Efficient Site-Specific Cleavage by RNase MRP Requires Interaction

MOLECULAR AND CELLULAR BIOLOGY, May 1990, p. 2191-2201 Vol. 10, No. 50270-7306/90/052191-11$02.00/0Copyright C) 1990, American Society for Microbiology

Efficient Site-Specific Cleavage by RNase MRP Requires Interactionwith Two Evolutionarily Conserved Mitochondrial RNA Sequences

JEFFREY L. BENNETT AND DAVID A. CLAYTON*Department ofDevelopmental Biology, Stanford University School of Medicine, Stanford, California 94305-5427

Received 13 November 1989/Accepted 10 January 1990

RNase MRP is a site-specffic endonuclease that processes primer mitochondrial RNA from the leading-strandorigin of mitochondrial DNA replication. Using deletional analysis and saturation mutagenesis, we havedetermined the substrate requirements for cleavage by mouse mitochondrial RNase MRP. Two regions ofsequence homology among vertebrate mitochondrial RNA primers, conserved sequence blocks II and Ill, werefound to be critical for both efficient and accurate cleavage; a third region of sequence homology, conservedsequence block I, was dispensable. Analysis of insertion and deletion mutations within conserved sequenceblock II demonstrated that the specificity of RNase MRP accommodates the natural sequence heterogeneity ofconserved sequence block II in vivo. Heterologous assays with human RNase MRP and mutated mousemitochondrial RNA substrates indicated that sequences essential for substrate recognition are conservedbetween mammalian species.

Infectious agents and their cellular hosts use RNA pro-cessing to control key steps in their growth, replication, anddifferentiation. A special subset of these reactions share aunique common denominator: they require one or moreessential RNAs for catalysis. The function of essentialRNAs in cellular processes spans a large continuum, rangingfrom enzymatic catalysis (41) to the determination of sub-strate specificity (29). For self-splicing RNAs (see reference8 for review) and the RNA component ofRNase P (reviewedin references 1 and 30), catalysis can occur in vitro in theabsence of protein; however, for events such as pre-mRNAsplicing (34) and histone pre-mRNA 3'-end formation (6), invitro catalysis requires the presence of both RNA andprotein components.The biochemical dissection of group I and group II self-

splicing introns, self-cleaving virusoid RNAs, and RNase Phas provided a detailed picture of the mechanisms throughwhich RNA can promote specific and efficient catalysis. Themost common and straightforward of these mechanisms isRNA-RNA base pairing. RNA-RNA base pairing determinesthe specificity of group I intron self-splicing (5, 38), group Iintervening sequence (IVS)-catalyzed transesterification re-actions (24, 40, 41), group II intron self-splicing (25, 28), andvirusoid RNA cleavage in cis (14, 15) and in trans (20, 36). Amore complex mechanism than Watson-Crick base pairing,however, is employed by RNase P for the specific recogni-tion of pre-tRNA substrates. Analysis of RNase P cleavageon mutant pre-tRNAs indicates that the specificity of theenzyme is not dependent simply on duplex formation be-tween pre-tRNA and the RNA component of RNase P (3)but rather on the recognition of conserved elements withinthe tertiary structure of the pre-tRNA substrate (7, 17).Examinations of RNase P cleavage on non-tRNA substratessuch as turnip yellow mosaic virus RNA, 4.5S RNA, andmodel synthetic RNA substrates have shown that productivesubstrate recognition requires the presence of a minimalRNA tertiary structure similar in conformation to the accep-tor stem and T stem and loop of mature tRNAs (19, 27).RNase MRP (for mitochondrial RNA processing) is a

site-specific endonuclease containing an essential RNA com-

* Corresponding author.

ponent (11). RNase MRP cleaves RNA transcripts at thedisplacement-loop (D-loop) region of mammalian mitochon-dria, potentially forming RNA primers for the initiation ofleading (heavy)-strand DNA replication (10). The endonu-clease activity is present in both the nucleus and mitochon-dria of mammalian cells, and its RNA component is anucleus-encoded transcript whose sequence and structurehave been conserved between human and mouse (12, 16).Recently, antibodies from a series of autoimmune patientswere found to immunoprecipitate RNase MRP RNA (16).RNase MRP RNA coprecipitated specifically with Hi RNA(the RNA component of human RNase P [4]), indicating thatin mammalian cells RNase MRP and RNase P probably havea common antigenic epitope.The mitochondrial RNA (mtRNA) substrate for RNase

MRP contains three short regions of sequence that are highlyconserved in most vertebrate species (conserved sequenceblocks [CSBs] I, II, and III [37]). The initial characterizationof the endonuclease activity indicated that the site-specificcleavage of mtRNA substrate in vitro occurred adjacent toCSB II; therefore, it was suggested that CSB II might play arole in guiding the specificity of RNase MRP cleavage (10).We have conducted a comprehensive mutagenesis of themtRNA substrate of RNase MRP. The results obtainedpermit the description of the substrate requirements forprecise and efficient cleavage of mtRNA by RNase MRP.CSB I is not required for endonuclease cleavage; however,CSB II and an upstream sequence element, CSB III, areessential. Oligonucleotide-directed inhibition ofRNase MRPactivity indicates that CSB II and CSB III constitute aunique bipartite recognition signal critical for cleavage bythe endonuclease. The assignment of an RNA-processingfunction to these conserved elements is the first such exam-ple for vertebrate mitochondria, and the specificity of RNaseMRP is discussed in the context of its conservation acrossmammalian species and its potential role in determining CSBII sequence heterogeneity in vivo.

MATERIALS AND METHODSReagents. Restriction endonucleases, SP6 RNA polymer-

ase, T4 DNA ligase, and RNase H were from BethesdaResearch Laboratories, Inc. Radioisotopes, cytidine-3',5'-

2191

2192 BENNETT AND CLAYTON

Saturation Mutagenesis 60% for the degenerate oligonucleotides and 70 to 90% forthe nondegenerate oligonucleotides.3-7 5'-AA ITAAC CCcX.TC-3' In vitro transcription of substrate RNA. Control mtRNA

13-17 5'-CCCCCACRRRRSCACC CTA-3' substrate was transcribed from plasmid pMR718B with SP618-22 5'-ACCCCCTRRSRSTAATGCC-3' RNA polymerase, 3'-end labeled with [32P]pCp and gel23-27 5'-CcCCrCWWSRCCAAACC-3r purified as described previously (10).33-32 5'-TAATGCCAAARRRRWAAAACACTAA-3' Mutated mtRNA substrate was transcribed directly from33837 5'-CCAACCCCAARWWWWcAAGAACT-3' M13 phage DNA which was made double-stranded and

5'-ACrCrCCXAACCCX-3' linear by the following procedure. Single-stranded phageCr<CrCCACAOCCflC-3' DNA (-3 ,ug) and 5 pmol of M13 sequencing primer (17-mer;

5'Cr0CAAAGCC0CCAC-3' Bio-Rad Laboratories) were hybridized in 1 x Klenow buffer5'-c2CCrCCrUITAATtIC-3'(10 mM Tris hydrochloride [Tris-HCl; pH 7.5], 5 mM MgCl2,

