among populations for the duration ofsterility. Heredity 92:257–262.

Wang H, Kazemi-Esfariani P, Benzer S. 2004. Multiple-stress analysis for isolation of Drosophilalongevity genes. Proc Natl Acad Sci USA 101:12610–12615.

Yang RS, Dao XF, Yang FL. 2007. Micro-Measurement by Photoshop software. Res ExplorationLab 26:56–58.

Ye GY, Hu C, Gong H. 2000. Effect of high temperature on ovarian growth and development inthe Japanese oak silkworm, Antheraea yamamai (Lepidoptera: Sat-uriidae), a precioussilkworm. Acta Ecol Sinica 20:490–494.

Yoo KL, Soon HK, Choo BH. 1998. Heat-shock protein 90 may be involved in differentiation ofthe female gametophytes in Griefithisa japonica (ceramiales, rhodophyta). J Phycol34:1017–1023.

Yue L, Timothy L, Karr DF, Nathan HS, Shaila S, Lindquist S. 1999. Genetic analysis of viablehsp90 alleles reveals a critical role in Drosophila spermatogenesis. Genetics 151:1065–1079.



Documents

Effects of heat shock on ovary development and hsp83 expression in Tribolium castaneum (Coleoptera: Tenebrionidae)