ARTICLEShttps://doi.org/10.1038/s41590-018-0185-0

1Aix Marseille University, CNRS, INSERM, Centre d’Immunologie de Marseille-Luminy, Marseille, France. 2Innate Pharma Research Laboratories, Innate Pharma, Marseille, France. 3Service d’Immunologie, Marseille Immunopole, Hôpital de la Timone, Assistance Publique des Hôpitaux de Marseille, Marseille, France. *e-mail: ugolini@ciml.univ-mrs.fr

The immune system protects the host organism against infec-tious diseases, principally by eradicating infectious agents. However, pathogen elimination frequently entails collateral

tissue damage and inflammation, which potentially decreases host fitness1. Neuroendocrine–immune system interactions have an important role in these regulatory processes, but the mechanisms involved remain unclear2,3. Endogenous glucocorticoids (cortisol in humans, and corticosterone in rodents) are essential steroid hormones that regulate many physiological and developmental processes. They are synthesized in the adrenal cortex after activa-tion of the hypothalamic–pituitary–adrenal (HPA) axis, a neu-ral–endocrine core for coordinating physiological responses to external stimuli4. Glucocorticoids released into the blood diffuse through cell membranes to bind cytosolic glucocorticoid recep-tor (GR), which is ubiquitously expressed and induces changes in gene expression5. The HPA neural–endocrine pathway restores homeostasis by limiting and resolving inflammation in many con-ditions2. In models of systemic inflammation, such as lipopoly-saccharide-induced sepsis, glucocorticoids specifically inhibit the production of pro-inflammatory cytokines in several types of immune cells6–9.

The HPA axis is also activated during infection with viruses such as influenza virus10 or cytomegalovirus (CMV)11. Murine CMV (MCMV) is a beta-herpesvirus used as a model for systemic infec-tion with human CMV, which can cause severe disease, especially in immunocompromised people. Mice rendered deficient in glucocor-ticoids by adrenalectomy are more susceptible to MCMV-induced death, due to the deleterious effects of cytokine-induced hyper-inflammation, and resistance is restored by corticosterone replace-ment12. Finally, glucocorticoids are clinically effective against many inflammatory and autoimmune diseases13. In all these conditions, the underlying mechanisms used by glucocorticoids have remained

unclear, because GRs are expressed by many hematopoietic and non-hematopoietic cells and can affect multiple signaling pathways.

During acute infection, the cytokine interferon-γ (IFN-γ ) pro-duced by innate lymphoid cells (ILCs) is essential for antiviral defense14–16. These IFN-γ -producing ILCs include natural killer (NK) cells in the spleen and liver and group 1 ILCs (ILC1s) in the liver, which all express GR6. Here we investigated the role of GRs in ILC subsets of relevance during infection with MCMV through the use of mice with conditional deletion of the gene encoding GR in ILCs expressing the activating NK cell receptor NCR1 (NKp46), which include NK cells, ILC1s and a subset of ILC3s. We found that endogenous glucocorticoids produced rapidly after infection induced selective and tissue-specific expression of the immuno-logical checkpoint receptor PD-1 on the surface of spleen NK cells. Concomitantly, the expression of PD-1 ligands was upregulated in several subsets of immune cells. PD-1 signaling was required for host survival after infection and acted by limiting the production of IFN-γ by NK cells in the spleen, which prevented immunopa-thology. This neuroendocrine–immune system axis controlled immunotolerance but did not impair viral clearance. Our findings therefore demonstrate a major role for the HPA axis in promoting host resistance to an infectious disease through regulation of the PD-1 inhibitory pathway in an ILC subset.

ResultsThe regulation of NK cell functions by glucocorticoids is organ specific. During acute infection with MCMV, high levels of viral replication are seen in the spleen and the liver17. In these organs, NK cells are required for host resistance to infection, and they mediate their anti-viral function through cytokine- and killing-dependent mechanisms18. Consistent with published findings11,19, infection of C57BL/6 J wild-type mice with MCMV induced the

Endogenous glucocorticoids control host resistance to viral infection through the tissue-specific regulation of PD-1 expression on NK cellsLinda Quatrini! !1, Elisabeth Wieduwild1, Bertrand Escaliere1, Jessica Filtjens1, Lionel Chasson1, Caroline Laprie1, Eric Vivier! !1,2,3 and Sophie Ugolini! !1*

Controlling the balance between immunity and immunopathology is crucial for host resistance to pathogens. After infection, activation of the hypothalamic–pituitary–adrenal (HPA) axis leads to the production of glucocorticoids. However, the pleio-tropic effects of these steroid hormones make it difficult to delineate their precise role(s) in vivo. Here we found that the regulation of natural killer (NK) cell function by the glucocorticoid receptor (GR) was required for host survival after infection with mouse cytomegalovirus (MCMV). Mechanistically, endogenous glucocorticoids produced shortly after infection induced selective and tissue-specific expression of the checkpoint receptor PD-1 on NK cells. This glucocorticoid–PD-1 pathway limited production of the cytokine IFN-γ by spleen NK cells, which prevented immunopathology. Notably, this regulation did not com-promise viral clearance. Thus, the fine tuning of NK cell functions by the HPA axis preserved tissue integrity without impairing pathogen elimination, which reveals a novel aspect of neuroimmune regulation.

NATURE IMMUNOLOGY | VOL 19 | SEPTEMBER 2018 | 954–962 | www.nature.com/natureimmunology954

ARTICLESNATURE IMMUNOLOGY

release of corticosterone into the bloodstream, with a peak at 36 h after infection (Fig. 1a), which suggested that the HPA axis might have a role during the early phase of the infection, when NK cells are activated14. We first analyzed the effect of glucocorticoids on the cytotoxic activity of spleen CD3–NCR1+ NK cells in vitro by stimulating splenocytes isolated from C57BL/6 J wild-type mice with antibody to the activating NK cell receptor NK1.1 or with the phorbol ester PMA and ionomycin. Treatment with corticoste-rone had no effect on the degranulation of NK cells, as assessed by measurement of the expression of lysosome-associated membrane protein-1 (also known as CD107a) (Supplementary Fig. 1a). We then analyzed the role of the GR pathway in NCR1+ ILCs in vivo through the use of Ncr1iCre/+Nr3c1loxP/loxP mice (called ‘GRNcr1-iCre mice’ here), in which loxP-flanked alleles encoding GR (Nr3c1loxP/loxP) are specifically deleted in NCR1+ cells that express Cre recombi-nase6,20,21. Sex-matched Ncr1iCre/+Nr3c1+/+ littermates (called ‘WTNcr1-iCre mice’ here), in which Cre recombinase is expressed in NCR1+ cells but Nr3cr1 is not deleted, were used throughout as control mice, unless specified otherwise. In steady-state conditions, NCR1+ ILCs in GRNcr1-iCre mice (i.e., NK cells, ILC1s and a subset of ILC3s) show normal development, maturation and function6. We infected GRNcr1-iCre and WTNcr1-iCre littermates with MCMV and analyzed their immune responses at 44 h after infection, after the concentration of corticosterone in blood had peaked. The concentration of cor-ticosterone in the serum of GRNcr1-iCre mice was similar to that in the serum of WTNcr1-iCre mice (Supplementary Fig. 1b). The expres-sion of granzyme B, a surrogate marker of NK cell cytotoxicity, was upregulated similarly in NK1.1+NCR1+DX5+CD49a– NK cells from GRNcr1-iCre mice and those from WTNcr1-iCre mice, both in the spleen and in the liver (Supplementary Fig. 1c). In contrast, the expres-sion of IFN-γ was higher in spleen GRNcr1-iCre NK cells than in spleen WTNcr1-iCre NK cells, as measured by mean fluorescence intensity and the frequency of IFN-γ + cells (Fig. 1b and Supplementary Fig. 1d). Although corticosterone is known to have systemic distribution, the expression of IFN-γ by liver GRNcr1-iCre NCR1+ NK cells and ILC1s was similar to that of their WTNcr1-iCre counterparts (Fig. 1c,d), which suggested that the effect of glucocorticoids was tissue specific.

Histological analysis of the spleen indicated that GRNcr1-iCre mice had more-substantial lesions, associated with coalescing and granu-lomatous necrotic splenitis in the marginal zone, than did WTNcr1-iCre mice (Fig. 2a,b). In contrast, no significant difference between GRNcr1-iCre mice and WTNcr1-iCre mice was observed in the nature or extent of the liver lesions, with mild multifocal pyogranulomatous and necrotic hepatitis in mice of each genotype (Fig. 2c,d). The viral load in the spleen and liver of GRNcr1-iCre was similar to that in WTNcr1-iCre mice (Fig. 2e), which suggested that the inflammation-induced tissue damage was not due to an impairment of viral clearance.

NCR1+ ILC3s are known to express GR, and the gene encod-ing GR is also deleted in NCR1+ ILC3s from GRNcr1-iCre mice6. These ILC3s reside mostly in mucosal tissues, where they produce the cyto-kines IL-22 and IL-17, but not IFN-γ 22, and thus they are thought to have minimal involvement in the immune response to MCMV. Nonetheless, we assessed the effect of endogenous glucocorticoids on these cells after infection with MCMV. Such infection did not induce an increase in the production of IL-22 or IL-17 in NCR1+ ILC3 from the small intestine of WTNcr1-iCre or GRNcr1-iCre mice (Supplementary Fig. 2a–d). The frequency of NCR1+ ILC3s in the small intestine was also unaffected (Supplementary Fig. 2e), which suggested that NCR1+ ILC3s did not have a major effect on the immune response to infection with MCMV. Collectively, these results indicated that the responsiveness of NCR1+ ILCs to glucocorticoids produced during acute infection with MCMV controlled spleen inflammation and specifically regulated the production of IFN-γ by spleen NK cells.