W=A/C R=G/C S=G/T V=AIr (1/1 ratio) 10 mM dithiothreitol [DTT]) by heating to 70°C and slowcooling to room temperature. dNTPs and lOx Klenow buffer

Filter Hybridization were added to a final concentration of 1 mM each and lx,respectively. The reaction was initiated by the addition of 1

5S-C=rCCACAAT3CCACT3' U of Klenow fragment, and polymerization continued for 1.5Y-SCxwAAACsCC!CCACWCCx-3h at 37°C. DNA was then digested with XbaI and HindIll,M5'-CrrAATGCCAAACCCCAAA-3' and the resulting fragment was isolated from agarose gels,5i-GCCAAACCCCAAAAACACIAAG-3' ethanol precipitated, and resuspended in an appropriateOligonucleotideComiletition volume for in vitro transcription. 5'-End-labeled mutated

RNA transcripts were made by run-off transcription with/CSB 3 SUTAC rrAU[T G CTAAGA SP6 RNA polymerase in a 20-,I volume under the followingGGAGGGGGTGGGGGUITrGGAGAcTITAT-3 reaction conditions: 40 mM Tris-HCI (pH 7.9), 6 mM MgCl2,I 5-GGAGCCCTTIGGGGGTTOrCA-3' 2 mM spermidine-[HCI]3, 1 U of RNAguard per RI, 100 ,CiL 5'-AGCTIGCCAAACCCCAAAAACA-3' of [,y-32P]GTP (>1,500 Ci/mmol), 500 ,M each CTP, UTP,

1. Categories and sequences of oligonucleotides used in and ATP, 6.6 ,uM GTP, and 15 U of SP6 RNA polymerase.tudy. Transcriptions were performed for 1 h at 37°C, unincorpo-

rated nucleotides were removed in a G-50 spin column, andthe transcript was purified by acrylamide gel electrophore-

)isphosphates, [y-32P]ATP, and Klenow fragment were sis.iased from Du Pont-New England Nuclear Corp. [-y- RNase MRP purification. Glycerol gradient-purified frac-rTP (>1,500 Ci/mmol) was from ICN Radiochemicals, tion I mouse mitochondrial RNase MRP (10) was usedRNase T1 was from Sankyo, and T4 RNA ligase, T4 throughout this study. Briefly, fraction I RNase MRP waspolymerase, RNAguard, T4 polynucleotide kinase, diluted 1:1 in buffer A (20 mM Tris-HCl [pH 8], 1 mM

nucleoside triphosphates were from Pharmacia, Inc. EDTA, 1 mM DTT, 10% glycerol), and 200 ,ul (-600 p.g) wasrial strains CJ236 (dut ung thi relA) and MV1190 were layered onto a 4-ml 10 to 30% glycerol gradient (buffer A plusned from Bio-Rad Laboratories (Muta-Gene in vitro 50 mM KCl). Gradients were centrifuged at 60,000 rpm for 5genesis kit). h at 4°C in an SW60Ti rotor and fractionated from thegonucleotides. Deoxyoligonucleotides were synthesized bottom, and active MRP fractions were pooled, divided intoperon Technologies, Inc. (Alameda, Calif.) or the portions, and stored at -70°C.rtment of Biology, University of Michigan. The cate- RNase MRP assays. Assays of RNase MRP activity weres and sequences of the various oligonucleotides used in performed as described previously (10) except that reactionstudy are shown in Fig. 1. were for 1 h at 37°C and -1 ,ug of glycerol gradient-purifiedtagenesis. 5' and 3' Bal 31 deletion mutations were RNase MRP was used per reaction. For the analysis oftesized as described previously (9). Prior to in vitro mutated mtRNA substrates, RNase MRP assays employedcription, the deletion mutations were further subcloned both mutated and wild-type substrates (2,500 cpm each),der to produce RNA transcripts with 5' and 3' mito- wild-type mtRNA substrate providing the internal control.drial sequences equivalent to those of the wild-type RNase MRP assays were performed under conditions of4A substrate pMR718B (10). 3' Bal 31 deletions were enzyme excess, and RNase MRP cleavage sites wereed with RsaI and HindIII, and the resulting fragment mapped by comparison with an enzymatic sequence laddering from 84 to 191 nucleotides) was introduced into (10).

SmaI-HindIII-digested pSP65. For in vitro transcriptionwith SP6 RNA polymerase, 3' deletion subclones weredigested with PvuII.

Saturation mutagenesis was conducted on mpl9MR718SP6, an M13 phage DNA constructed by inserting theSphI-XbaI fragment of pMR718B containing the SP6 pro-moter and the mitochondrial D-loop insert into M13mpl9.Uracil-containing phage DNA was prepared in Escherichiacoli CJ236 as described by Kunkel et al. (26), and in vitromutagenesis was performed with the Muta-Gene in vitromutagenesis kit. M13 plaques were screened by filter hybrid-ization (39), and the mutated phage DNA was subsequentlyisolated and sequenced by the dideoxy chain terminationmethod (33). The efficiency of in vitro mutagenesis was 25 to

RESULTS

Deletion of CSB II precludes RNase MRP cleavage in vitro.Essential sequences for RNase MRP cleavage in vitro wereinitially identified by examining RNase MRP activity ontruncated RNA templates (Fig. 2A). Deletion mutationsextending across the mouse mitochondrial D-loop region (9)were subcloned into plasmid vector pSP65 and transcribedwith SP6 RNA polymerase in vitro, and the resulting tran-scripts were tested for cleavage with RNase MRP. The effectof progressive 3' deletions on RNase MRP cleavage is shownin Fig. 3. Deletion of CSB I and additional mitochondrialsequences downstream of CSB II had little or no effect on

WOB 3WOB EWOB 1WOB IWOB 2WOB 2WOB3WOB3M2GM3GM5CM21C

SCR-1SCR-2SCR-3SCR-4SCR-S

CSB 2VCSB 21CSB 31CSB 31FIG

this st

[32p]1purch32PIGInc. IDNAand r

Bacteobtaiimutal

Oli,by CDepaigorierthis sMu

synthtrans(in or(choncmtRIScleav(rangi

MOL. CELL. BIOL.

