Upload
others
View
5
Download
0
Embed Size (px)
Citation preview
1
Eradication of hepatocellular carcinoma by NKG2D-specific CAR T-1
cells 2
3
Bin Sun1,2,3, #
, Dong Yang1,2, 3, #
, Hongjiu Dai3, #, *
, Xiuyun Liu2, Ru Jia
4, Xiaoyue Cui
2, 4
Wenxuan Li5, Changchun Cai
7, Jianming Xu
4, Xudong Zhao
1,2,6, * 5
1 Laboratory of tumor animal models and anti-aging, State Key Laboratory of 6
Biotherapy and Cancer Center, West China Hospital, Sichuan University, Chengdu 7
610041, Sichuan. China. 8
2 Key Laboratory of Animal Models and Human Disease Mechanisms of Chinese 9
Academy of Sciences/Key Laboratory of Bioactive Peptides of Yunnan Province, 10
Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 11
650223, China 12
3 Nanjing Kaedi Biotech Co. Ltd., Nanjing, Jiangsu 211100, China 13
4 Department of GI Oncology, the 307 Hospital of Academy of Military Medical 14
Science, Beijing 100071, China 15
5 College of Life Sciences, Sichuan University, Chengdu, Sichuan 610064, China 16
6 Center for Excellence in Animal Evolution and Genetics, Chinese Academy of 17
Sciences, Kunming 650223, China 18
7 Department of Gastroenterology, The Affiliated Hospital of Jiujiang University, 19
Jiujiang, Jiangxi 332000, China 20
21
# These authors contributed equally to the study. 22
23
Running title: NKG2D-BBz CAR-T eliminates hepatocellular cancer 24
25
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
2
Key words: NKG2D, NKG2DL, HCC, CAR-T cells 26
27
Financial Support 28
This work was financially supported by the National Natural Science Foundation of China 29
(U1702289 to X.Z., 81802976 to D.Y.) 30
31
*Co-corresponding authors 32
Hongjiu Dai, Ph.D. 33
NANJING KAEDI BIOTECH INC. 34
No. 18 Zhilan Road, Building #5 Room 402, Science Park, Jiangning District, Nanjing, 35
Jiangsu 211100, China 36
E-mail: [email protected] 37
Tel: +86-25-52187062 38
39
Xudong Zhao, Ph.D. 40
Kunming Institute of Zoology, the Chinese Academy of Sciences 41
No. 32 Jiaochang Donglu, Kunming, Yunnan 650223, P.R. China 42
E-mail: [email protected] 43
Tel: +86-871-68125430 44
45
46
Disclosure of Potential Conflicts of Interest 47
No potential conflicts of interest were disclosed. 48
49
Total number of figures: 6 50
Total number of tables: 0 51
Word count: 3460 52
53
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
3
54
Abstract 55
Despite the great success of chimeric antigen receptor T (CAR-T) cell therapy in the 56
treatment of hematological malignancies, CAR-T cell therapy is limited in solid 57
tumors, including hepatocellular carcinoma (HCC). NKG2D ligands (NKG2DLs) are 58
generally absent on the surface of normal cells but are overexpressed on malignant 59
cells, offering good targets for CAR-T therapy. Indeed, analysis of the Cancer 60
Genome Atlas and HCC tumor samples showed that the expression of most 61
NKG2DLs was elevated in tumors compared with normal tissues. Thus, we designed 62
a novel NKG2D-CAR comprising the extracellular domain of human NKG2D, 4-1BB 63
and CD3ζ signaling domains (BBz). NKG2D-BBz CAR-T cells efficiently killed the 64
HCC cell lines SMMC-7721 and MHCC97H in vitro, which express high levels of 65
NKG2DLs, whereas they less efficiently killed NKG2DL- silenced SMMC-7721 cells 66
or NKG2DL-negative Hep3B cells. Overexpression of MICA or ULBP2 in Hep3B 67
improved the killing capacity of NKG2D-BBz CAR-T cells. T cells expressing the 68
NKG2D-BBz CAR effectively eradicated SMMC-7721 HCC xenografts. 69
Collectively, these results suggested that NKG2D-BBz CAR-T cells could potently 70
eliminate NKG2DL-high HCC cells both in vitro and in vivo, thereby providing a 71
promising therapeutic intervention for NKG2DL-positive HCC patients. 72
73
74
Introduction 75
Liver cancer is the sixth most common cancer type and the fourth most common 76
cause of cancer-related deaths worldwide (1) Hepatocellular carcinoma (HCC) 77
accounts for more than 75–85% of all liver cancer cases (1). In developed countries, 78