Endogenous glucocorticoids induce PD-1 expression on spleen NK cells. Next we performed RNA-based next-generation

b

d

a

c

IFN

-γ+ c

ells

(%

)

UI

*2.2 30

3.1 53

IFN-γ-BV421

FS

C-A

0 103 104 105

UI MCMV

WTNcr1-iCre

GRNcr1-iCre

WTNcr1-iCre

GRNcr1-iCre

12 24 36 480

100

200

300

400

500

MCMV

UI

Time after injection (h)

******

*

Cor

ticos

tero

ne (

ng/m

l)

0

20

40

60

80

MCMV

3.1 29

2.8 26

0

10

20

30

40

50

IFN

-γ+ c

ells

(%

)

IFN-γ-BV421

FS

C-A

250200150100500

UI MCMV

WTNcr1-iCre

GRNcr1-iCre

WTNcr1-iCre

GRNcr1-iCre

UI MCMV

1.2 30

1.4 30250200150100

500

0

20

40

60

IFN

-γ+ c

ells

(%

)

IFN-γ-BV421

FS

C-A

UI MCMV

WTNcr1-iCre

GRNcr1-iCre

WTNcr1-iCre

GRNcr1-iCre

UI MCMV

0 10 104 105

0 10 104 105

250200150100

500

Fig. 1 | Organ-specific glucocorticoid regulation of the production of IFN-γ by NCR1+ ILCs in the spleen and liver after infection with MCMV. a, ELISA of corticosterone in the serum of wild-type mice at various times (horizontal axis) after injection of DMEM (uninfected (UI)) or MCMV (key). Data are pooled from two experiments with n!= !5 mice per group (mean!± !s.e.m.). *P!< !0.05, **P!< !0.01 and ****P!< !0.0001 (one-way analysis of variance (ANOVA)). b–d, Flow-cytometry analysis of intracellular IFN-γ in spleen NK cells (b), liver NK cells (c) and liver ILC1s (d) of GRNcr1-iCre and WTNcr1-iCre mice (left margin) at 44!h after injection of DMEM or MCMV (above plots), assessed directly ex vivo without re-stimulation in vitro (left), and frequency of IFN-γ -producing (IFN-γ +) cells among those cells (right). Numbers adjacent to outlined areas (left) indicate percent IFN-γ + cells. FSC, forward scatter. Each symbol (right) represents an individual mouse. Data are representative of (left) or pooled from (right) five experiments with n!= !10 mice per genotype (UI), n!= !16 WTNcr1-iCre mice (MCMV) or n!= !15 GRNcr1-iCre mice (MCMV) (b), n!= !10 mice per genotype (UI), n!= !16 WTNcr1-iCre mice (MCMV) or n!= !15 GRNcr1-iCre mice (MCMV) (c), or n!= !9 WTNcr1-iCre mice (UI), n!= !11 GRNcr1-iCre mice (UI), n!= !16 WTNcr1-iCre mice (MCMV) or n!= !15 GRNcr1-iCre mice (MCMV) (d) (mean!± !s.e.m.). *P!< !0.05 (two-tailed Student’s t-test).

NATURE IMMUNOLOGY | VOL 19 | SEPTEMBER 2018 | 954–962 | www.nature.com/natureimmunology 955

ARTICLES NATURE IMMUNOLOGY

sequencing on spleen CD3–CD19–NK1.1+NCR1+DX5+ NK cells, liver CD3–CD19–NK1.1+NCR1+DX5+CD49a– NK cells and liver CD3–CD19–NK1.1+NCR1+DX5–CD49a+ ILC1s sorted from GRNcr1-iCre and WTNcr1-iCre mice at 44 h after infection with MCMV (Supplementary Fig. 3). Pairwise comparison of the two genotypes for gene expression by spleen NK cells, liver NK cells and liver ILC1s identified genes expressed differentially by cells of the two geno-types for each ILC subset (Supplementary Table 1). Unsupervised genome-wide analysis indicated that the GR-dependent modifica-tions of the transcriptome were different in spleen NK cells, liver NK cells and liver ILC1s (Supplementary Table 1), which suggested that the regulation of gene expression by glucocorticoids was specific to both organ and cell lineage in vivo. To identify candidate genes associated with the selective hyper-inflammation observed in the spleen of GRNcr1-iCre mice, we focused on genes that were expressed

differentially by WTNcr1-iCre spleen NK cells relative to their expres-sion by GRNcr1-iCre spleen NK cells. In addition to the expression of Nr3c1 (which encodes GR), the expression of Tsc22d3 (which encodes the glucocorticoid-induced protein GILZ) and of Pdcd1 (which encodes PD-1) was significantly downregulated in spleen NK cells from GRNcr1-iCre mice after infection, relative to such expres-sion in spleen NK cells from their WTNcr1-iCre littermates (Fig. 3a and Supplementary Table 1).

Consistent with the rapid and ubiquitous induction of Tsc22d3 by glucocorticoids in many cell types and inflammatory condi-tions23, the expression of Tsc22d3 in both spleen NK cells and liver NK cells from GRNcr1-iCre after infection was different from that in their WTNcr1-iCre counterparts (Supplementary Table 1). GILZ is a mediator of the anti-inflammatory effects of glucocorticoids and regulates the survival, homeostasis and apoptosis of various cell types, including lymphoid cells24,25. We assessed the proliferation and apoptosis of NK cells in the spleen and liver of GRNcr1-iCre mice and their WTNcr1-iCre littermates at 44 h after infection with MCMV, through the use of staining with proliferation marker Ki67 and with the apoptosis marker annexin V and propidium iodide, followed by flow cytometry. Despite the downregulation of Tsc22d3 in spleen and liver GRNcr1-iCre NK cells, there was no difference in the prolifera-tion or apoptosis of spleen and liver GRNcr1-iCre NK cells relative to that of their WTNcr1-iCre counterparts (Supplementary Fig. 4a,b). The homeostasis of liver ILC1s in GRNcr1-iCre mice was also similar to that in WTNcr1-iCre mice (Supplementary Fig. 4c), which suggested that GILZ did not have a major role in the selective immunopathology observed in the spleen of GRNcr1-iCre mice.

In contrast to the expression of Tsc22d3, differential expression of Pdcd1 by cells of the two genotypes was observed selectively for spleen NK cells, not for liver NK cells (Supplementary Table 1). In addition, Pdcd1 expression in liver ILC1s from MCMV-infected GRNcr1-iCre mice was similar to that in such cells from MCMV-infected WTNcr1-iCre mice. PD-1 is an inhibitory cell-surface receptor that downregulates T cell activity26. PD-1 protein was not expressed on the surface of spleen or liver NK cells from uninfected GRNcr1-iCre or WTNcr1-iCre mice, but it was detected on spleen NK cells from MCMV-infected WTNcr1-iCre mice at 44 h after infection (Fig. 3b). Notably, we did not detect PD-1 in spleen NK cells from MCMV-infected GRNcr1-iCre mice (Fig. 3b), which showed that the induction of PD-1 was dependent on the glucocorticoid–GR pathway. PD-1 expression was not detected on spleen macrophages, neutrophils or dendritic cells in either uninfected wild-type mice or MCMV-infected wild-type mice at 44 h after infection (Supplementary Fig. 5). In the spleen of uninfected WTNcr1-iCre and GRNcr1-iCre mice, a dis-crete subset of T cells (less than 4%) had low basal expression of PD-1, but this T cell subset did not expand, and PD-1 expression on T cells did not change after infection with MCMV in mice of either genotype (Fig. 3c). Expression of PD-1 was not detected on liver NK cells or ILC1s (Fig. 3d,e), consistent with the transcriptomic data. Similar results were obtained with two different clones of antibody to PD-1 (J43 and RMP1-30) (Fig. 3b). These data indicated that glucocorticoids released after infection with MCMV induced the GR-dependent de novo expression of PD-1 on spleen NK cells by regulating Pdcd1 transcription.

NK cell expression of PD-1 depends on the cytokine microenvi-ronment. Liver NK cells expressed GR both at steady state6 and after infection with MCMV (Supplementary Fig. 6a). Tsc22d3 expression was downregulated in spleen and liver GRNcr1-iCre NK cells similarly to its downregulation in their WTNcr1-iCre counterparts (Supplementary Table 1), which indicated that the liver NK cells were responsive to GR signaling. Because the lack of expression of PD-1 on liver NK cells, in contrast to its expression on spleen NK cells, could not be explained by impaired responsiveness to glucocorticoids, we inves-tigated whether it was dependent on the presence of tissue-specific

a

0

2

4

6

8

10

Spleen Liver

Ie1

copy

num

ber

(per

mg.

log)

c

0

1

2

3

Spl

een

infla

mm

atio

nsc

ore

*

e

WTNcr1-iCre

GRNcr1-iCre

b

0

1

2

3

Live

r in

flam

mat

ion

scor

e

d

WTNcr1-iCre

GRNcr1-iCre

WTNcr1-iCre

WTNcr1-iCre

GRNcr1-iCre

GRNcr1-iCre

WTNcr1-iCre

GRNcr1-iCre

9

7

5

3

1

Spleen

Liver

Fig. 2 | GRNcr1-iCre mice display greater inflammation in the spleen than that of WTNcr1-iCre mice, but their viral titers are unaffected. a,c, Histology (H&E staining) of the spleen (a) and liver (c) of GRNcr1-iCre and WTNcr1-iCre mice (left margin) at 44!h after infection with MCMV; arrowheads (a) indicate an area of inflammation in the marginal zone. Scale bars, 50!μ m. Data are from two experiments with eight mice per genotype. b,d, Histopathological quantification of inflammation in the spleen (b) and liver (d) of GRNcr1-iCre and WTNcr1-iCre mice (key) at 44!h after infection with MCMV: 1, mild; 2, moderate; 3, substantial. Each symbol represents an individual mouse; small horizontal lines indicate the mean (!± !s.e.m.). Data are pooled from two experiments with n!= !7 WTNcr1-iCre mice and n!= !9 GRNcr1-iCre mice. *P!< !0.05 (two-tailed Mann-Whitney test). e, qPCR analysis of the MCMV gene Ie1 (absolute quantification; log values), assessing viral titers in the spleen and liver (horizontal axis) of GRNcr1-iCre and WTNcr1-iCre mice (key) at 44!h after infection with MCMV. Each symbol represents an individual mouse. Data are pooled from two experiments with n!= !7 WTNcr1-iCre mice and n!= !8 GRNcr1-iCre mice (mean!± !s.e.m.).

NATURE IMMUNOLOGY | VOL 19 | SEPTEMBER 2018 | 954–962 | www.nature.com/natureimmunology956

ARTICLESNATURE IMMUNOLOGY

inflammatory cytokines in the microenvironment. We focused on the main cytokines known to modulate the activation of NK cells. We extracted RNA from spleen and liver tissue homogenates of MCMV-infected wild-type mice at 44 h after infection and of unin-fected wild-type mice and assessed the expression of Il12, Il15 and Il18 mRNA by RT-qPCR. We did not detect any significant differ-ence in the expression of Il18 mRNA in either organ after infection, relative to its expression before infection (Supplementary Fig. 6b). In contrast, expression of Il12 mRNA was upregulated by infection to a greater extent in the liver than in the spleen, and Il15 mRNA expression was higher exclusively in the spleen of infected mice relative to that in uninfected mice (Fig. 4a). Similar expression pat-terns were observed for Il12, Il15 and Il18 in WTNcr1-iCre mice and GRNcr1-iCre mice (data not shown). These data suggested that during infection with MCMV, the cytokine microenvironment in the liver differed from that in the spleen.