SUBSTRATE RECOGNITION BY RNase MRP 2193

(A) Deletion Analysis

pS'4 3'

ps'il "I _ 3'p5'27 III3'

p5'l13 3I 3

~~~~~~3'

31 ni-la --I--~~p3'75S. EN I _ p

S' II-1I3 I p3'265' =I5' p'4

se- pV.4

(B) Saturation Mutageneuis

I

-6-*11- I:3~ 3'

5@ __13 = 3@

FIG. 2. Strategy for mutagenesis of the mtRNA substrate. (A)Deletion mutations of the mtRNA substrate. Open boxes representthe three CSBs near the mitochondrial D-loop, CSB I, CSB II, andCSB III. The three vertical arrows depict the major cleavage sites ofRNase MRP. The wild-type substrate shown in the center repre-sents 239 nucleotides ofmtRNA sequence (genomic positions 16,216to 15,978 [9]); not shown are 25 nucleotides of 5' pSP65 vectorsequence. The names of the various deletion clones indicate theamount of mitochondrial sequence remaining either 5' or 3' of themiddle RNase MRP cleavage site; this site is 124 nucleotides 5' fromthe 3' end of the wild-type substrate. Not shown for the 3' deletionsis the 184 nucleotides ofpSP65 vector sequence at the 3' termini. (B)Schematic representation of saturation mutagenesis of the D-loopRNA substrate. Mutagenesis was performed as described in Mate-rials and Methods and extended over the region encompassing CSBII, CSB III, and their intervening sequence. Solid lines with aster-isks depict some of the various oligonucleotide primers used in themutagenesis. The bars represent oligonucleotides, and the asterisksdenote altered bases (one or two) within them.

RNase MRP activity (Fig. 3, lanes 1 to 10); however,elimination of CSB II (Fig. 2A, p3'-4) resulted in completeloss of cleavage activity (Fig. 3, lane 12).

Progressive deletions proceeding from the 5' end of theRNA substrate resulted in extremely low levels of RNaseMRP cleavage independent of the amount of deleted mito-chondrial sequence (data not shown). Although some RNaseMRP activity was evident for 5' deletions that spared CSBIII (Fig. 2A), the efficiency of cleavage for each of thesesubstrates was quite low. We interpreted these results toindicate that RNase MRP is sensitive to alterations in theconformation of the substrate RNA. Whether some generalfeature of RNA secondary structure was recognized byRNase MRP or whether RNA conformation secondarilyaffects the accessibility of primary sequence elements criti-cal for substrate recognition is a difficult distinction to make;however, additional experiments appeared to favor the latterof these two hypotheses (see below).

Point mutations in CSBs II and IH affect the efficiency and

I-' 4 5 -h 'i il _:

_ _

. 16.: .4V4~~~~~~~~~~~.!:

FIG. 3. RNase MRP cleavage of 3' deletion substrates. RNaseMRP cleavage assays were performed with either 3'-end-labeledwild-type RNA substrate (lanes 1 and 2) or 5'-end-labeled deletionsubstrate (lanes 3 to 12), and the products were analyzed in a 6%polyacrylamide-7 M urea gel. Odd-numbered lanes, No enzyme;even-numbered lanes, RNase MRP. Lanes 1 and 2, wild type; lanes3 and 4, p3'75; lanes 5 and 6, p3'53; lanes 7 and 8, p3'28; lanes 9 and10, p3'15; lanes 11 and 12, p3'-4. Solid and open triangles indicatethe RNase MRP cleavage products of the wild-type and deletionmutant substrates, respectively.

accuracy of RNase MRP cleavage in vitro. Since deletion ofCSB I had no effect on endonuclease activity, saturationmutagenesis within CSB II and upstream mitochondrialsequences was initiated in order to investigate the impor-tance of individual nucleotides for accurate and efficientcleavage by RNase MRP. With a set of nested degenerateoligonucleotides, site-directed mutagenesis of the substrateRNA was conducted so that each nucleotide in the regionencompassing CSB II and CSB III could be mutated bothindividually and in combination with its nearest neighbors.Degenerate oligonucleotides consisted of a mix of 32 dif-ferent oligomers created by synthesizing a single DNAoligonucleotide whose five central positions were filled ran-domly by one of two possible nucleotides, a wild-typenucleotide, or a mutagenic nucleotide whose insertion wouldbe disruptive to any potential Watson-Crick base pairingoccurring at that position. With this procedure, 60 individualand multiple-point mutations were isolated, saturating the42-nucleotide region extending from the 3' end of CSB II tothe 5' end of CSB III (Fig. 2B). The mutation clones weresubsequently sequenced and transcribed with SP6 RNApolymerase, and the resulting 5'-end-labeled mutated RNAswere analyzed for cleavage by RNase MRP in the presenceof a 3'-end-labeled wild-type RNA as an internal control (seeMaterials and Methods).An analysis of RNase MRP cleavage activity on a sample

of these point-mutated substrates is displayed in Fig. 4A toD. Mutations in CSB III as well as CSB II severely inhibitedRNase MRP activity, whereas mutations in the sequencebetween these two regions had little or no effect on cleavageactivity (Fig. 4, compare panels B and D with panel C).Alternatively, some mutations in CSB II and adjacent se-quences resulted in enhanced cleavage by RNase MRP (Fig.4A, 21C+; Fig. 4B, 16C+). Since cleavage of the 3'-end-labeled wild-type substrate remained unchanged in thepresence or absence of 5'-end-labeled substrate, the differ-ential effect of mutations inside and outside of CSB II andCSB III cannot be attributed to differences in competitionbetween 3'-end-labeled wild-type substrate and 5'-end-la-beled mutated substrate (Fig. 4A, compare lanes WT+ and

VOL. 10, 1990


aI-hIMIIIImII

_ I. e 4^,t

&.. ,

* - s *_~~7

AS

.A

so_4, a

w ib -

so_ m_

IC). Therefore, CSBs II and III represent independentelements critical for RNase MRP cleavage in vitro.Although mutations affecting RNase MRP cleavage ap-

peared to be concentrated within CSBs II and III, mutationsin the small stretch of nucleotides between CSBs II and III,containing the adjacent 5 bases composing the cleavage site

0 of RNase MRP, also affected endonuclease activity (Fig. 4A,lane 21C+; Fig. 4C, lanes 18C+, 19C+, and 18C19C+).Interestingly, these mutations had a greater influence on theaccuracy of RNase MRP cleavage than on its efficiency. Thiscombined effect, however, was not limited to nucleotidechanges in and around the cleavage sites of the endonucle-ase. Closer examination of the cleavage products of variousmutations within CSB II and CSB III indicated that specificnucleotides in these regions were also capable of affectingthe accuracy of the mitochondrial activity (for example, Fig.4B and D, lanes 13C+ and 38G41G+, respectively). In aneffort to decipher the relationship between individual nucle-otides and RNase MRP cleavage site selection, cleavagesites were mapped to the nucleotide level for each of thepoint-mutated RNA substrates.Two major types of effects on cleavage site selection were