approximately 40% of HCC patients are diagnosed at an early stage due to health 79
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
4
surveillance programs (2,3). According to the Barcelona Clinic Liver Cancer (BCLC) 80
staging system, many therapies, such as partial liver resection, transplantation, and 81
local ablation, have excellent effects on early-stage HCC patients (stages 0 and A), 82
providing median survival rates of 60 months and beyond (2,4). Unfortunately, most 83
HCC patients, especially in developing countries, are diagnosed at a later disease 84
stage because the symptoms of liver cancer are not obvious until it is in its later stages 85
(3,5). For more developed stages of HCC, only a few treatments have shown survival 86
benefits. Patients at intermediate stages (stage B) benefit from chemoembolization 87
and have an estimated median survival of 26 months (2,6). For patients at advanced 88
stages (stage C), only two therapies have been approved for clinical use by the Food 89
and Drug Administration (FDA), sorafenib as a frontline treatment and regorafenib as 90
a second line treatment (7,8); these drugs extend the overall survival of patients by 2-91
3 months but are often accompanied by treatment-induced adverse events,such as 92
hypophosphatemia, weight loss, hand–foot skin reaction, hypertension, etc. (7,8). 93
Therefore, novel strategies for the treatment of advanced HCC, such as 94
immunotherapy with PD-1 antibodies or Chimeric antigen receptor T (CAR-T) cells, 95
are currently being tested in clinical trials (2,3,9). 96
Immunotherapy is an effective treatment strategy for several cancers, including 97
HCC. For example, administration of a cytotoxic T-lymphocyte-associated protein 4 98
(CTLA-4) inhibitor enhances antitumor immunity in a murine HCC model, with a 99
tumor re-challenge rejection rate of 90% and an elimination rate of 50% for 100
metastatic tumor(10). In addition, nivolumab (a fully human programmed death-1 101
inhibitor) shows potential as a treatment for HCC with a manageable safety profile 102
(11). Chimeric antigen receptor T (CAR-T) cell therapy is another emerging 103
immunotherapeutic option for cancer treatment (2,3). CAR-T cells are engineered to 104
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
5
express a specific CAR, which recognizes tumor-associated antigens on the surface of 105
tumor cells and then kills these cells in a targeted manner (12). However, clinical 106
application of this approach requires the identification of the tumor-associated 107
antigens and the design of highly specific CARs. 108
CAR-T immunotherapy has shown promise in the fight against cancer, especially 109
for hematologic malignancies (12,13). Currently, the FDA has approved two CAR-T 110
therapies for blood cancer: Yescarta (axicabtagene cioleucel) developed by Kite 111
Pharma Inc. and Kymriah (tisangenlecleucel) developed by Novartis International AG 112
(14). However, insufficient persistence of tumor-specific antigens (15), heterogeneity 113
among tumor cells (16,17), presence of an immunosuppressive microenvironment 114
(16), and toxicity due to off-target effects currently (17) compromise the therapeutic 115
efficiency of CAR-T immunotherapy in solid cancers. There are a few of ongoing 116
preclinical studies of CAR-T therapies for HCC, which target the HCC associated 117
antigens GPC-3, MUC-1, and CEA. However, the clinical results of CAR-T cells in 118
HCC have been disappointing and associate with severe side effects (18). Therefore, 119
there is a need to further develop CAR-T therapies for the treatment of HCC. 120
NK group 2 member D (NKG2D) is a type II transmembrane-anchored C-type 121
lectin-like protein receptor expressed on natural killer (NK) cells, CD8+ T cells, 122
subsets of γδ T cells, and some autoreactive CD4+ T cells (19,20). NKG2D 123