Next we determined whether various combinations of cytokines in culture medium modified the effect of the activation of GR on NK cells in vitro. We stimulated splenocytes from WTNcr1-iCre or GRNcr1-iCre mice for 48 h with various combinations of IL-12, IL-15 and IL-18 in the presence or absence of corticosterone. In the absence of corti-costerone, PD-1 expression was not induced on CD3–NCR1+NK1.1+ NK cells or CD3+ T cells (Fig. 4b and data not shown). Similarly, corticosterone, alone or in combination with IL-15 or with IL-12 and IL-15, did not induce the expression of PD-1 on NK cells or T cells of either genotype (Fig. 4b and data not shown). In contrast, treat-ment with corticosterone, IL-15 and IL-18 induced PD-1 expression, in a dose-dependent manner, on NK cells from WTNcr1-iCre mice but not on those from GRNcr1-iCre mice (Fig. 4b,c). This treatment did not

induce the expression of PD-1 on T cells from WTNcr1-iCre or GRNcr1-iCre mice (Fig. 4b and data not shown). The addition of IL-12 abolished the corticosterone-, IL-15- and IL-18-dependent induction of PD-1 expression in WTNcr1-iCre NK cells (Fig. 4b). Similar results were obtained for NK1.1+NCR1+ NK cells enriched from splenocytes (86–89% purity) and stimulated in the same way (Fig. 4d and data not shown), which suggested that the effect of IL-15 and IL-18 on NK cells was cell intrinsic. These data indicated that the induction of PD-1 expression by GR was specific to the cell type and was depen-dent on the cytokine microenvironment of NK cells.

The GR–PD-1 axis inhibits IFN-γ production in spleen NK cells. The activating NK cell receptor Ly49H mediates resistance of C57BL/6 J mice to infection with MCMV by specifically binding the virus-encoded protein m15727. Thus, we investigated the link between the expression of PD-1 and that of Ly49H on spleen NK cells during infection with MCMV. At 44 h after the infection of wild-type C57BL/6 J mice, PD-1 expression was upregulated similarly on Ly49H+ and Ly49H– spleen NK subsets (Supplementary Fig. 7a). Moreover, the frequency of Ly49H+ spleen NK cells in GRNcr1-iCre mice at 5 d after infection was similar to that in WTNcr1-iCre mice (Supplementary Fig. 7b), which suggested that GR signaling and PD-1 expression did not affect the population expansion of the m157-specific NK cells during infection with MCMV.

To further investigate whether PD-1 expression and signaling in spleen NK cells might have functional relevance, we determined whether the PD-1 ligands PD-L1 and PD-L2 were expressed in wild-type mice during infection with MCMV. Cytofluorimetric analysis revealed that PD-L1 expression was upregulated on macrophages,

c ed

WTNcr1-iCre GRNcr1-iCre

PD-1 PE0 104103 105

Eve

nts

(% o

f max

)

10080604020

0Spl

een

T c

ells

PD

-1M

FI (

rela

tive)

WTNcr1-iCre

GRNcr1-iCre

0

0.5

1.0

1.5

2.0

2.5

Live

r N

K c

ells

PD

-1M

FI (

rela

tive)

UI MCMV

WTNcr1-iCre

GRNcr1-iCreWTNcr1-iCre

GRNcr1-iCre

Live

r IL

C1s

PD

-1M

FI (

rela

tive)

UI MCMV0

0.5

1.0

1.5

2.0

2.5

0

0.5

1.0

1.5

2.0

2.5

UI MCMV

Ig UI MCMV

Spl

een

NK

cel

ls P

D-1

MF

I (re

lativ

e)

UI MCMV

b

Mean of normalized counts

Exp

ress

ion

(log 2

fold

)G

RNcr1-

iCre

vs

WTNcr1-

iCre

1 100 10,000

−4

−2

0

2

4

Pdcd1

Nr3c1Tsc22d3

Down in GRNcr1-iCreUp in GRNcr1-iCrea

****

0

1

2

3

WTNcr1-iCre

WTNcr1-iCre

GRNcr1-iCre

GRNcr1-iCre

PD-1 PE

Eve

nts

(% o

f max

)

0 104103 105

10080604020

0

Ig UI MCMV

Fig. 3 | Infection with MCMV induces glucocorticoid-dependent PD-1 expression in spleen NK cells. a, RNA-based next-generation sequencing of genes in spleen NK cells sorted from GRNcr1-iCre and WTNcr1-iCre mice at 44!h after infection with MCMV, presented as an MA plot (log ratio versus mean average) of the expression in GRNcr1-iCre mice relative to that in WTNcr1-iCre mice (log2 ‘fold’ values) plotted against mean values for normalized read counts; red symbols (‘Down in GRNcr1-iCre’) indicate genes with significantly lower expression in GRNcr1-iCre cells than in WTNcr1-iCre cells (absolute difference in expression of over onefold (log2 values) and P!< !0.05 (Wald test)). Data are from n!= !3 samples per genotype. b–e, Surface expression of PD-1 on spleen NK cells (b), spleen T cells (c), liver NK cells (d) and liver ILC1s (e) from GRNcr1-iCre and WTNcr1-iCre mice at 44!h after injection of DMEM (UI) or MCMV (horizontal axis), assessed by flow cytometry (b,c, right) and presented as (left) mean fluorescence intensity (MFI) relative to that of the isotype-matched control antibody (Ig); similar results were obtained with two different antibodies to PD-1 (J43 and RMP1-30). Each symbol represents an individual mouse. Data are pooled from three experiments with n!= !6 mice per genotype (UI), n!= !9 WTNcr1-iCre mice (MCMV) and n!= !12 GRNcr1-iCre mice (MCMV) (b) or two experiments with n!= !2 mice per genotype (UI), n!= !4 WTNcr1-iCre mice (MCMV) and n!= !6 GRNcr1-iCre mice (MCMV) (c), n!= !3 mice per genotype (UI), n!= !7 WTNcr1-iCre mice (MCMV) and n!= !8 GRNcr1-iCre mice (MCMV) (d) or n!= !2 mice per genotype (UI), n!= !4 WTNcr1-iCre mice (MCMV) and n!= !6 GRNcr1-iCre mice (MCMV) (e) (mean!± !s.e.m.). **P!< !0.01 (one-way ANOVA).

NATURE IMMUNOLOGY | VOL 19 | SEPTEMBER 2018 | 954–962 | www.nature.com/natureimmunology 957

ARTICLES NATURE IMMUNOLOGY

dendritic cells, neutrophils, T cells, B cells and NK cells from the spleen of MCMV-infected wild-type mice relative to its expression on such cells from the spleen of uninfected wild-type mice (Fig. 5a), while PD-L2 was expressed only on dendritic cells after infection with MCMV (Fig. 5b). To determine whether the potential engage-ment of PD-1 by its ligands controlled the function of NK cells in the spleen, we infected WTNcr1-iCre and GRNcr1-iCre mice with MCMV, followed by the administration of a PD-1-blocking antibody or isotype-matched control antibody. The antibodies were injected intraperitoneally 1 d after infection, before activation of the HPA axis and the release of glucocorticoids into the bloodstream. At 44 h after infection, the frequency of IFN-γ + spleen NK cells in WTNcr1-iCre mice that received the PD-1-blocking antibody (about 61%) was higher than that of WTNcr1-iCre mice given injection of the control antibody (about 33%) but was similar to that in GRNcr1-iCre mice treated with the control antibody (54%) (Fig. 5c). There was no greater frequency of IFN-γ + spleen NK cells in GRNcr1-iCre mice that received the PD-1-blocking antibody than in mice given injection of the control antibody (Fig. 5c), indicative of a strict dependence of the effect of PD-1 on GR-expressing NCR1+ NK cells. Moreover, blockade of PD-1 had no effect on the frequency of IFN-γ + NK cells in the liver of WTNcr1-iCre mice, relative to the effect of treat-ment with the control antibody (Fig. 5d), consistent with the lack of PD-1 expression on liver NK cells. Thus, during infection with MCMV, PD-1 signaling in spleen NK cells limited IFN-γ produc-tion by these cells. This regulation occurred in the spleen but not in the liver.

GR and PD-1 are required for host resistance to infection with MCMV. To assess the effect of the glucocorticoid–PD-1 axis on host resistance to viral infection, we infected 9- to 10-week-old GRNcr1-iCre and WTNcr1-iCre mice intraperitoneally with a median lethal dose (LD50) of MCMV. GRNcr1-iCre mice had greater mortality (100%) than that of their WTNcr1-iCre littermates (62%) (Fig. 6a), which indicated that glucocorticoid signaling in NCR1+ ILCs was required for host resistance to viral infection. To evaluate the specific contribution of the PD-1–PD-1 ligand interaction to such host resistance, we infected female wild-type C57BL/6 J mice with the LD50 of MCMV, followed by intraperitoneal administration of the PD-1-blocking antibody or isotype-matched control antibody at 1 d after infection. All mice that received the PD-1-blocking antibody succumbed to infection within a week (Fig. 6b), which resulted in a mortality similar to that of GRNcr1-iCre mice (Fig. 6a). Notably, this greater susceptibility to infection was not due to a difference in viral replication rate in GRNcr1-iCre mice relative to that in WTNcr1-iCre mice (Fig. 6c), or in wild-type mice that received the PD-1-blocking antibody relative to that in wild-type mice that received the control antibody (Fig. 6d), which suggested that the GR–PD-1 regulatory pathway did not impair viral clearance. Wild-type mice that received the PD-1-blocking antibody had more-substantial immunopathological features in the spleen, with larger areas of coalescing necrotic and granulomatous splenitis in the marginal zone than that of wild-type mice that received the control antibody (Fig. 6e). In contrast, the severity of hepatic lesions was not affected by blockade of PD-1, with both groups of mice displaying moderate to substantial necrotic and pyogranulomatous

cMCMVUI

Spleen Liver

Il15

expr

essi

on (

fold

)