produced by mutations in the mtRNA substrate (Fig. 5). Thefirst, and most common, was a change in the relativedistribution of the RNase MRP cleavage sites. In theseinstances, the probability of hydrolysis at one or more of thefive sites of cleavage was either increased or decreasedwithout the accompanying scission of additional phospho-diester bonds (Fig. 5, mutants 13C, 16C, and 17C). Thesecond, and more unusual, consequence was the appearanceof a novel site of RNase MRP cleavage (Fig. 5, mutant 14C).In the analysis of all mutated substrates isolated to date, thegeneration of a new site of RNase MRP cleavage hasoccurred only upon mutation of the guanosine at position 14(see Fig. 6 for orientation). However, mutation at thisposition was not sufficient for a shift in RNase MRP cleav-

MP age, since hydrolysis of the additional phosphodiester bondwas not observed with mutant 14C16C. A summary of all

* point-mutated RNA substrates, detailing both their level ofcleavage by RNase MRP and the distribution of their RNaseMRP cleavage sites, is given in Fig. 6.CSBs II and III constitute a specific bipartite recognition

element for RNase MRP. Since the results of saturationmutagenesis indicated that both CSB II and CSB III werecritical for RNase MRP cleavage, we examined the potentialfunctional independence of these two conserved sequenceelements in RNase MRP substrate recognition. To address

: I:. .

FIG. 4. RNase MRP cleavage analysis of point-mutated mtRNAsubstrates. In vitro cleavage reactions were conducted as describedin Materials and Methods; each reaction contained both 3'-end-labeled wild-type substrate RNA as an internal control and 5'-end-labeled mutated RNA. Denoted above each lane is the mutatedRNA substrate present; the presence or absence of RNase MRP ismarked by + or - signs, respectively. Nomenclature for mutatedsubstrates denotes the base(s) that is altered in the RNA substrate;

base position numbers are those indicated at the top of Fig. 6. Forexample, 14C16C is a substrate in which there are two transversions(from G to C) at positions 14 and 16. Solid and open trianglesidentify the RNase MRP cleavage products of 3'-end-labeled wild-type and 5'-end-labeled mutated substrate RNAs, respectively. Thelevel of RNase MRP activity on each mutated RNA substrate wasquantitated by assay of radioactivity in individual gel slices by liquidscintillation spectrometry. (A) Mutated RNAs encompassing CSBsII and III and their intervening sequence. Abbreviations: M, HpaII-digested pBR322 size markers; WT, 5'-end-labeled wild-type sub-strate RNA; IC (internal control), 3'-end-labeled wild-type substratealone. (B) In vitro cleavage products of point mutations within CSBII. (C) In vitro cleavage products of point mutations within theregion between CSBs II and III. (D) In vitro cleavage products ofpoint mutations within CSB III. (E) In vitro cleavage products ofinsertion and deletion mutations within CSB II. Mutated RNAs arenamed according to their respective sequences within CSB II (wildtype is G5UG6 [5'-GGGGGUGGGGGG-3']).

MOL. CELL. BIOL.

I -1. 'f

1 7 7 , 7, 7,

.- C -1 :r- -


I2. V!. f ..

.. OH-Ti+0

OH -

TlI

I

'2 VYTV I?

ir

-2 v Ty V

f'A

OH -

Ti.

tn>. n

t

nt-nnn"2 ___

S

n-0 nr T y v v '

1-

S;o_ _ _ _ _ _ _

VOL. 10, 1990

OH -

Ti+

OH -

Ti+

_-

0-

Cs. III vI4l1 Cs. 11

5'.UGUUUUUGGGGUUUGGCAUUAAGAGGAGGGGGUGGGGGGUUU-3'* - - 40 * * 0 0 35 * - -- 30 * v - - 25 S * * - 20 * * - - 15 * - * - 10 * . * * 5 ..

VTCI GE MUTANI ACTIV1I3 CLXf&GE20

32

SC

ST20C

5026C

SC2SC

STISC19C22C

CI2SC

Sc

9C2SC

10A

IOA20C

IOCIIA

IIA

13C14C

14C

14CISC

14C1 SC

I 0.*

2

2

2

2

I 0 * .

2

1i2

* * *

S..0

U

21 *4

111.2

1.2

197+14

2 1w

1.2

U1I

40

407C

SC26C

11A26C

12C

13C

13C17C

IsciSC

ISC17C

lSC

lScl9c

1SC2SC

1SC

310

33C

36C370

3

2 Ut3+3X

3

3

24 414~~~~~h~14+13

349A4~149A

13C1SC

13C1IC

16C

17C

1I C21 C

20C

20C26C

21C

SD21C

22C

22C26C

23C

23C250

240

26C

2MC27

OSUQ7

OSUOS

_S4

u.s,w444S IV5.5, 1445 Au5974U~~~~~~5 w AWUAU5AU5q

I4UtlwWAUlwl

1sc

29C 2 e* .

2

1 * * .

2 4.-11 * * .

1 * * .

122

FIG. 6. Summary of mutational analysis. Mutated mtRNA substrates were classified into three groups based on their efficiency of cleavageby RNase MRP. The level of RNase MRP activity on each mutated substrate was quantitated by assay of radioactivity in individual gel slicesand subsequently assigned a score ranging from 1 to 5, with the activity of RNase MRP on wild-type substrate given a value of 5. Group Amutants have little to no activity (1 to 2; 0 to 39o of wild type); group B mutants have medium activity (3 to 4; 40 to 79% of wild type); andgroup C mutants have high to enhanced activity (5 to 5+; 80 to 120% of wild type). The cleavage pattern of RNase MRP on each mutatedRNA is represented by a series of arrows, the heights of which denote the relative probability of cleavage at that particular phosphodiesterbond (*** indicates mutated RNAs whose cleavage sites could not be determined unambiguously). Across the top of the figure is a schematicillustrating a portion of the sequence of the mtRNA substrate. Overlines demarcate CSB II and CSB III, and arrows identify the cleavage sitesof RNase MRP. Below the sequence is the numbering scheme used to name the various mutations generated in this study (e.g., 2G denotesa transversion from U to G at position 2). 5D26C and 5D21C contain deletions of the guanosine at position 5. The nomenclature for mutantsG5UG5, G5UG7, and G5UG8 is described in the legend to Fig. 4E.

2196

300310

33C34C

350410

41042C

42C

aSUOS

ACTIVITY C4#tGrz


CSII 2H

= WIn r4IIC f4 - WI

2 .- -

0

In

CSB 3H

X,~~~~~~~~b0 In r~~~~~~C e*nf4 %

WI, es4 -~ so e, I

CSB 3L CSB 2 / CSB 3l~~~, WA WI WI_

o 0Ifl ff4 0 0 n

in In -- n II. O m In

'mniiiimi-nrnmm

e4 -

FIG. 7. Oligonucleotide-directed inhibition of RNase MRP cleavage. RNase MRP cleavage assays were performed in either the presenceor absence of competitor DNA oligonucleotide ranging in concentration from 500 to 3.13 nM. The sequence of each oligonucleotide is of thesame strand as the substrate RNA except for CSB 3L, which contains the sequence of the strand complementary to the RNA substrate. Theoligonucleotides contain either the sequence of CSB II (CSB 2H), CSB III (CSB 3H and CSB 3L), or CSB II, CSBIII, and their interveningsequence (CSB 2/CSB 3) (detailed sequences are given in Fig. 1). CSB 2H also encompasses the 3 adjacent bases at the cleavage site; CSBs3H and 3L contain 4 additional 5' bases for cloning purposes. The concentration of RNA substrate in each competition experiment wasapproximately 0.03 nM. -MRP, no enzyme; -OLIGO, no competitor oligonucleotide. The solid triangle identifies the RNase MRP cleavageproduct.