recognizes its ligands (NKG2DLs), such as MHC I chain-related molecules A and B 124
(MICA and MICB) (21) and six cytomegalovirus UL16-binding proteins (ULBP1–6) 125
(22). NKG2DLs are generally absent on the surface of normal cells but are 126
overexpressed on tumor cells, and their expression can be further increased by 127
chemotherapy or radiation (23). Accordingly, NKG2DL is a potential target for CAR-128
T therapy. Previous studies have indicated that ligation of NKG2D with its ligands 129
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
6
can activate NK cells and stimulate T cells in vitro (24), and ectopic expression of 130
NKG2DLs on tumor cells was sufficient to cause tumor rejection mediated by NK 131
cells (25). NKG2D-expressing CARs exhibited robust anti-tumor efficacy in several 132
different xenograft models, including models of multiple myeloma (26), ovarian 133
carcinoma (27), osteosarcoma (28), glioblastoma (29), pancreatic cancer (30), and 134
relapsed/refractory acute myeloid leukemia (31). NKG2DLs are also overexpressed in 135
human HCC, and the expression is significantly and negatively associated with poor 136
prognosis or early recurrence (32,33). However, no NKG2D-CAR has been reported 137
for HCC treatment. Therefore, we designed a NKG2D-BBz CAR with high 138
specificity and selectivity for HCC, and evaluated its antitumor activities using HCC 139
cell lines in vitro and in a xenograft mouse model in vivo. 140
141
Materials and methods 142
143
Plasmid construction and lentiviral package 144
The lentiviral vectors pTomo-pCMV-MICA-IRES-EGFP and pTomo-pCMV-ULBP2-145
IRES-puro, which were used for overexpression of MICA and ULBP2 in Hep3B cells 146
as described below, were constructed in a pTomo vector backbone (Addgene, USA). 147
The full-length human MICA (accession_NM_000247, primer: F, 148
ATGGGGCTGGGCCCGGTCTT; R, CTAGGCGCCCTCAGTGGAGCCAG ) and 149
ULBP2 (accession_NM_025217, primer: F, ATGGCAGCAGCCGCCGCTACCAAG; 150
R, TCAGATGCCAGGGAGGATGAAG) sequences were PCR-amplified using 151
PrimeSTAR HS DNA Polymerase (Takara, China) and inserted into the plasmids 152
between the XbaI and BamHI restriction sites. For the MICA andULBP2 shRNA 153
plasmids, the target sequences were cloned into a plko.1 puro vector obtained from 154
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
7
Addgene according to the manufacturer’s protocol (http://www.addgene.org/8453/). 155
The target sequences were as follow: shMICA-1, GCAGAAGATGTCCTGGGAAAT; 156
shMICA-2, ATTCAATTCCCTGCCTGGAT; shULBP2-1, 157
CCTCCTCTTTGACTCAGAGAA; shULBP2-2, TGAGCACGGTCTTGATCAAAC. 158
A codon-optimized targeting domain comprising the extracellular domain of human 159
NKG2D or CD19 scFv (as shown in the Supplementary Table) was synthesized 160
(Idobio, China) and fused to a CAR backbone comprising a human CD8 hinge spacer 161
and transmembrane domain, 4-1BB co-stimulatory domain and CD3ζ (BBz) (as 162
shown in the Supplementary Table 1). The entire encoding sequence of the CAR 163
expression molecule (as shown in Supplementary Table 1) was cloned into the 164
lentiviral vector LentiGuide-Puro (Addgene, USA) between the SmaI and MluI 165
restriction sites to replace PuroR and an EF1a promoter was inserted in front of the 166
CAR sequences by SmaI single digestion. For lentiviral package, the lentiviral 167
plasmids were co-transfected into HEK293T cells with the packaging plasmids 168
psPAX2 and pCMV-VSVG (Addgene, USA) at a ratio of 10:8:5. Lentivirus were 169
harvested as described before (34). 170
171
Cell lines and culture 172
The human liver cancer cell lines SMMC-7721, Hep3B, and MHCC97H were 173
purchased from Guangzhou Jennio Biotech Co., Ltd. in March 2018 and validated 174
using short tandem repeat (STR) profiling in October 2018.Hep3B cells were infected 175
with pTomo-CMV-ULBP2-IRES-puro and pTomo-CMV-MICA-IRES-EGFP 176
lentivirus [multiplicity of infection (MOI) = 10] to generate Hep3B-ULBP2 and 177