0

1

2

3

4

5*

NS

Vehicle Cort 250 nM Cort 500 nM

1.8 35 53

1.8 2 1.3

NC

R1-

BV

421

PD-1-BV650

010

3

104

105 0

103

104

105 0

103

104

105

103

0

104

105

WTNcr1-iCre

GRNcr1-iCre103

0

104

105

103

0

104

105

NCR1-BV421

NK

1.1-

BV

510

89

86

0.7 31

0.3 0.8

Vehicle Cort 250 nM

WTNcr1-iCre

GRNcr1-iCre

NC

R1-

BV

421

PD-1-BV650

d

a

**

**

0

10

20

30

40

50

Spleen Liver

Il12

expr

essi

on (

fold

)b

Vehicle

Cort 250 nM

Cort 500 nM

IL-15IL-12IL-18

++–

+–+

+++

WTNcr1-iCre NK cells

+––

GRNcr1-iCre NK cells WTNcr1-iCre T cells

0

1020

40

60

80

0

1020

40

60

80

0

1020

40

60

80

PD

-1+ c

ells

(%

)

PD

-1+ c

ells

(%

)

PD

-1+ c

ells

(%

)*

IL-15IL-12IL-18

++–

+–+

+++

+––

IL-15IL-12IL-18

++–

+–+

+++

+––

Fig. 4 | Specific combinations of cytokines and corticosterone act together to induce PD-1 expression on NK cells. a, qRT-PCR analysis of Il12 and Il15 mRNA among RNA extracted from spleen and liver homogenates (horizontal axis) of wild-type mice at 44!h after injection of DMEM (UI) or MCMV (key); results are presented relative to those of uninfected mice. Each symbol represents an individual mouse; small horizontal lines indicate the mean. Data are pooled from two experiments with n!= !7 mice. NS, not significant (P!> !0.05); *P!< !0.05 and **P!<!0.01 (two-tailed Mann-Whitney test). b, Frequency of PD-1-expressing (PD-1+) NK cells and T cells among WTNcr1-iCre and GRNcr1-iCre total splenocytes stimulated for 48!h at 37!°C in vitro with various combinations of IL-15, I-12 and IL-18 (below plots) in the presence of 250 or 500!nM corticosterone (Cort) or vehicle (key), assessed by flow cytometry (as in c for NK cells). Each symbol represents an individual experiment. Data are from n!= !3 independent experiments (IL-12!+ !IL-15, IL-15!+ !IL-18, or IL-12!+ !IL-15!+ !IL-18; vehicle or 500!nM corticosterone) or n!= !2 independent experiments (all other samples) (mean!± !s.d.). *P!< !0.05 (one-way ANOVA). c,d, Flow-cytometry analysis of the expression of PD-1 by WTNcr1-iCre and GRNcr1-iCre NK cells among total splenocytes (c) or purified spleen NK cells (d; gating, left) stimulated for 48!h at 37!°C in vitro with IL-15 plus IL-18 in the presence of corticosterone or vehicle (above plots); left (d), flow-cytometry analysis of the expression of NK1.1 and NCR1 by live cells after purification of NK cells, gating NK cells (86–89%) for further analysis at right. Numbers adjacent to outlined areas indicate percent PD-1+ NK cells (c,d (middle and right)) or NK1.1+NCR1+ cells (d (left)). Data are from n!= !3 independent experiments (vehicle or 500!nM corticosterone) or n!= !2 independent experiments (250!nM corticosterone).

NATURE IMMUNOLOGY | VOL 19 | SEPTEMBER 2018 | 954–962 | www.nature.com/natureimmunology958

ARTICLESNATURE IMMUNOLOGY

hepatitis, with intranuclear inclusions in hepatocytes (Fig. 6e). MCMV-infected wild-type mice treated with the PD-1-blocking antibody were, therefore, a phenocopy of GRNcr1-iCre mice, which indi-cated that PD-1 expression mediated the GR-dependent protection of the host from infection-induced immunopathology.

The GR–PD-1–IFN-γ pathway prevents spleen immunopathol-ogy. PD-1-deficient mice infected with the murine hepatitis virus strain 3 are reported to have severe spleen and liver damage and high expression of FGL2, a molecule involved in fibrinogen deposi-tion28. By RT-qPCR, we found no difference in the expression of Fgl2 in spleen tissue homogenates after injection of the PD-1-blocking antibody into MCMV-infected wild-type C57BL/6 J mice relative to its expression in such homogenates of their counterparts given injection of the control antibody (data not shown). To further inves-tigate the mechanisms involved in the immunopathology observed in the MCMV-infected GRNcr1-iCre mice and mice treated with the PD-1-blocking antibody, we used a cytometric-bead array to mea-sure the concentration of inflammatory cytokines in serum, spleen and liver after infection. At 3 d after infection, the amount of the cytokines IL-6, TNF and IL-10 in the serum and tissues of MCMV-infected GRNcr1-iCre mice and those of wild-type mice treated with the PD-1-blocking antibody was similar to that of the WTNcr1-iCre mice and wild-type mice treated with the control antibody, respectively

(Supplementary Fig. 8). In contrast, we detected greater IFN-γ pro-duction in the spleen and serum, but not in the liver, of MCMV-infected GRNcr1-iCre mice and those of wild-type mice treated with the PD-1-blocking antibody than in that of WTNcr1-iCre mice and wild-type mice treated with the control antibody, respectively (Fig. 6f,g). To determine whether the NK cell–derived IFN-γ in the spleen of GRNcr1-iCre mice might have a role in spleen hyper-inflammation and immunopathology, we treated WTNcr1-iCre and GRNcr1-iCre mice with an IFN-γ -blocking antibody or an isotype-matched control anti-body (IgG1) on day 1 after infection, a time at which the HPA axis was activated. Histological analysis revealed substantial-to-severe inflammation in the spleen of IgG1-treated GRNcr1-iCre mice on day 3 after infection, with large and coalescing pyogranulomas and necrotic foci throughout the splenic parenchyma (Fig. 7a). We also observed destruction of the white pulp, including, in particular, the periarteriolar lymphoid sheath (PALS), which displayed decreased cellularity and atrophy in the severely affected areas and partial replacement by necrotic and granulomatous inflammation (Fig. 7a). Morphometric assessment of the PALS indicated that IgG1-treated GRNcr1-iCre mice had more-severe destruction of the splenic archi-tecture, with decreased surface of PALS areas on spleen sections, relative to that of IgG1-treated WTNcr1-iCre mice (Fig. 7b). In con-trast, GRNcr1-iCre mice treated with the IFN-γ -neutralizing antibody showed ‘rescue’ of their spleen immunopathology to a level similar

19 20

23 27

26 55

54 56

a

b

c

d

0

10

20

30

40

50

**

*

IFN

-γ+ c

ells

(%

)

WTNcr1-iCre GRNcr1-iCre

Ig PD-1 Ab

0

20

40

60

80

100

PD-L1-PE

Eve

nts

(% o

f max

)

0 103 104 105

100806040200

NK cells T cells

Macrophages DCs Neutrophils

B cells

0 103 104 105

250200150100

500

IFN-γ-BV421

FS

C-A

Ig

PD-1Ab

WTNcr1-iCre GRNcr1-iCre

WTNcr1-iCre GRNcr1-iCre

Ig

PD-1 Ab

0 103 104 105

250200150100500

IFN-γ-BV421

FS

C-A

Ig

PD-1Ab

WTNcr1-iCre GRNcr1-iCre

PD-L2-PE

Eve

nts

(% o

f max

)

0 103 104 105

100

80

60

40

20

0

IFN

-γ+ c

ells

(%

)

UI

MCMV

UI

MCMVNK cells T cells

Macrophages DCs Neutrophils

B cells

Fig. 5 | MCMV-induced IFN-γ production by spleen NK cells is regulated by a glucocorticoid–PD-1 axis. a,b, Flow-cytometry analysis of the surface expression of PD-L1 (a) or PD-L2 (b) on macrophages (CD11c–CD11b+F4/80+), dendritic cells (DCs) (CD11c+MHCIIhi), neutrophils (CD11c–CD11b+Ly6G+), NK cells (NK1.1+NKp46+CD49b+), B cells (CD19+) and T cells (CD3+NK1.1–) (above plots) from the spleen of wild-type mice at 44!h after injection of DMEM (UI) or MCMV (key). Data are from n!= !2 independent experiments. c,d, Flow-cytometry analysis of intracellular IFN-γ in NK cells from the spleen (c) and liver (d) of WTNcr1-iCre and GRNcr1-iCre mice (above plots) infected with MCMV and then treated with PD-1-blocking antibody (PD-1 Ab) or isotype-matched control antibody (Ig) (left margin), assessed at 44!h after infection directly ex vivo without re-stimulation in vitro (left), and frequency of IFN-γ -producing cells among those cells (right). Numbers adjacent to outlined areas (left) indicate percent IFN-γ + cells. Each symbol (right) represents an individual mouse. Data are representative of (left) or pooled from (right) four experiments with n!= !8 WTNcr1-iCre mice (Ig or PD-1 Ab), n!= !6 GRNcr1-iCre mice (Ig) and n!= !7 GRNcr1-iCre mice (PD-1 Ab) (c) or n!= !9 mice per genotype (Ig) and n!= !7 mice per genotype (PD-1 Ab) (d) (mean!± !s.e.m.). *P!< !0.05 (one-way ANOVA).

NATURE IMMUNOLOGY | VOL 19 | SEPTEMBER 2018 | 954–962 | www.nature.com/natureimmunology 959

ARTICLES NATURE IMMUNOLOGY

to that of WTNcr1-iCre mice given injection of IgG1 or the IFN-γ -neu-tralizing antibody (Fig. 7a,b). Thus, the glucocorticoids produced after infection with MCMV controlled the production of IFN-γ by spleen NK cells and IFN-γ -mediated spleen immunopathology.

DiscussionHere we found that endogenous glucocorticoids produced in response to infection with MCMV selectively induced the expres-sion of PD-1 in spleen NK cells and thus controlled their IFN-γ production and prevented the development of immunopathology

in the spleen. This regulatory pathway was organ specific and did not affect viral clearance.