this question, the ability of various DNA oligonucleotides toinhibit RNase MRP cleavage of wild-type mtRNA substratewas analyzed. Oligonucleotides CSB 2H and CSB 3H, whichcontain the sequences of CSB II and CSB III, respectively,were found to inhibit RNase MRP cleavage by 30% atoligonucleotide concentrations approaching 12.5 nM (Fig. 7,CSB 2H and CSB 3H). In comparison, oligonucleotidespreviously shown to inhibit RNase MRP activity noncom-petitively through interaction with the RNA component ofthe endonuclease required concentrations of 3 puM toachieve cleavage inhibition (11). No inhibition was foundwith an oligonucleotide complementary to the sequence ofCSB III in the RNA substrate (Fig. 7, CSB 3L).When CSB II and CSB III and their intervening sequence

were placed on a single oligonucleotide, a marked increase incleavage inhibition occurred; oligonucleotide-directed inhi-bition was 80% at the lowest inhibitor concentration tested,3.13 nM (Fig. 7, CSB 2/CSB 3). No inhibition occurred witha nonspecific oligonucleotide of similar length at concentra-tions as high as 68 nM (data not shown). The augmentedinhibition of RNase MRP cleavage following the linearcombination of CSB II and CSB III on the same oligonucle-otide could be due to either cooperative binding of the twosequence elements or increased stability of the resultingduplex with RNase MRP RNA. RNase H digestion experi-ments revealed no interactions between the inhibitory oligo-nucleotides and the mtRNA substrate (data not shown).

Several aspects of the experimental data suggest that the

interaction between RNase MRP and substrate RNA occursat the level of primary sequence. First, oligonucleotideinhibition of RNase MRP cleavage is both dependent onspecific sequences in CSB II and CSB III (Fig. 7, compareoligonucleotides CSB 3H and CSB 3L) and competitive withmtRNA substrate (data not shown). Second, analysis of thesecondary conformation of the mtRNA substrate undercleavage assay conditions indicates that the 5' half of CSBII, nucleotides surrounding the RNase MRP cleavage sites,and the 3' portion of CSB III are single-stranded (data notshown). Therefore, point mutations, at least at these posi-tions, are unlikely to decrease RNase MRP activity bydisrupting RNA substrate conformation. Third, examinationof oligonucleotide CSB 2/CSB 3 by nondenaturing gel elec-trophoresis indicates that the oligonucleotide does not forma hairpin duplex structure (data not shown). Hence, ifRNaseMRP were to recognize a specific feature of the secondarystructure of the RNA substrate, this feature would not berecapitulated in the inhibitory oligonucleotide CSB 2/CSB 3.RNase MRP is sensitive to length polymorphism in CSB II.

mtDNA sequence heterogeneity has been documented inboth mammalian tissue and tissue culture cell sources (22,23). In each instance, length polymorphism was exhibited bya single homopolymer sequence within CSB II (correspond-ing to Fig. 6, nucleotides 5 to 10). In human tissue culturecells, this homopolymer sequence varies from 8 to 12 nucle-otides in length, the mode being 9 (22). Different sources ofhuman placental tissue maintain several different sizes for

A-

M

VOL. 10,1990


Analogous studies examining RNase MRP cleavage siteselection have produced results consistent with those notedabove; exact cleavage site selection was found to be inde-pendent of the source of RNase MRP (data not shown).

FIG. 8. Human and mouse RNase MRP activity on mutatedmtRNA substrates. RNase MRP cleavage reactions were performedas described in Materials and Methods with either human (H) ormouse (M) glycerol gradient-purified fraction I mitochondrial RNaseMRP. Solid and open triangles mark the cleavage products of3'-end-labeled wild-type and 5'-end-labeled mutated RNAs, respec-tively. Lane IC (internal control), 3'-end-labeled wild-type substratealone. The apparent decreased activity for both mouse and humanRNase MRPs on 5'-end-labeled wild-type mtRNA substrate was dueto the lower specific activity of that labeled RNA.

CSB II, with the variable homopolymer run numbering aslow as 7 nucleotides (2, 18). No analysis has demonstratedany length variation in the second homopolymer stretch ofCSB II (corresponding to Fig. 6, nucleotides 12 to 16).The sensitivity of RNase MRP to length polymorphism in

CSB II was examined by using insertion and deletion mu-tants constructed during site-directed mutagenesis of theRNA substrate. A limited set of length polymorphs of CSBII, ranging from 5 to 8 nucleotides, was examined forcleavage by RNase MRP (Fig. 4E). Substrate RNA contain-ing a homopolymer stretch of 5 nucleotides was not pro-cessed by RNase MRP (Fig. 3E, mutation G5UG5), whereassubstrates possessing homopolymer lengths of 6 or morenucleotides were cleaved efficiently (Fig. 3E, WT and mu-

tations G5UG7 and G5UG8). Since no mammalian mtDNAsequenced to date has possessed fewer than 6 nucleotides inthe variable homopolymer stretch of CSB II, RNase MRPmay be involved in determining the limits of CSB II lengthpolymorphism in vivo.

Substrate recognition by RNase MRP is conserved betweenmouse and human species. Heterologous assays mixing en-donuclease and RNA substrate from different organismshave illustrated that RNase MRP cleavage extends acrossspecies boundaries (10, 35). The extent of sequence conser-vation between CSBs II and III in human and mousemtDNAs (37) and the correspondingly high degree of homol-ogy among their respective nuclear DNA sequences forRNase MRP RNA (12, 16) suggest that interactions involvedin substrate recognition by RNase MRP will be preservedacross mammalian species. We have investigated this ques-tion directly by comparing the cleavage of point-mutatedmouse mtRNA substrates with both mouse and humanRNase MRP (Fig. 8). The results of these heterologousexperiments indicated that the overall effect of point muta-tions on RNase MRP activity was independent of the sourceof the endonuclease. Mutated substrates displayed eitherreduced (Fig. 8, 15C) or enhanced (Fig. 8, 13C16C) cleavageby RNase MRP irrespective of whether the endonucleasewas purified from mouse or human cells. Further analyses ofadditional point-mutated substrates yielded similar results.

DISCUSSION

CSBs II and III are necessary and sufficient for accurate andefficient cleavage by RNase MRP. Two CSBs of the verte-brate mitochondrial D-loop region were discovered to becritical for RNase MRP cleavage: CSB II and CSB III.Mutations in CSB II and CSB III independently affectedboth the accuracy and efficiency of the endonuclease (Fig. 6,groups A to C). The majority of mutations (42 of 60) resultedin reduced cleavage by RNase MRP. Over half of these weregrossly deficient in cleavage (Fig. 6, group A), while theremainder resulted in only moderate reductions in efficiency(Fig. 6, group B). Some mutations were characterized bytheir ability to enhance cleavage by RNase MRP (Fig. 6,mutations 13C16C, 16C, 18C21C, 21C, and 5D21C), whileothers resulted in altered sites of RNase MRP cleavage (Fig.6, mutations 13C14C, 14C, and 14C15C). While the majorityof mutations in CSB II and CSB III influenced RNase MRPactivity, only a few mutations in the nonconserved interven-ing sequence affected cleavage efficiency. These mutationsclustered in and around the sites of RNase MRP cleavage(Fig. 6, nucleotides 18 to 20), and they tended to affect theaccuracy more than the efficiency of the endonuclease (Fig.6, group B mutants 18C, 18C19C, and 19C). CSB I was notrequired for cleavage in vitro.CSBs II and III were first identified by comparison of