Hep3B-MICA cell lines, respectively. SMMC-7721 cells were infected with pTomo-178
CMV-luciferase-IRES-puro, plko-shMICA, and plko-shULBP2 lentivirus (MOI = 10) 179
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
8
and subsequently selected by puromycin (1 μg/ml) for 2 weeks to generate SMMC-180
7721-luciferase, SMMC7721-shMICA, SMMC7721-shULPB2, and SMMC7721-181
shMICA-shULBP2 cell lines, respectively. Hep3B, Hep3B-MICA, and Hep3B-182
ULBP2 cells were cultured in Dulbecco’s modified Eagle’s medium (Life 183
Technologies, USA) supplemented with 10% FBS (Life Technologies, USA), 100 184
U/ml penicillin, and 100 mg/ml streptomycin sulfate (Life Technologies, USA). 185
SMMC-7721 and MHCC97H cells were cultured in RPMI1640 (Life Technologies, 186
USA) supplemented with 10% FBS, 100 U/ml penicillin, and 100 mg/ml 187
streptomycin sulfate. HEK293T cells used for lentiviral package were obtained from 188
A. Lasorella (The Institute for Cancer Genetics, Columbia University Medical Center) 189
in December 2011 and cultured in DMEM (Life Technologies, USA) supplemented 190
with 10% FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin sulfate. HEK293T 191
cells were not validated within the past year. All the cells were cultured at 37°C in a 192
humidified incubator with 5% CO2 and routinely confirmed to be Mycoplasma-free 193
by PCR. 194
195
Generation of CAR-T cells 196
Primary T cells were isolated from peripheral blood of three healthy donors and two 197
HCC patients using the RosetteSep™ Human T Cell Enrichment Cocktail 198
(STEMCELL, Canada) according to the manufacturer’s protocol. The purity of the 199
isolated cells was detected by flow cytometry using phycoerythrin-conjugated anti-200
human CD3 (Biolegend, 300408).T cells were cultured in RPMI1640 (Gibco, USA) 201
supplemented with 10% FBS, 100 U/ml penicillin, 100 mg/ml streptomycin sulfate, 202
and 200 U/ml IL-2 (PeproTech, USA). To generate CAR-T cells, T cells were 203
stimulated with CD3/CD28 beads (Life Technologies, USA) at a ratio of 1:1 for 48 h 204
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
9
and then infected with lentiviral particles at a MOI of 10. All the patient studies were 205
approved by the Institutional Review Board at Kunming Institute of Zoology, Chinese 206
Academy of Sciences (approved ID: SMKX-2019022) with written informed consent 207
obtained from participants and conducted in accordance with the international ethical 208
guidelines for biomedical research involving human subjects. 209
210
In vitro cytotoxicity assays 211
The specific cytotoxicity of the CAR-modified T cells was tested against the various 212
HCC cell lines at variable effector-to-target (E/T) ratios of 0.5:1, 1:1, 2:1, 4:1, and 213
8:1. After 16 h of culture in RPMI1640 (Gibco, USA) supplemented with 10% FBS, 214
100 U/ml penicillin, 100 mg/ml streptomycin sulfate, cytotoxicity was measured 215
using Cell-Mediated Cytotoxicity Fluorometric Assay Kit (BioVison, K315-100, 216
USA) according to the manufacturer’s protocol. 217
218
Flow cytometry 219
Cells were harvested, washed twice with 1× PBS, and resuspended in cold PBS 220
containing 2% FCS, 1% sodium azide (at a density of 1 × 106 cells/ml). Subsequently, 221
labelled primary antibodies were added into the cell suspension according to the 222
manufacturers’ instructions and incubated for 1h at 4℃ in the dark. To evaluate CAR 223
expression, CD19-BBz CAR-T cells and NKG2D-BBz CAR-T cells were incubated 224
with Alexa Fluor 647-conjugated goat anti-mouse F(ab)2 (Jackson 225
ImmunoResearch,115-606-006) and allophycocyanin (APC)-conjugated anti-226
NKG2D (Biolegend, 320808), respectively. APC-conjugated MICA (R&D Systems, 227
FAB1300A), MICB (R&D Systems, FAB1599A), ULBP1 (R&D Systems, 228
FAB1380A), ULBP2/5/6 (R&D Systems, FAB1298A), and ULBP3 (R&D Systems, 229
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