PD-1 expression was induced in vitro on NK cells by treatment with glucocorticoids in combination with IL-15 and IL-18, and this effect was abolished when IL-12 was also present. Consistent with that, different inflammatory profiles were observed in the spleen versus the liver of MCMV-infected mice in vivo. Although in vitro experiments cannot reproduce the complex combination of events that occur in the tissues in vivo after infection, they defined the con-ditions under which PD-1 expression can be induced on NK cells.

a b dc

e

f

Spleen Liver0123456789

10

Ie1

copy

num

ber

(per

mg,

log)

WTNcr1-iCre

GRNcr1-iCre

g

WTNcr1-iCre

GRNcr1-iCre

IFN

-γ (

ng/m

g)

Liver

0

100

200

300

400

500

Spleen

0

1

2

3

*IF

N-γ

(µg/

mg)

Spleen

IFN

-γ (µ

g/m

g)

0

1

2

3

4

*

0

50

100

150

200

**

Serum

IFN

-γ (

pg/m

l)

Serum

IFN

-γ (

pg/m

l)

0

100

200

300

400

*

Liver

Spleen

Ig

PD-1 Ab

Ig

PD-1 Ab

Ie1

copy

num

ber

(per

mg,

log)

Ig

PD-1 Ab

Spleen Liver0123456789

10

0

50

100

150

200Liver

IFN

-γ (

ng/m

g)

Ig

PD-1 Ab

Ig

PD-1 Ab

Time after infection (d)

0 2 4 6 8

Sur

viva

l (%

)

20

50

75

100

**

0 2 4 6 8

Time after infection (d)

Sur

viva

l (%

)

**

WTNcr1-iCre

GRNcr1-iCre

0

20

50

75

100

Fig. 6 | The glucocorticoid–PD-1 regulatory pathway is required for protection against infection with MCMV. a,b, Survival of WTNcr1-iCre and GRNcr1-iCre mice (key) infected with MCMV (LD50) (a) or of wild-type infected with MCMV (LD50) and then given injection of PD-1-blocking antibody or isotype-matched control antibody (key) (b), assessed at various times (horizontal) after infection. Data are pooled from three experiments with n!= !13 mice (a) or two experiments with n!= !11 mice (Ig) and n!= !10 mice (PD-1 Ab) (b). **P!< !0.01 (two-tailed log-rank Mantel-Cox test). c,d, qPCR analysis of Ie1 (as in Fig. 2e), assessing viral titers in the spleen and liver (horizontal axis) of mice as in a (c) or b (d) (key) at 3 d after infection. Each symbol represents an individual mouse. Data are pooled from two experiments with n!= !6 WTNcr1-iCre mice and n!= !9 GRNcr1-iCre mice (c) or n!= !9 mice (Ig) and n!= !10 mice (PD-1 Ab) (d) (mean!± !s.e.m). e, Histology (H&E staining) of the spleen and liver (left margin) of mice as in b (right margin), assessed 3 d after infection (right, enlargement of areas outlined at left); similar results were obtained with two different anti-PD-1 clones (J43 and RMP1-14). Scale bars, 100!μ m. Data are from n!= !4 mice (Ig) and n!= !5 mice (PD-1 Ab). f,g, Cytometric-bead array of IFN-γ in the serum, spleen and liver (above plots) of mice as in a (f) or b (g) (key) at 3 d after infection. Each symbol represents an individual mouse. Data are pooled from two experiments (serum) or three experiments (spleen and liver) with n!= !7 WTNcr1-iCre mice (serum), n!= !8 GRNcr1-iCre mice (serum), n!= !8 WTNcr1-iCre mice (spleen and liver) and n!= !14 GRNcr1-iCre mice (spleen and liver) mice (f; mean!± !s.e.m.) or are pooled from two experiments with n!= !7 mice (Ig, serum), n!= !8 mice (PD-1 Ab, serum) and n!= !9 mice (spleen and liver) (g; mean!± !s.e.m.). *P!< !0.05 and **P!< !0.01 (two-tailed Mann-Whitney test (serum) or two-tailed Student’s t-test (spleen)).

NATURE IMMUNOLOGY | VOL 19 | SEPTEMBER 2018 | 954–962 | www.nature.com/natureimmunology960

ARTICLESNATURE IMMUNOLOGY

The correlation between the effect of the cytokines in vitro and their organ-specific expression in vivo suggests that distinct combinations of inflammatory or homeostatic cytokines could act together with corticosterone to induce PD-1 expression on NK cells in the spleen. Characterization of the precise inflammatory context involved in the corticosterone-induced regulation of PD-1 expression in vivo will require further investigation. For example, PD-1 was expressed on spleen NK cells in vivo despite the induction of Il12 mRNA in this organ. Although we did not measure IL-12 at the protein level, it is possible that different concentrations of recombinant IL-12 in vitro and in the NK cell microenvironment in vivo mediate different effects. We detected the expression of Il18 transcripts in the spleen and liver in vivo but did not detect a significant increase in the tran-scription of this cytokine-encoding gene in either organ at 44 h after infection. However, as IL-18 is synthesized as an inactive precursor that requires proteolytic cleavage to produce the biologically active

cytokine29, it is possible that expression of the mature IL-18 pro-tein is regulated at the tissue level. In line with that, expression of mature IL-18 has been reported to be higher in the spleen than in the liver after infection with MCMV30, which would provide a pos-sible explanation for the organ-specific induction of PD-1 expres-sion on spleen NK cells.

In the hematopoietic lineage, the regulation of PD-1 expression by glucocorticoids during the early stage of infection with MCMV seemed to be restricted to NK cells. It would be useful to determine whether endogenous glucocorticoids induce PD-1 expression on various immune cells, including T cells, in other pathological con-texts, as PD-1 expression has been reported on several subsets of immune cells in other models of viral infection28,31,32. PD-1 expres-sion is upregulated on T cells during various conditions of activa-tion26. The lack of PD-1 induction on T cells early during infection with MCMV observed here would be expected, as T lymphocytes are activated during the later phase of such infection17. Moreover, treatment with various combinations of inflammatory cytokines and corticosterone in vitro did not induce PD-1 expression on T cells. Thus, the GR-induced regulation of PD-1 was specific to NK cells in these conditions.

We found that the GR-dependent induction of PD-1 expression on spleen NK cells was needed to control the production of IFN-γ in these cells, which prevented IFN-γ -dependent immunopathology in the spleen. However, the viral load in the spleen of GRNcr1-iCre mice was similar to that in their WTNcr1-iCre (control) littermates, which indicated that the downregulation of IFN-γ production by the HPA axis did not compromise the control of viral replication. Similarly, blockade of PD-1 in wild-type mice resulted in a phenocopy of the spleen hyper-inflammation seen in GRNcr1-iCre mice, and it did not modify the viral load. Consistent with those results, published stud-ies have shown that spleen NK cells exert their antiviral effects in a perforin-dependent manner, suggestive of a major role for cytotoxic mechanisms in this organ33. Activation of GR had no effect on the cytotoxic activity of NK cells, which would suggest decoupling of the actions of glucocorticoids on the main antiviral functions of NK cells. In the liver, IFN-γ production by NK cells is a major mecha-nism for the control of MCMV replication15,33,34. Despite high con-centrations of corticosterone in the serum, PD-1 expression was not upregulated in liver NK cells, and the IFN-γ production of these cells was unaffected. Therefore, the dampening of NK cell func-tion by the HPA axis did not affect the effectiveness of the anti-viral response in either the spleen or the liver.

The glucocorticoid-dependent induction of PD-1 expression on NK cells during infection with MCMV is a previously unrecognized mechanism by which the HPA axis suppresses immunopathology and promotes disease resistance without compromising protective immunity. It will be important to evaluate the role of this pathway in other infectious conditions and in people with inflammatory diseases. Along that line, a population of PD-1+ NK cells has been identified in healthy donors seropositive for human CMV35, in peo-ple seropositive for human immunodeficiency virus type 136 and in patients with Kaposi sarcoma37, but the mechanisms by which PD-1 expression is regulated on these cells remain to be addressed. It will be also useful to analyze whether PD-1 expression on immune cells is associated with the immunological dysfunctions observed in peo-ple in other conditions in which the HPA axis is activated, such as psychological distress and tissue damage38.

Novel immunotherapies that act through the blockade of immu-nological checkpoints such as PD-1 have yielded outstanding results for advanced cancer39,40. In patients with cancer, inflammatory reac-tions can be managed with immunosuppressive agents, such as cor-ticosteroids39. It will be important to determine in which conditions and on which cells PD-1 expression can be induced by such treat-ments. Such an analysis could make it possible to identify additional pathological situations in which treatment with antibodies to PD-1

a

bWTNcr1-iCre

GRNcr1-iCre

PA

LS (

%)

**

0

10

20

30

40

50

IgG1

GRNcr1-iCreWTNcr1-iCre

IgG1

IFN-γ Ab

IFN-γ Ab

Fig. 7 | IFN-γ neutralization prevents spleen immunopathology in GRNcr1-iCre mice. a, Histology (H&E staining) of the spleen of WTNcr1-iCre and GRNcr1-iCre mice (above plots) infected with MCMV (LD50), then, 1 d later, treated with IFN-γ -neutralizing antibody (IFN-γ Ab) or isotype-matched control antibody (IgG1) (left margin), assessed 3 d after infection. Scale bars, 500!μ m. b, Histopathological quantification of spleen inflammation in mice as in a, assessed by measurement of the area covered by PALS and presented as the proportion of the total area of the spleen section. Each symbol represents an individual mouse; small horizontal lines indicate the mean (!± !s.e.m.). *P!< !0.05 (one-way ANOVA). Data are pooled from two experiments with n!= !10 WTNcr1-iCre mice (IgG1), n!= !9 GRNcr1-iCre mice (IgG1), n!= !11 WTNcr1-iCre mice (IFN-γ Ab) and n!= !5 GRNcr1-iCre mice (IFN-γ Ab).

NATURE IMMUNOLOGY | VOL 19 | SEPTEMBER 2018 | 954–962 | www.nature.com/natureimmunology 961

ARTICLES NATURE IMMUNOLOGY

could be effective. Deeper understanding of the physiological and pathological conditions in which this glucocorticoid–PD-1 pathway exerts some beneficial or detrimental effects could provide a ratio-nal basis for the development of new therapeutic strategies.

MethodsMethods, including statements of data availability and any asso-ciated accession codes and references, are available at https://doi.org/10.1038/s41590-018-0185-0.

Received: 8 January 2018; Accepted: 20 July 2018; Published online: 20 August 2018

References 1. Medzhitov, R., Schneider, D. S. & Soares, M. P. Disease tolerance as a defense

strategy. Science 335, 936–941 (2012). 2. Webster, J. I., Tonelli, L. & Sternberg, E. M. Neuroendocrine regulation of

immunity. Annu. Rev. Immunol. 20, 125–163 (2002). 3. Irwin, M. R. & Cole, S. W. Reciprocal regulation of the neural and innate

immune systems. Nat. Rev. Immunol. 11, 625–632 (2011). 4. Cain, D. W. & Cidlowski, J. A. Immune regulation by glucocorticoids. Nat. Rev.

Immunol. 17, 233–247 (2017). 5. Weikum, E. R., Knuesel, M. T., Ortlund, E. A. & Yamamoto, K. R.

Glucocorticoid receptor control of transcription: precision and plasticity via allostery. Nat. Rev. Mol. Cell Biol. 18, 159–174 (2017).

