EoC Review Game

Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6

100 100 100 100 100 100

200 200 200 200 200 200

300 300 300 300 300 300

400 400 400 400 400 400

500 500 500 500 500 500

Unit 1 - 100

• If someone was interested in a career with responsibility to determine the cause of death, what careers should he or she consider and investigate?

Unit 1 - 200

• What is the structure of the body starting with the smallest unit and moving to the largest.

• (hint: Cell ______________________)

Unit 1 – 300

• Name at least 2 organs from and describe the function of the Respiratory System

• A system of organs, functioning in the process of gas exchange between the body and the environment, consisting especially of the nose, nasal passages, nasopharynx, larynx, trachea, bronchi, and lungs.

Unit 1 - 400

• Name at least 2 organs from and describe the function of the Digestive System

• The group of organs that break down foods into chemical components that the body can absorb and use for energy, and for building and repairing cells and tissues.

Unit 1 - 500

• Name at least 3 organs from and describe the function of the Cardiovascular System

• The transport system of the body responsible for carrying oxygen and nutrients to the body and carrying away carbon dioxide and other wastes; composed of the heart, blood vessels, and blood.

Unit 2 - 100

• What is a pump?

• A device that raises, transfers, delivers, or compresses fluids or gases especially by suction or pressure or both.

Unit 2 - 200• Name the structure at # 2

Superior Vena Cava

Unit 2 - 300

• What are the four major components of blood and what do they do?

• Plasma – liquid of blood• Platelets – clotting• White blood cells – immune system• Red blood cells – carry oxygen

Unit 2 - 400What is happening during the “T” wave?

Relaxation of the ventricles

Unit 2 - 500

• Fill in the blanks:• Body – Vena Cava – Right Atrium– Tricuspid

Valve – Right Ventricle– Pulmonary artery –Lungs – Pulmonary vein – Left atrium – Mitral/Bicuspid– Left ventricle – Aortic semilunar valve – Aorta – Body

Unit 3 - 100

• Where is insulin made and what is its function?

• Pancreas; Function: regulate blood sugar(regulate amount of sugar entering cell)

Unit 3 - 200

• This picture shows the process of ________.

hydrolysis

Unit 3 – 300

• Name the two types of enzymes we learned about in this class. Tell me which on is represented in the picture below.

Lock and Key modelInduced fit modelPicture shows a catabolic lock and key

Unit 3 - 400

• What are the monomers of the 4 different types of macromolecules?

• Proteins –Amino Acids• Nucleic acids – Nucleotides• Carbohydrates – Glucose• Lipids – Glycerol and Fatty acid chains

Unit 3 - 500

• Label the insulin/glucose model. Use the following labels: insulin, glucose, cell membrane, receptor molecule, glut4, mitochondrion, energy

Unit 4 - 100

• How many individuals have sickle cell disease?

3

Unit 4 - 200

• What is one symptom of sickle cell disease?• What is one complication of sickle cell

disease?

• Symptoms – low oxygen, pain in muscles• Complications – heart damage

Unit 4 - 300

• Who is Henrietta Lacks and describe how her cells are related to the idea of HIPAA.

• Source of the HeLa cell line. The use of her cells without her permission and tying her name to the cells

Unit 4 - 400

• If generation IV individual 3 married someone without sickle cell disease or sickle cell trait, what is the probability that their child would have sickle cell disease?

0%

Unit 4 - 500

• What is the third amino acid in the chain made by the DNA above?CACGTGGACTGAGGACTCTTCAGAG

Leucine

Unit 5 - 100

• What is the difference between saturated and unsaturated fats?

• Saturated – solid at room temperature, no double bonds in fatty acid chains

• Unsaturated – liquid at room temperature, at least one double bond in fatty acid chains

Unit 5 - 200

• Describe the health risks associated with elevated levels of LDL that have earned it the nickname of “bad cholesterol.”

• Low density lipoprotein ; travels slowly/builds up in blood stream; carries more cholesterol than HDL

Unit 5 - 300

• Which patient is:– Homozygous

recessive?• #3

– Homozygous dominant?• #2

– Heterozygous?• #1

DNA Markers

Normal Control

+FH Control

Patient #1

Patient #2

Patient #3

Unit 5 – 400• Based on the molecular

structures below, label each of the following as saturated, monounsaturated, or polyunsaturated

• Palmitic acid =– saturated

• Stearic acid =– saturated

• Oleic acid = – monounsaturated

• Linoleic acid =– polyunsaturated

Unit 5 - 500

• Explain the process and importance of Polymerase Chain Reaction (PCR) when dealing with small amounts of DNA

• Process: use restriction enzymes to find the specific piece of DNA you want to copy, replicate the DNA

• Importance: Amplify DNA so that we can use it in gel electrophoresis

Unit 6 - 100

• What are 3 differences between Viruses and Bacteria?

• Virus: not alive unless it’s in a host, cannot replicate on its own

• Bacteria: replicates by itself, prokaryotic

Unit 6 – 200

• How is a Gram + cell different than a Gram – cell?

• + = thick cell wall• - = thin cell wall

Unit 6 - 300

• Describe difference between broad spectrum and limited spectrum antibiotics

• Broad – works on many different types of bacteria

• Limited – works on only select types of bacteria

Unit 6 - 400

• Draw the basic structure of an animal virus and label the following parts clearly: capsid, DNA, protein keys

Unit 6 - 500• Describe the process of the Gram staining procedure.

• Step 1 – stain with purple stain• Step 2-wash • Step 3-stain with pink stain• Step 4-wash• Cells that are purple still = Gram + since they have a

thick cell wall• Cells that are pink = Gram – since they do not have a

thick cell wall