10
FAB1517A) were used to determine the expression of NKG2DLs on different HCC 230
cells. APC-anti-CD4 (Biolegend, 357408) and FITC-anti-CD8 (Biolegend, 344704) 231
were used to detect the ratio of CD4-positive to CD8-positive T cells. All flow 232
cytometry readings were performed on the BD LSR Fortessa system and analyzed 233
using FlowJo software. 234
Cell growth analysis 235
To detect the proliferation capacity, a 5-ethynyl-uridine (EdU)-labeling assay was 236
performed using Click-iT EdU imaging Kits (Invitrogen, C10337). Briefly, EdU was 237
added to the cell culture medium at a final concentration 10 μM and incubated for 1 h 238
at 37°C in a humidified incubator with 5% CO2. Then the cells were harvested and 239
fixed with 4% paraformaldehyde. Permeabilization was performed with 0.3% Triton 240
X-100 followed by incubation withClick-iT reaction cocktail containing Alexa 241
Fluor® azide for 30 min at room temperature. The EdU incorporation rate was 242
analyzed by flow cytometry. To measure the proportion of apoptotic cells, cells were 243
harvested, washed with 1× PBS, and resuspended at a density of 1 × 106 cells/ml. 244
Thereafter, 7-aminoactinomycin D (Sangon Biotech, E607304-0200, China) was 245
added according to the manufacturer’s protocol and the ratio of stained cell was 246
analyzed by flow cytometry. 247
Cytokine release assay 248
CD19-BBz CAR-T and NKG2D-BBz CAR-T cells were co-cultured with SMMC-249
7721 cells in RPMI1640 (Gibco, USA) supplemented with 10% FBS, 100 U/ml 250
penicillin, 100 mg/ml streptomycin sulfate at an E/T ratio of 0:1 and 5:1, respectively, 251
for 16 h. 10 μL of the supernatant was collected and the concentrations of IFN-γ (BD 252
Biosciences,550612), interleukin (IL)-10 (BD Biosciences,550613), tumor 253
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
11
necrosis factor (TNF)-α (BD Biosciences,550610), and IL-2 (BD Biosciences,254
550611) were determined using respective enzyme-linked immunosorbent assay 255
(ELISA) kits as described above according to the manufacturer instructions. The 256
quantification was performed on the Synergy H1 (BioTek, USA) by measuring 257
absorbance at 450 nm. 258
In vivo HCC xenograft model 259
All protocols were approved by the animal ethics committee of the Kunming Institute 260
of Zoology, Chinese Academy of Sciences. Five to six-week-old NOD-Prkdcscid
261
Il2rgtm1
/Bcgen mice (B-NDG) were purchased from Jiangsu Biocytogen Co., Ltd. 262
(Jiangsu, China). A total of 1 × 106 SMMC-7721-luciferase cells were suspended in 263
PBS containing 30% Matrigel (BD Bioscience) and subcutaneously injected into the 264
B-NDG mice. When the mean tumor bioluminescence reached ~5 × 106 265
photons/second at one-week after tumor cell injectiona, the mice were anesthetized 266
with 2.5% avertin by intraperitoneal injection (15 ml/kg) followed by the 267
intraperitoneal injection of 150 mg/kg D-luciferin (BioVison, USA). Ten minutes 268
later, bioluminescent signals were recorded using an in vivo imaging software (IVIS) 269
system (Lumina Xr, USA), and the mice were randomly divided into the following 270
four groups: (i) tail intravenous injection of 100 l of sterile saline only without T 271
cells; (ii) 1 × 107 non-transduced T cells (NTD) in sterile saline; (iii) 1 × 10
7 272
genetically modified CD19-BBz CAR-T cells in sterile saline (CD19-BBz CAR); and 273
(iv) 1 × 107 genetically modified NKG2D-BBz CAR-T cells in sterile saline 274
(NKG2D-BBz CAR). After that, the bioluminescent signals were measured 275
approximately every 10 days. The data were quantified using Living Image software 276
(Caliper Life Science, USA). The mice were sacrificed when the tumor volume 277
reached approximately 2000 mm3. 278
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
12
Tissue microarray and immunohistochemistry (IHC) Analysis 279