6. Quatrini, L. et al. Host resistance to endotoxic shock requires the neuroendocrine regulation of group 1 innate lymphoid cells. J. Exp. Med. 214, 3531–3541 (2017).

7. Bhattacharyya, S., Brown, D. E., Brewer, J. A., Vogt, S. K. & Muglia, L. J. Macrophage glucocorticoid receptors regulate Toll-like receptor 4-mediated inflammatory responses by selective inhibition of p38 MAP kinase. Blood 109, 4313–4319 (2007).

8. Li, C. C., Munitic, I., Mittelstadt, P. R., Castro, E. & Ashwell, J. D. Suppression of dendritic cell-derived IL-12 by endogenous glucocorticoids is protective in LPS-induced sepsis. PLoS Biol. 13, e1002269 (2015).

9. Kleiman, A. et al. Glucocorticoid receptor dimerization is required for survival in septic shock via suppression of interleukin-1 in macrophages. FASEB J. 26, 722–729 (2012).

10. Jamieson, A. M., Yu, S., Annicelli, C. H. & Medzhitov, R. Influenza virus-induced glucocorticoids compromise innate host defense against a secondary bacterial infection. Cell Host Microbe 7, 103–114 (2010).

11. Ruzek, M. C., Miller, A. H., Opal, S. M., Pearce, B. D. & Biron, C. A. Characterization of early cytokine responses and an interleukin (IL)-6-dependent pathway of endogenous glucocorticoid induction during murine cytomegalovirus infection. J. Exp. Med. 185, 1185–1192 (1997).

12. Ruzek, M. C., Pearce, B. D., Miller, A. H. & Biron, C. A. Endogenous glucocorticoids protect against cytokine-mediated lethality during viral infection. J. Immunol. 162, 3527–3533 (1999).

13. Rhen, T. & Cidlowski, J. A. Antiinflammatory action of glucocorticoids–new mechanisms for old drugs. N. Engl. J. Med. 353, 1711–1723 (2005).

14. Orange, J. S. & Biron, C. A. Characterization of early IL-12, IFN-α β , and TNF effects on antiviral state and NK cell responses during murine cytomegalovirus infection. J. Immunol. 156, 4746–4756 (1996).

15. Orange, J. S. & Biron, C. A. An absolute and restricted requirement for IL-12 in natural killer cell IFN-? production and antiviral defense. Studies of natural killer and T cell responses in contrasting viral infections. J. Immunol. 156, 1138–1142 (1996).

16. Weizman, O. E. et al. ILC1 confer early host protection at initial sites of viral infection. Cell 171, 795–808 (2017).

17. Krmpotic, A., Bubic, I., Polic, B., Lucin, P. & Jonjic, S. Pathogenesis of murine cytomegalovirus infection. Microbes Infect. 5, 1263–1277 (2003).

18. Loh, J., Chu, D. T., O'Guin, A. K., Yokoyama, W. M. & Virgin, H. W. Natural killer cells utilize both perforin and ? interferon to regulate murine cytomegalovirus infection in the spleen and liver. J. Virol. 79, 661–667 (2005).

19. Biron, C. A. & Tarrio, M. L. Immunoregulatory cytokine networks: 60 years of learning from murine cytomegalovirus. Med. Microbiol. Immunol. (Berl.) 204, 345–354 (2015).

20. Tronche, F. et al. Disruption of the glucocorticoid receptor gene in the nervous system results in reduced anxiety. Nat. Genet. 23, 99–103 (1999).

21. Narni-Mancinelli, E. et al. Fate mapping analysis of lymphoid cells expressing the NKp46 cell surface receptor. Proc. Natl. Acad. Sci. USA 108, 18324–18329 (2011).

22. Spits, H. et al. Innate lymphoid cells–a proposal for uniform nomenclature. Nat. Rev. Immunol. 13, 145–149 (2013).

23. Ayroldi, E. & Riccardi, C. Glucocorticoid-induced leucine zipper (GILZ): a new important mediator of glucocorticoid action. FASEB J. 23, 3649–3658 (2009).

24. Delfino, D. V., Agostini, M., Spinicelli, S., Vito, P. & Riccardi, C. Decrease of Bcl-xL and augmentation of thymocyte apoptosis in GILZ overexpressing transgenic mice. Blood 104, 4134–4141 (2004).

25. Schmidt, S. et al. Glucocorticoid-induced apoptosis and glucocorticoid resistance: molecular mechanisms and clinical relevance. Cell Death Differ. 11, S45–S55 (2004).

26. Sharpe, A. H. & Pauken, K. E. The diverse functions of the PD1 inhibitory pathway. Nat. Rev. Immunol. 18, 153–167 (2017).

27. Arase, H., Mocarski, E. S., Campbell, A. E., Hill, A. B. & Lanier, L. L. Direct recognition of cytomegalovirus by activating and inhibitory NK cell receptors. Science 296, 1323–1326 (2002).

28. Chen, Y. et al. Programmed death (PD)-1-deficient mice are extremely sensitive to murine hepatitis virus strain-3 (MHV-3) infection. PLoS Pathog. 7, e1001347 (2011).

29. Okamura, H., Tsutsui, H., Kashiwamura, S., Yoshimoto, T. & Nakanishi, K. Interleukin-18: a novel cytokine that augments both innate and acquired immunity. Adv. Immunol. 70, 281–312 (1998).

30. Pien, G. C., Satoskar, A. R., Takeda, K., Akira, S. & Biron, C. A. Cutting edge: selective IL-18 requirements for induction of compartmental IFN-γ responses during viral infection. J. Immunol. 165, 4787–4791 (2000).

31. Frebel, H. et al. Programmed death 1 protects from fatal circulatory failure during systemic virus infection of mice. J. Exp. Med. 209, 2485–2499 (2012).

32. Erickson, J. J. et al. Viral acute lower respiratory infections impair CD8+ T cells through PD-1. J. Clin. Invest. 122, 2967–2982 (2012).

33. Tay, C. H. & Welsh, R. M. Distinct organ-dependent mechanisms for the control of murine cytomegalovirus infection by natural killer cells. J. Virol. 71, 267–275 (1997).

34. Orange, J. S., Wang, B., Terhorst, C. & Biron, C. A. Requirement for natural killer cell-produced interferon γ in defense against murine cytomegalovirus infection and enhancement of this defense pathway by interleukin 12 administration. J. Exp. Med. 182, 1045–1056 (1995).

35. Della Chiesa, M. et al. Features of memory-like and PD-1+ human NK cell subsets. Front. Immunol. 7, 351 (2016).

36. Norris, S. et al. PD-1 expression on natural killer cells and CD8+ T cells during chronic HIV-1 infection. Viral Immunol. 25, 329–332 (2012).

37. Beldi-Ferchiou, A. et al. PD-1 mediates functional exhaustion of activated NK cells in patients with Kaposi sarcoma. Oncotarget 7, 72961–72977 (2016).

38. Glaser, R. & Kiecolt-Glaser, J. K. Stress-induced immune dysfunction: implications for health. Nat. Rev. Immunol. 5, 243–251 (2005).

39. Sharma, P. & Allison, J. P. Immune checkpoint targeting in cancer therapy: toward combination strategies with curative potential. Cell 161, 205–214 (2015).

40. Sharma, P. & Allison, J. P. The future of immune checkpoint therapy. Science 348, 56–61 (2015).

AcknowledgementsWe thank F. Tronche (Sorbonne Universités, Université Pierre et Marie Curie, UMR_CR18, Neuroscience, Paris-Seine) for Nr3c1loxP/loxP mice; J. Galluso and P. Morganti for mouse breeding and genotyping; G. Bessou (Centre d’Immunologie de Marseille-Luminy) for the plasmid containing the Ie1 gene; and the Centre d’Immunologie de Marseille-Luminy mouse house and core cytometry facilities. This project received funding from the European Research Council under the European Union’s Horizon 2020 research and innovation program, under grant agreement 648768; from the Agence Nationnale de la Recherche (ANR-14-CE14-0009-01) and from the ARC foundation (PGA120140200817). This work was also supported by institutional grants from INSERM, CNRS, Aix-Marseille University and Marseille-Immunopole to the Centre d’Immunologie de Marseille-Luminy.

Author contributionsL.Q. designed and performed experiments and analyzed data; E.W. and J.F. performed experiments; B.E. performed RNA-based next-generation sequencing; L.C. processed the histology samples and C.L. performed pathological analysis of those samples; E.V. provided the Ncr1Cre mouse model and advice during the manuscript preparation; S.U. conceived of, designed and directed the study; L.Q. and S.U. wrote the manuscript; and all authors reviewed and provided input on the manuscript.

Competing interestsE.V. is a cofounder and employee of Innate Pharma.

Additional informationSupplementary information is available for this paper at https://doi.org/10.1038/s41590-018-0185-0.Reprints and permissions information is available at www.nature.com/reprints.Correspondence and requests for materials should be addressed to S.U.Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

NATURE IMMUNOLOGY | VOL 19 | SEPTEMBER 2018 | 954–962 | www.nature.com/natureimmunology962

ARTICLESNATURE IMMUNOLOGY

MethodsMice. Female mice on a C57BL/6 background were used in this study. Wild-type C57BL/6 J mice were purchased from Janvier Labs. Ncr1iCre/+Nr3c1loxP/loxP (GRNcr1-iCre) mice were generated as previously described6. Sex matched Ncr1iCre/+ littermates (WTNcr1-iCre) were used as controls for GRNcr1-iCre mice. In some experiments in which two to five mice per genotype per experimental condition were analyzed, mice from several litters were used. All the mice used were bred and maintained under specific pathogen-free conditions at the Centre d’Immunophenomique (Ciphe) de Marseille and the Centre d’Immunologie de Marseille Luminy. Mice were housed under a standard 12 h–12 h light-dark cycle with ad libitum access to food and water. Age-matched (7- to 10-week-old) and sex-matched littermates were used as controls. All experiments were conducted in accordance with institutional committee recommendations (Comité d’Ethique de Marseille n°14 - APAFiS #14260) and French and European guidelines for animal care.

Infection with MCMV. Stocks of Smith strain MCMV were generated by homogenizing salivary glands harvested from six-week-old BALB/c mice infected with 2.5 × 103 PFU of MCMV at the age of 3 weeks. Mice were infected at 2 p.m. by intraperitoneal injection of 103 PFU/g or 3 × 103 PFU/g (LD50) MCMV diluted in DMEM. Uninfected (UI) mice received DMEM only. For blockade of PD-1, 250 μ g anti-PD-1 (clone J43 or RMP1-14) or the appropriate isotype-matched control antibody (Armenian hamster IgG or IgG2a monoclonal antibody mAb clone 2A3) (all from BioXCell) were injected intraperitoneally into mice on day 1 after infection. For neutralization of IFN-γ , 500 μ g anti-IFN-γ (clone XMG1.2) or rat IgG1 (HRPN) (both from BioXCell) were injected intraperitoneally into mice on day 1 after infection. Spleens and livers were harvested after perfusion at various time points, and were processed for flow cytometry or histology analysis, or were weighed and homogenized for RNA or protein extraction. Organs were homogenized in a FastPrep-24 5 G homogenizer (MP Biomedicals).