vertebrate mtDNA sequence information (37). Because oftheir high degree of conservation, they were speculated toplay some role in mitochondrial organelle biogenesis. Theexperiments reported here demonstrate that both elementsare functionally important in substrate recognition by RNaseMRP. Previous analyses of in vivo mtRNA species frommouse mitochondria have mapped the 3' ends of severallight-strand promoter transcripts to sequences in and aroundCSBs II and III (13). Since RNase MRP is currently the onlyvertebrate mtRNA-processing enzyme that has been char-acterized at the level of enzyme and its substrate, it remainsto be determined whether CSBs II and III are important forany other metabolic events.Enzymatic cleavage by RNase MRP encompasses several

distinct steps: substrate recognition, binding, cleavage, andproduct release. It is not unreasonable to expect that criticalsubstrate sequences and their structural consequences maybe important at any or all of these steps. Examination of thesequence of mouse RNase MRP RNA (12) indicates thatthere is a region in the midportion of the molecule that iscomplementary to both CSB II and CSB III in the mtRNAsubstrate and largely single-stranded in the intact ribonucle-oprotein particle (J. N. Topper and D. A. Clayton, submit-ted for publication). A potential interaction between thisregion of RNase MRP RNA and the mtRNA substrate ispresented in Fig. 9.

Mutations in CSB III were found to have a profound effecton the efficiency of cleavage by RNase MRP. The locationand extent of inhibition associated with each of these pointmutations are consistent with the extensive base-pairinginteraction depicted in Fig. 9. Mutations which disruptmultiple potential base pairs (30G31G, 33C34C, and38G41G) result in significant drops in cleavage efficiency,whereas mutations which disrupt single base pairs (31G,33C, and 26C) result in minimal reduction in endonuclease

ilmkimk- Z.11.-

pp-

To ..I.1.

MOL. CELL. BIOL.

%% 4 t '( 13C 14( R' 1 t)t R-11 r-------1 r-------I IT ....I

R\.i"L. NTRP. %I 11 - %I If - %I If %I H 'Ni H M 11


CA

CUCGACU

G200

A U GAC 220A C^A

GGC cc 240A A U IGUGCG GGCUCGCACCAAC CCGUGC UCGAGCG GGG CA /G CAC2 10C-GISOX CGA U CC~ISs-C-G

G COGc~ ~0C-GCC G

& \C_ CCUACUG0ACGC A ,260

AU

A cACAA G G cA U U.GG-C O-C

AUCCUU 60 C-GA u .1,GoG-C60 oGC

G U UCU C GAG-C IACA A A U C-GGUUCCU GCCU GG CGGGC GAGAGUGCUgI:

U III* III,i,iii II I I

AC AGI CGA U UUU C G CGCUCGA 0 A AAGu ApppGCAUAC I20 5

UAC-OH3,

I CSBII li- i I + I CSB I-I Ia a .UUUGGGGGGUGGGGGAGGAGAAUUACGGUUUGGGGUUUUUGU.aa

a a . .IUAGACUU CCCCCGCAAGUCACUGUUAGCCCGCCAAGAAG]. a a

5'

FIG. 9. Proposed interaction between RNase MRP RNA and mtRNA substrate. The schematic at the top depicts the secondary structureof mouse RNase MRP RNA (Topper and Clayton, submitted). The bracketed line depicts a proposed tertiary base-pairing interaction in theRNA structure. The boxed region in the RNA highlights the possible binding sequence for the mtRNA substrate. Base pairing between thesubstrate-binding sequence and the mtRNA substrate is shown in the enlarged sequence below. The positions of CSB II and CSB III areindicated, and the five arrows denote the sites of RNase MRP cleavage. CSB II nucleotide position 2 and CSB III nucleotide position 42 areshown (see Fig. 6).

activity. Two point mutations (29C and 42C), however, wereunique in their ability to result in large reductions in cleavageefficiency. The significant loss of activity associated withmutation 29C could be due to its central position within aduplex region at the 3' end of CSB III. Significant reductionsin cleavage efficiency have also been found with mutantsubstrates 28C and 28C29C (data not shown). Mutation 42C,which is cleaved at very low efficiency, is at the 5' terminusof CSB III and is not obviously critical for base-pairinginteraction (Fig. 9). Further understanding of the role ofCSBIII in the cleavage process is necessary to infer any functionfor the base at this position.The flexibility in sequence composition in the intervening

region between CSB II and CSB III is reflected by the lackof potential base pairing between this region and RNaseMRP RNA (Fig. 9). The ability of mutations in nucleotidessurrounding the cleavage site to affect cleavage efficiency issupported by the effect of mutations at positions 18 and 21 onpotential substrate-endonuclease interactions. Mutation

18C, which disrupts a potential base-pairing interaction,results in a moderate reduction in endonuclease activity;however, mutation 21C, which creates a new potentialbase-pairing interaction, increases endonuclease efficiency.

Potential interactions between CSB II in the mtRNAsubstrate and RNase MRP RNA encompass both the 5' and3' guanosine tracts of CSB II. Many mutations in CSB IIwhich significantly disrupt potential base-pairing interac-tions in either of these regions result in a major reduction incleavage activity (9C, 1OA, lOCliA, 13C14C, 14C, 14C15C,14C16C, and 15C). Although the differential effect of variouspoint mutations on RNase MRP cleavage can be rationalizedbased on their relative location within duplex regions in theproposed model (compare 8C26C with 9C and 12C and 13Cwith 14C), the large drop in efficiency associated withmutations in the 3'-most portion of CSB II cannot beexplained by the disruption of any potential base pairs(mutants 2G, 3G, 4G, and SC). The importance of theseresidues may be due to their involvement in either tertiary

3

VOL. 10, 1990


interactions with RNase MRP RNA, protein-RNA contact,metal ion binding, or base pairing of a type not featured here.

Surprisingly, mutation 16C, which disrupts a potentialbase pair in the model shown in Fig. 9, results in an increasein endonuclease cleavage. A similar phenomenon has beendiscovered for 5' exon cleavage by the L-21 Scal Tetrahy-mena IVS (42). GTP-mediated cleavage of an oligoribonu-cleotide substrate was found to be enhanced by disruption ofa base-pairing interaction between the substrate RNA andthe internal guide sequence of the group I IVS RNA.Similarly, disruption of base pairing at residue 16 mayincrease cleavage by destabilizing the enzyme-substratecomplex or stabilizing the resulting transition state.The fact that RNase MRP can cleave one of five phospho-