Viral titers and q-RT-PCR. Organs were kept in RNAlater (Qiagen) after harvesting. RNA was extracted from organ homogenates with the RNeasy Fibrous Tissue Mini Kit (Qiagen) and was reverse-transcribed with the iScript cDNA Synthesis kit (Biorad). Viral titers were determined, by qPCR, as absolute levels of the MCMV gene Ie1 (F: 5′ GAGTCTGGAACCGAAACCGT3′ ; R: 5′ GTCGCTGTTATCATTCCCCAC3′ , Sigma) using the SYBR Green Master Mix (Takara). For analysis of the expression of Il15, Il12 and Il18, microfluidic quantitative real-time RT-PCR with the Biomark HD system (Fluidigm) was used. In briefly, pre-amplified cDNA (22 cycles) was diluted fivefold before analysis in a Flex Six IFC (Fluidigm) with Universal PCR Master Mix (Fluidigm) and ready-to-use primer and probe sets pre-developed by Applied Biosystems (TaqMan Gene Expression Assays): IL-15 (Mm00434226_m1), IL-12b (Mm00434174_m1), IL-18 (Mm00434226_m1) and GAPDH as a control (Mm99999915_g1). Ct values were calculated from the system’s software (BioMark Real-time PCR Analysis; Fluidigm).

In vitro splenocyte stimulation. Total splenocytes or spleen NK cells (enriched with the NK cell isolation kit from Miltenyi Biotech) from WTNcr1-iCre and GRNcr1-iCre mice were stimulated in vitro in complete culture medium (RPMI 10% FCS, 100 μ g/ml penicillin/streptomycin, 2 mM l-glutamine, 1 mM sodium pyruvate and 0.01 M Hepes) with the followng: 25 ng/ml IL-12 (eBiosciences), 25 ng/ml IL-15 (Peprotech) and 20 ng/ml IL-18 (MBL), alone or in combination; or PMA (200 ng/ml, Sigma) and ionomycin (1 μ g/ml, Sigma). For stimulation of NK1.1, 96-well plates (Immulon 2HB) were coated overnight at 37 °C with 2.5 μ l/well anti-NK1.1 (PK136, eBiosciences) or IgG2a isotype-matched control antibody (eBM2a, e Biosciences) before cell plating. During stimulation, 250 or 500 nM corticosterone (Sigma; dissolved in ethanol) or the same volume of vehicle alone were added to the medium. Cells were stimulated at 37 °C in the presence of Golgi Stop and Golgi Plug from BD Biosciences, and then were washed and stained for flow cytometry. For staining of CD107a, anti-CD107a-FITC (1D4B, BD Biosciences) was added, at a concentration of 2.5 μ l per well, during stimulation.

Cytokine levels in tissues. We measured IFN-γ , IL-6, TNF and IL-10 protein in organ homogenates by cytometric bead arrays, according to the manufacturer’s protocol (CBA, BD Biosciences). Results obtained in pg/ml were converted to μ g/mg or ng/mg of tissue, with consideration of the weight of the organ before homogenization.

Serum analysis. Blood was collected from the retro-orbital sinus of MCMV-infected mice under low-stress conditions (i.e., within 2 min of handling). After blood coagulation at room temperature, blood samples were centrifuged to separate the serum from the clot. Serum samples were analyzed with the Corticosterone ELISA Kit (Enzo), according to the manufacturer’s instructions, to determine corticosterone concentration, or were analyzed by cytometric bead array, according to the manufacturer’s protocol (CBA, BD Biosciences), to determine cytokine concentrations.

Flow cytometry. Single-cell suspensions were obtained from the spleen by scratching the spleen through 70- μ m cell strainer or from the liver by pressing

the liver through a 100-μ m cell strainer, followed by lymphocyte isolation on a 37.5–67.5% Percoll gradient. For isolation of cells from the lamina propria of the small intestine, intestines were cut longitudinally and then transversally in 2- to 3-cm pieces, were thoroughly rinsed with PBS and then were shaken for 30 min in PBS containing 10% FBS, 15 mM HEPES and 5 mM EDTA to remove intraepithelial and epithelial cells. Intestines were then digested with collagenase VIII (300 UI/ml; Sigma) in complete RPMI for 45 min at 37 °C under agitation, and lamina-propria lymphocytes were isolated on a 40–100% Percoll gradient. Cells were incubated with Fc-blocking antibody (2.4G2, BD Biosciences) and with a fixable blue dead-cell stain kit (Invitrogen). Surface molecules were stained with antibodies to the following: CD45.2 Alexa Fluor 700 (104), CD3 PE-CF594 and APC/Cy7 (145-2C11), CD19 PE-CF594 (1D3), NK1.1 BV510 (PK136), CD49a Alexa Fluor 647 (Ha31/8), CD11b BV510 (M1/70), MHCII BV605 (M5/114.15.2), TCRβ FITC (H57-597), PD-1 BV650 (J43, and hamster IgG2 isotype-matched control antibody (cat. number 563860)) and PD-L1 PE (MIH5) (all from BD Biosciences); NKp46 PerCP-eFluor 710 and PE/Cy7 (29A1.4), CD49b PE/Cy7 (DX5), F4/80 APC (BM8) and Ly49H APC (3D10) (all from eBioscience); CD11c PE/Cy7 (N418), CD19 APC/Cy7 (6D5), PD-1 PE (RMP1-30, and rat IgG2b isotype-matched control antibody (cat. number 12-4031-82)), PD-L2 PE (TY25) and Ly6G APC/Cy7 (1A8) (all from Biolegend). For intracellular staining, cells were fixed and permeabilized with an intracellular staining kit (eBioscience), and the following antibodies were used: anti-IFN-γ BV421 (XMG1.2) (from Biolegend); anti-granzyme B PE (GB11), anti-RORγ t PE-CF594 (Q31-378), anti-IL17 PE (TC11-18H10) and anti-Ki67 PE (B56) (all from BD Biosciences); anti-IL-22 (JOP eBioscience, coupled to Alexa Fluor 647 with an antibody labeling kit from Life Technologies); and anti-GR Alexa Fluor 488 XP rabbit monoclonal antibody (D8H2) and rabbit monoclonal antibody IgG Alexa Fluor 488 XP (DA1E) (both from Cell Signaling Technology). Stained samples were analyzed in a BD LSRII flow cytometer (BD Biosciences). Apoptosis was detected with the FITC Annexin V Apoptosis Detection Kit I from BD Biosciences, according to the manufacturer’s protocol.

The gating strategy for NCR1+ ILC3s is shown in Supplementary Fig. 2a; the gating strategy for the sorting of NCR1+ cells from the spleen and liver is shown in Supplementary Fig. 3; and the gating strategy for DCs, neutrophils and macrophages is shown in Supplementary Fig. 5a.

Histology. Tissues were fixed in 10% neutral buffered formalin for 24 h, then were dehydrated and embedded in paraffin. Sections of 3.5 μ m were cut using the microtome Leica RM2245. Hematoxylin–eosin (H&E) staining was effectuated automatically with Leica autostainer XL and slides were mounted with Entellan and were kept at room temperature. Histological slides of spleen and liver tissue were assessed by an anatomopathologist in a blinded way. For spleen inflammation grading, scores assigned on the basis of the severity, as follows: 0, normal spleen; 1, mild (multifocal pyogranulomas in marginal zones); 2, moderate (locally coalescing pyogranulomas in marginal zones with small necrotic foci); 3, substantial (large and coalescing pyogranulomas throughout the splenic parenchyma with extensive necrotic foci, PALS preserved); and 4, severe (extensive necrotic and pyogranulomatous foci, PALS partially replaced by necrotic and granulomatous inflammation). For grading of liver inflammation, scores were assigned on the basis of the severity as follows: 0, normal; 1, mild (multifocal pyogranulomatous hepatitis with scattered single necrotic hepatocytes); 2, moderate (multifocal to coalescing necrotic and pyogranulomatous hepatitis with intranuclear inclusions in hepatocytes); and 3, substantial (coalescing necrotic and pyogranulomatous hepatitis with intranuclear inclusions in hepatocytes). For the morphometric assessment of periarteriolar lymphoid sheath (PALS), the area of PALS and the total area of spleen section were measured using CaseViewer software from 3Dhistech. Analysis was done on pictures taken with a Nikon Eclipse Ci microscope, on random cross sections of the spleens.

Cell sorting and mRNAseq analysis. Splenocytes (after NK cell enrichment with the mouse NK Cell Isolation Kit II, Miltenyi Biotec) and liver lymphocytes were pooled from three mice for each genotype. A FACSAria III (BD Biosciences) was used to sort approximately 5 × 105 NK cells from the spleen and liver and 5 × 104 liver-resident ILC1s. Cells were sorted directly in RLT lysis buffer (Qiagen). Total RNA was prepared from purified ILC populations with an RNeasy Micro Kit (Qiagen). Three biological replicates were generated for all samples except the GRNcr1-iCre liver ILC1 samples (two biological replicates). Pre-amplification was performed with the SMART-Seq v4 Ultra Low-Input RNA Kit (Clontech). The DNA libraries were generated by double-indexing with the Nextera XT DNA Kit (Illumina), and RNA sequencing was performed with a NextSeq 500 (Illumina; paired-end reads 2 × 75 with 30 M reads per sample). The fastq files were assessed with the fastqc program and trimming was performed with Trimmomatics, to remove potential molecular barcodes, Illumina adapters and low-quality reads. Alignment was performed with two algorithms: first, with bowtie2 vs GRCm38 ensemble transcriptome, which resulted in a BAM that could be processed with the molecular index provided by the kit vendor; and second, with HiSat2 over the GRCm38 genome, for the detection of novel junction regions. Duplicates were detected and removed by MarkDuplicates from picard tools, and the number of reads mapped to each gene was determined with

NATURE IMMUNOLOGY | www.nature.com/natureimmunology

ARTICLES NATURE IMMUNOLOGY

featureCounts v1.5.2. Normalization and differential analysis were performed with DESeq2 v1.16.1. HalioDx (Marseille, France) processed the RNA samples and bioinformatics analyses were performed by the Centre d’Immunologie de Marseille-Luminy platform.