diester bonds in the mtRNA substrate indicates that a certainamount of flexibility may be incorporated into the interactionof the endonuclease with its RNA substrate. This could beaccomplished by allowing multiple alignments betweenRNase MRP RNA and its RNA substrate. In fact, if theenergetic loss of bulged nucleotides is ignored, severaladditional alignments between CSBs II and III are possible.The ability of mutations to favor or disfavor various inter-actions between endonuclease and substrate may lead to theeffects noted on cleavage site selection. Alternatively, asingle, stable interaction such as that depicted in Fig. 9 couldallow multiple cleavage sites if the geometry of the interac-tion allowed hydrolysis at one of a number of sites. Muta-tions at various nucleotides might therefore distort thisinteraction and hence bias the cleavage of certain phospho-diester bonds.

In a computer-assisted sequence comparison betweenmouse RNase MRP RNA and mouse mtRNA substrate, adodecamer region of potential base pairing was proposed(12). This site involved positions 154 to 163 of MRP RNAand the CSB II region of the mtRNA substrate; CSB II wasconsidered the most likely important substrate sequenceelement, based on its conservation and adjacency to thecleavage site (10-12). Although there are no data availablethat rule out the possibility that CSB II can interact at thatregion, this mutational analysis raises for the first time apossible requirement for accommodating CSB III in anyinteraction model. Under the previous CSB 1I-only assump-tion (12), there is no obvious site for base pairing of theupstream CSB III RNA sequence. More extensive inhibitionanalyses and cross-linking of RNA substrate to MRP RNAshould help to reveal definitive areas of interaction betweenthese two RNA elements.

Conservation of substrate recognition by mammalian RNaseMRP. Heterologous assays with mouse or human mitochon-drial RNase MRP on mutated mouse mtRNA substratesillustrated that the basic mechanisms governing substraterecognition and cleavage are conserved in these two species(Fig. 8). Inspection of the sequence of human RNase MRPRNA (16) revealed that it contains a possible substrate-binding site highly homologous to the region of mouseRNase MRP RNA that exhibits partial complementarity withCSB II and CSB III (approximately 90% for the sequencebetween human and mouse nucleotides 115 and 152 [16]).Alignment of the mouse mtRNA substrate with the analo-gous complementary sequence in human RNase MRP RNAshows 80% conservation of the potential base pairs noted inFig. 9 (with an equivalent number of base pairs beingmaintained in the heterologous alignment). Among thosebase pairs lost in the heterologous alignment, only one hasbeen shown by mutational analysis to have a significanteffect on substrate cleavage.

Prior experiments have shown that both mouse and humanRNase MRPs are capable of processing yeast oriS mtRNAsubstrate with very low efficiency (35). This result is intrigu-ing, given the fact that the yeast mtRNA substrate containsonly a CSB II sequence element. The simplest explanationconsistent with the available data is that CSB III serves as anefficiency element for the cleavage reaction.RNase MRP cleaves length variants of CSB II. CSB II is the

only noncoding region of the mammalian mitochondrialgenome that exhibits intracellular length polymorphism (22)(Fig. 6, nucleotides 5 to 10). Mouse mitochondrial RNaseMRP did not cleave an RNA substrate containing a CSB IIhomopolymer run of 5 nucleotides, yet it efficiently pro-cessed RNAs containing homopolymer runs of 6 to 8 nucle-otides (Fig. 4E). No mammalian mtDNA has been found tocontain fewer than 6 nucleotides in the variable homopoly-mer run of CSB II. If the length of the variable homopolymerrun in CSB II is important in regulating critical processes innucleic acid metabolism in mitochondria, then RNase MRPcould be indirectly involved in regulating these events bydetermining the outer boundaries to which this polymor-phism might extend in vivo. If RNase MRP forms primersfor the initiation of mtDNA replication, then length variantsunable to be cleaved by RNase MRP would fail to bereplicated and transmitted to future generations.A nuclear substrate for RNase MRP. The mammalian

nucleus contains an abundant amount of RNase MRP RNA(11). Recently, it has been shown that this MRP RNA ispresent in active ribonucleoprotein complexes and that thesecomplexes are identical with the previously identified anti-Th or 7-2 ribonucleoprotein particles (16, 21, 31). Previousimmunocytochemistry localized these particles to the gran-ular component of the nucleolus of the cell (32). If thenuclear form of RNase MRP is active in the nucleus of thecell, then its localization in the nucleolus suggests that it maybe involved in the processing of rRNA.Under the assumption that the nuclear form of RNase

MRP possessed the same substrate specificity as the mito-chondrial form of the activity, a computer search wasconducted for potential substrate sequences within mamma-lian rDNA. No matches were found with a combined CSBII-CSB III consensus template. Therefore, if the nuclearform of RNase MRP possesses the same substrate specificityas the mitochondrial form, the possibility that nuclear RNaseMRP processes rRNA is rather unlikely. Comparison of boththe fine structure and substrate specificity of the nuclear andmitochondrial forms of the endonuclease will aid in deci-phering the importance of the various protein and RNAcomponents in substrate recognition and catalysis. Thismutational analysis provides the initial foundation for thatcomparison and for the assignment of any function for thenuclear form of the enzyme.

ACKNOWLEDGMENTS

We thank D. D. Chang for insightful discussions throughout thecourse of this study and D. D. Chang and J. N. Topper for helpfulcomments on the manuscript.

J.L.B. is a Medical Scientist Training Program Trainee of theNational Institute of General Medical Sciences (GM07365-13). Thisinvestigation was supported by Public Health Service grantGM33088-19 from the National Institute of General Medical Sci-ences and grant NP-9P from the American Cancer Society, Inc.

LITERATURE CITED1. Altman, S., M. Baer, H. Gold, C. Guerrier-Takada, L. Kirse-

bom, N. Lawrence, N. Lumelsky, and A. Vioque. 1987. Cleavage

MOL. CELL. BIOL.


of RNA by RNase P from Escherichia coli, p. 3-15. In M.Inouye and B. S. Dudock (ed.), Molecular biology of RNA: newperspectives. Academic Press, Inc., San Diego.

2. Anderson, S., A. T. Bankier, B. G. Barrell, M. H. L. De Bruin,A. R. Coulson, J. Drouin, I. C. Eperon, D. P. Nierlich, B. A.Roe, F. Sanger, P. H. Schreier, A. J. H. Smith, R. Staden, andI. G. Young. 1981. Sequence and organization of the humanmitochondrial genome. Nature (London) 290:457-465.

3. Baer, M. F., R. M. Reilly, G. M. McCorkle, T.-Y. Hai, S.Altman, and U. L. RajBhandary. 1988. The recognition ofRNase P of precursor tRNAs. J. Biol. Chem. 263:2344-2351.

4. Bartkiewicz, M., H. Gold, and S. Altman. 1989. Identificationand characterization of an RNA molecule that copurifies withRNase P activity from HeLa cells. Genes Dev. 3:488-499.