Statistical analysis. No sample size calculation was performed, but a reasonable sample size was chosen to ensure adequate reproducibility of results and was based on our previous studies. Mice were assigned to experimental groups according to sex and age. Statistical analysis was performed with Graphpad Prism 7 Software. Normality was tested with the Shapiro-Wilk test. Unpaired two-tailed Student’s t-tests were used if the data followed a Gaussian distribution with similar variances.

Mann-Whitney U tests were performed if this was not the case. One-way ANOVA was used for multigroup comparisons. Differences in survival were evaluated with Mantel-Cox tests. Differences were considered significant for P values less than 0.05.

Reporting Summary. Further information on experimental design is available in the Nature Research Reporting Summary linked to this article.

Data availability. The data that support the findings of this study are available from the corresponding author upon request. The RNA sequencing data have been deposited in the GEO repository under accession code GSE114827.

NATURE IMMUNOLOGY | www.nature.com/natureimmunology

1

nature research | reporting summ

aryApril 2018

Corresponding author(s): Sophie Ugolini

Reporting SummaryNature Research wishes to improve the reproducibility of the work that we publish. This form provides structure for consistency and transparency in reporting. For further information on Nature Research policies, see Authors & Referees and the Editorial Policy Checklist.

Statistical parametersWhen statistical analyses are reported, confirm that the following items are present in the relevant location (e.g. figure legend, table legend, main text, or Methods section).

n/a Confirmed

The exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement

An indication of whether measurements were taken from distinct samples or whether the same sample was measured repeatedly

The statistical test(s) used AND whether they are one- or two-sided Only common tests should be described solely by name; describe more complex techniques in the Methods section.

A description of all covariates tested

A description of any assumptions or corrections, such as tests of normality and adjustment for multiple comparisons

A full description of the statistics including central tendency (e.g. means) or other basic estimates (e.g. regression coefficient) AND variation (e.g. standard deviation) or associated estimates of uncertainty (e.g. confidence intervals)

For null hypothesis testing, the test statistic (e.g. F, t, r) with confidence intervals, effect sizes, degrees of freedom and P value noted Give P values as exact values whenever suitable.

For Bayesian analysis, information on the choice of priors and Markov chain Monte Carlo settings

For hierarchical and complex designs, identification of the appropriate level for tests and full reporting of outcomes

Estimates of effect sizes (e.g. Cohen's d, Pearson's r), indicating how they were calculated

Clearly defined error bars State explicitly what error bars represent (e.g. SD, SE, CI)

Our web collection on statistics for biologists may be useful.

Software and codePolicy information about availability of computer code

Data collection BD FACS Diva 8.0.1 software was used for cytofluorimetric data collection.

Data analysis GraphPad Prism7 was used for the statistical analysis. FlowJo10 was used for the analysis of the FACS data. CaseViewer from 3dhistech was used for the morphometric assessment of histological slides. BioMark HD (Fluidigm) was used for gene expression analysis. HiSat2, bowtie2, MarkDuplicates, featureCounts v1.5.2 and DESeq v1.16.1 were used for bioinformatics analysis.

For manuscripts utilizing custom algorithms or software that are central to the research but not yet described in published literature, software must be made available to editors/reviewers upon request. We strongly encourage code deposition in a community repository (e.g. GitHub). See the Nature Research guidelines for submitting code & software for further information.

2

nature research | reporting summ

aryApril 2018

DataPolicy information about availability of data

All manuscripts must include a data availability statement. This statement should provide the following information, where applicable: - Accession codes, unique identifiers, or web links for publicly available datasets - A list of figures that have associated raw data - A description of any restrictions on data availability

The data that support the findings of this study are available from the corresponding author upon request. The RNA sequencing data have been deposited in the GEO repository under accession code GSE114827.

Field-specific reportingPlease select the best fit for your research. If you are not sure, read the appropriate sections before making your selection.

Life sciences Behavioural & social sciences Ecological, evolutionary & environmental sciencesFor a reference copy of the document with all sections, see nature.com/authors/policies/ReportingSummary-flat.pdf

Life sciences study designAll studies must disclose on these points even when the disclosure is negative.

Sample size No sample size calculation was performed, but a reasonable sample size was chosen to ensure adequate reproducibility of results and was based on our previous studies.

Data exclusions No data was excluded.

Replication Experiments were replicated several times with reproducible results, as indicated in each figure legend.

Randomization Mice were assigned to experimental groups according to sex and age.

Blinding In the in vivo experiments the investigators were not blinded to the genotype of the experimental groups. Anatomopathological analysis of histological samples was blinded.

Reporting for specific materials, systems and methods

Materials & experimental systemsn/a Involved in the study

Unique biological materials

Antibodies

Eukaryotic cell lines

Palaeontology

Animals and other organisms

Human research participants

Methodsn/a Involved in the study

ChIP-seq

Flow cytometry

MRI-based neuroimaging

AntibodiesAntibodies used The following antibodies were used for flow cytometry: CD45.2 (1:200, clone 104, #560693), CD3 (1:100, clone 145-2C11,

#562286 and #557596), CD19 (1:200, clone 1D3, #562291), NK1.1 (1:50, clone PK136, #563096), CD49a (1:400, clone Ha31/8, #562113), CD11b (1:400, clone M1/70, #562950), NKp46 (1:50, clone 29A1.4, #562850), MHCII (1:200, clone M5/114.15.2, #563413), TCRb (1:400, clone H57-597, #553171), PD1 (1:50, clone J43, #744546), Hamster IgG2 isotype control (1:50, clone B81-3, #563860), PDL1 (1:100, clone MIH5, #558091), granzyme B (1:50, clone GB11, #561142), Rorgt (1:100, clone Q31-378, #562684), IL17 (1:100, clone TC11-18H10, #559502), CD107a (1:60, clone 1D4B, #553793), Fc block CD16/CD32 (1:200, clone 24G2, #553142) and Ki67 (1:50, clone B56, #5560027) from BD Biosciences; NKp46 (1:50, clone 29A1.4, #46-3351-82 and #25-3351-82), CD49b (1:200, clone DX5, #103518), F4/80 (1:100, clone BM8, #17-4801-82), Ly49H (1:200, clone 3D10, #17-5886-82) and IL22 (1:200, clone IL22JOP, #16-7222-82 coupled to AlexaFluor647) from eBioscience; CD19 (1:200, clone 6D5, #115530), CD11c (1:200, clone N418, #117318), PD1 (1:50, clone RMP1-30, #109103), Rat IgG2b isotype control (1:50, clone RTK4530, #400607), PDL2 (1:100, clone TY25, #107206), Ly6G (1:200, clone 1A8, #127624), and IFN-g (1:100, clone XMG1.2,

3

nature research | reporting summ

aryApril 2018

#505829) from Biolegend; GR (1:50, clone D8H2, #12007) and rabbit mAb IgG XP (1:100, clone DA1E, #2795) from Cell Signaling Technology. For PD1 blockade experiments in vivo anti-PD1 antibody (clone J43 #BE0033-2 or clone RMP1-14 #BE0146) and Armenian Hamster IgG (#BE0091) or IgG2a mAb (clone 2A3, #BE0089) from BioXCell were used. For IFN-g neutralization in vivo anti-IFN-g (clone XMG1.2 #BE0055) or Rat IgG1 (clone HRPN #BE0088) both from BioXCell were used.

Validation All the antibodies used are from commercial sources and have been validated by the vendors. Validation data for species (mouse) and application (flow cytometry and in vivo injection) are available on the manufacturer's website.

Animals and other organismsPolicy information about studies involving animals; ARRIVE guidelines recommended for reporting animal research

Laboratory animals All mice used for experiments were females on a C57BL/6J genetic background and 7-10 weeks-old. Wild-type mice littermates (Ncr1iCre/+Nr3c1+/+) of GRNcr1-iCre mice (Ncr1iCre/+Nr3c1LoxP/LoxP) were used as a control of the mutant strain, or were purchased from Janvier Labs otherwise. All the mice used were bred and maintained under specific pathogen-free conditions at the Centre d’Immunophenomique (Ciphe) de Marseille and the Centre d’Immunologie de Marseille Luminy. Mice were housed under a standard 12 h:12 h light-dark cycle with ad libitum access to food and water. For the generation of stocks of Smith strain MCMV, female BALB/c mice were purchased from Janvier Labs and infected at 3 weeks of age.

Wild animals The study did not involve wild animals

Field-collected samples The study did not involve samples collected from the field.

Flow CytometryPlots

Confirm that:The axis labels state the marker and fluorochrome used (e.g. CD4-FITC).

The axis scales are clearly visible. Include numbers along axes only for bottom left plot of group (a 'group' is an analysis of identical markers).

All plots are contour plots with outliers or pseudocolor plots.

A numerical value for number of cells or percentage (with statistics) is provided.

Methodology

Sample preparation Single-cell suspensions were obtained from the spleen by scratching it through 70um cell strainer, or from the liver by scratching it through 100um cell strainer and subsequent lymphocyte isolation on a 37.5-67.5% Percoll gradient. For isolation of small intestine lamina propria cells, intestines were cut longitudinally, then transversally in 2-3 cm pieces, thoroughly rinsed with PBS, and shaken for 30 min in PBS containing 10% FBS, 15mM Hepes and 5mM EDTA to remove intraepithelial and epithelial cells. Intestines were then digested with collagenase VIII (300UI/ml) in complete RPMI for 45 min at 37'C under agitation, and lamina propria lymphocytes were isolated on a 40-100% Percoll gradient.

Instrument BD LSRII and BD FACSAria II

Software BD FACS Diva 8.0.1 software was used for data collection and FlowJo v.10 was used for data analysis.

Cell population abundance Post-sort cells were not reanalyzed because cells were sorted in RLT lysis buffer for RNA extraction

Gating strategy Among live, single, CD45+ cells, NK cells were gated as: CD3-CD19-NK1.1+NKp46+CD49b+ (and in the liver CD49a-); liver ILC1s were gated as: CD3-CD19-NK1.1+NKp46+CD49b-CD49a+ T cells were gated as: CD3+NK1.1- or TCRb+ B cells were gated as: CD19+ Neutrophils were gated as: CD11c-CD11b+Ly6G+ Macrophages were gated as: CD11c-CD11b+F480+ DCs were gated as: CD11c+MHCIIhi small intestine ILC3s were gated as: CD3-CD19-NKp46+Rorgt+

Tick this box to confirm that a figure exemplifying the gating strategy is provided in the Supplementary Information.