5. Been, M. D., and T. R. Cech. 1986. One binding site determinessequence specificity of Tetrahymena pre-rRNA self-splicing,trans-splicing, and RNA enzyme activity. Cell 47:207-216.

6. Birnstiel, M. L., and F. J. Schaufele. 1988. Structure andfunction of minor snRNPs, p. 155-182. In M. L. Birnstiel (ed.),Structure and function of major and minor small nuclear ribo-nucleoprotein particles. Springer-Verlag, Berlin.

7. Burkard, U., I. Willis, and D. Soil. 1988. Processing of histidinetransfer RNA precursors: abnormal cleavage site for RNase P.J. Biol. Chem. 263:2447-2451.

8. Cech, T. R., and B. L. Bass. 1986. Biological catalysis by RNA.Annu. Rev. Biochem. 55:599-629.

9. Chang, D. D., and D. A. Clayton. 1986. Precise assignment ofthe light-strand promoter of mouse mitochondrial DNA: afunctional promoter consists of multiple upstream domains.Mol. Cell. Biol. 6:3253-3261.

10. Chang, D. D., and D. A. Clayton. 1987. A novel endoribonu-clease cleaves at a priming site of mouse mitochondrial DNAreplication. EMBO J. 6:409-417.

11. Chang, D. D., and D. A. Clayton. 1987. A mammalian mitochon-drial RNA processing activity contains nucleus-encoded RNA.Science 235:1178-1184.

12. Chang, D. D., and D. A. Clayton. 1989. Mouse RNAase MRPRNA is encoded by a nuclear gene and contains a dodecamersequence complementary to a conserved region of mitochon-drial RNA substrate. Cell 56:131-139.

13. Chang, D. D., W. W. Hauswirth, and D. A. Clayton. 1985.Replication priming and transcription initiate from precisely thesame site in mouse mitochondrial DNA. EMBO J. 4:1559-1567.

14. Forster, A. C., A. C. Jeffries, C. C. Sheldon, and R. H. Symons.1987. Structural and ionic requirements for self-cleavage ofvirusoid RNAs and trans self-cleavage of viroid RNA. ColdSpring Harbor Symp. Quant. Biol. 52:249-259.

15. Forster, A. C., and R. H. Symons. 1987. Self-cleavage ofvirusoid RNA is performed by the proposed 55-nucleotideactive site. Cell 50:9-16.

16. Gold, H. A., J. N. Topper, D. A. Clayton, and J. Craft. 1989.The RNA processing enzyme RNase MRP is identical to the ThRNP and related to RNase P. Science 245:1377-1380.

17. Green, C. J., and B. S. Vold. 1988. Structural requirements forprocessing of synthetic tRNAHiS precursors by the catalyticRNA component of RNase P. J. Biol. Chem. 263:652-657.

18. Greenberg, B. D., J. E. Newbold, and A. Sugino. 1983. Intraspe-cific nucleotide sequence variability surrounding the origin ofreplication in human mitochondrial DNA. Gene 21:33-49.

19. Guerrier-Takada. C., A. von Belkum, C. W. A. PleU, and S.Altman. 1988. Novel reactions of RNAase P with a tRNA-likestructure in turnip yellow mosaic virus RNA. Cell 53:267-272.

20. Haseloff, J., and W. L. Gerlach. 1988. Simple RNA enzymeswith new and highly specific endoribonuclease activities. Na-ture (London) 334:585-591.

21. Hashimoto, C., and J. A. Steitz. 1983. Sequential association ofnucleolar 7-2 RNA with two different autoantigens. J. Biol.Chem. 258:1379-1382.

22. Hauswirth, W. W., and D. A. Clayton. 1985. Length heteroge-

neity of a conserved displacement-loop sequence in humanmitochondrial DNA. Nucleic Acids Res. 13:8093-8104.

23. Hauswirth, W. W., M. J. Van De Walle, P. J. Laipis, and P. D.Olivo. 1984. Heterogeneous mitochondrial DNA D-loop se-quences in bovine tissue. Cell 37:1001-1007.

24. Inoue, T., F. X. Sullivan, and T. R. Cech. 1985. Intermolecularexon ligation of the rRNA precursor of Tetrahymena: oligonu-cleotides can function as 5' exons. Cell 43:431-437.

25. Jacquier, A., and F. Michel. 1987. Multiple exon-binding sites inclass II self-splicing introns. Cell 50:17-29.

26. Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid andefficient site-specific mutagenesis without phenotypic selection.Methods Enzymol. 154:367-382.

27. McClain, W. H., C. Guerrier-Takada, and S. Altman. 1987.Model substrates for an RNA enzyme. Science 238:527-530.

28. Michel, F., and A. Jacquier. 1987. Long-range intron-exon andintron-intron pairings involved in self-splicing of class II cata-lytic introns. Cold Spring Harbor Symp. Quant. Biol. 52:201-212.

29. Mount, S. M., I. Pettersson, M. Hinterberger, A. Karmas, andJ. A. Steitz. 1983. The Ul small nuclear RNA-protein complexselectively binds a 5' splice site in vitro. Cell 33:509-518.

30. Pace, N. R., B. D. James, C. Reich, D. S. Waugh, G. J. Olsen,and T. L. Marsh. 1987. Bacillus subtilis RNase P, p. 17-36. InM. Inouye and B. S. Dudock (ed.), Molecular biology of RNA:new perspectives. Academic Press, Inc., San Diego.

31. Reddy, R., E. M. Tan, D. Henning, K. Nohga, and H. Busch.1983. Detection of a nucleolar 7-2 ribonucleoprotein and acytoplasmic 8-2 ribonucleoprotein with autoantibodies frompatients with scleroderma. J. Biol. Chem. 258:1383-1386.

32. Reiner, G., I. Raska, U. Scheer, and E. M. Tan. 1988. Immu-nolocalization of 7-2-ribonucleoprotein in the granular compo-nent of the nucleolus. Exp. Cell Res. 176:117-128.

33. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

34. Steitz, J. A., D. L. Black, V. Gerke, K. A. Parker, A. Krimer, D.Frendewey, and W. Keller. 1988. Functions of the abundantU-snRNPs, p. 115-154. In M. L. Birnstiel (ed.), Structure andfunction of major and minor small nuclear ribonucleoproteinparticles. Springer-Verlag, Berlin.

35. Topper, J. N., D. D. Chang, R. P. Fisher, and D. A. Clayton.1988. Initiation and processing of mitochondrial displacement-loop transcripts, p. 207-212. In T. Kelly and B. Stillman (ed.),Cancer Cells 6. Cold Spring Harbor Laboratory, Cold SpringHarbor, N.Y.

36. Uhlenbeck, 0. C. 1987. A small catalytic oligoribonucleotide.Nature (London) 328:596-60.

37. Walberg, M. W., and D. A. Clayton. 1981. Sequence andproperties of the human KB cell and mouse L cell D-loopregions of mitochondrial DNA. Nucleic Acids Res. 9:5411-5421.

38. Waring, R. B., P. Towner, S. J. Minter, and R. W. Davies. 1986.Splice-site selection by a self-splicing RNA of Tetrahymena.Nature (London) 321:133-139.

39. Wood, W. I., J. Gitschier, L. A. Lasky, and R. M. Lawn. 1985.Base composition-independent hybridization in tetramethylam-monium chloride: a method for oligonucleotide screening ofhighly complex gene libraries. Proc. Natl. Acad. Sci. USA82:1585-1588.

40. Zaug, A. J., M. D. Been, and T. R. Cech. 1986. The Tetrahy-mena ribozyme acts like an RNA restriction endonuclease.Nature (London) 324:429-433.

41. Zaug, A. J., and T. R. Cech. 1986. The intervening sequenceRNA of Tetrahymena is an enzyme. Science 231:470-475.

42. Zaug, A. J., C. A. Grosshans, and T. R. Cech. 1988. Sequence-specific endoribonuclease activity of the Tetrahymena ri-bozyme: enhanced cleavage of certain oligonucleotide sub-strates that form mismatched ribozyme-substrate complexes.Biochemistry 27:8924-8931.

VOL. 10, 1990

Documents

Efficient Site-Specific Cleavage by RNase MRP Requires Interaction