Immunohistochemistry analysis was performed as described previously (34). Briefly, 280
sections cut from paraffin-embedded samples were deparaffinized, rehydrated, and 281
processed for antigen retrieval with sodium citrate buffer (Beyotime, china). The 282
sections were blocked with 10% serum from the same species as the source of the 283
secondary antibody for 1 hour at room temperature and incubated with primary 284
antibodies at 4°C overnight. Then, the sections were washed thrice in TBS 0.025% 285
Triton with gentle agitation and incubated with secondary antibodies for 1 hour at 286
room temperature. Chromogenic staining was performed on the sections using 3,3′-287
Diaminobenzidine (Beyotime, P0203, china) according to the manufacturer’s 288
protocol. The OD-CT-DgLive02-002 microarray (Outdo Biotech, Shanghai, China) 289
containing 32 human liver cancer samples, HOrgN090PT02 microarray (Outdo 290
Biotech, Shanghai, China) containing 90 normal tissues from major human organs 291
(including the thyroid, tongue, esophagus, stomach, duodenum, colon, liver, pancreas, 292
trachea, lung, heart, artery, skeletal muscle, skin, seminal vesicle, prostate, testis, 293
bladder, brain, and spleen) and HLivH060CD03 microarray (Outdo Biotech, 294
Shanghai, China) containing 7 non-tumor cirrhotic liver tissues were immunostained 295
using anti-MICA (Abcam, ab93170, USA) at a dilution ratio of 1:200 or anti-ULBP2 296
(thermo fisher, PA5-47118, USA) at a dilution ratio of 1:50. To investigate the 297
persistence of the administrated human T cells in the mice, the sections of formalin-298
fixed, paraffin-embedded lung, liver, bone marrow, hippocampus, spleen, kidney, 299
pancreas, and tumor tissues from the CD19-BBz CAR-T group and NKG2D-BBz 300
CAR-T groups were immuno-stained using an CD3-ξ antibody (Santa Cruz 301
Biotechnology, sc-1239, USA) at a dilution ratio of 1:100. 302
Karyotype assays 303
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
13
NKG2D-BBz CAR-T cells were collected 10 days after infection with NKG2D-BBz 304
CAR and normal T cells were used as controls. Karyotype assays were conducted as 305
previously described (35). Briefly, cells were treated with colcemid (Sangon Biotech, 306
A600322, China) at 37℃ for 2 hours, then harvested, washed in 0.075mol/L KCl at 307
37℃ for 10 min. Then the cells were fixed in freshly prepared fixative 308
(methanol/glacial acetic acid = 3/1), dropped onto slides, and dried at room 309
temperature. The chromosome images were captured on the Olympus DP71 310
microscope. 311
Statistical analysis 312
All statistical analyses were performed using GraphPad Prism 7.0 statistical software. 313
The data were all presented as mean ± standard deviation (SD). Statistical differences 314
between two groups were analyzed using Student’s t-tests with Welch correction. 315
Statistical differences among three or more groups were analyzed by one-way 316
ANOVA with Sidak correction. Statistical significance was defined as *P ≤ 0.05,
**P ≤ 317
0.01, ***
P ≤ 0.001. 318
319
Results 320
NKG2DLs were overexpressed in human liver cancer 321
To clarify the expression of NKG2DLs in clinical samples, we analyzed the RNA-Seq 322
data of paired liver cancer and normal tissues from the Cancer Genome Atlas (TCGA; 323
N = 50). The results showed that MICA, MICB, ULBP1, ULBP2, ULBP4, and ULBP5 324
were upregulated compared with those in paired normal tissues (Supplemental Fig. 325
S1). Similarly, immunohistochemistry in human liver cancer specimens on the OD-326
CT-DgLive02-002 microarray chip showed that expression levels of MICA and 327
ULBP2 were elevated in 72% (23/32) and 97% (31/32) of the liver cancer tissues, 328
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
14
respectively (Fig. 1A, B). Although the leading cause of HCC is cirrhosis and most 329
HCC patients have liver cirrhosis, the expression of MICA and ULBP2 was absent in 330
non-tumor cirrhotic liver tissue (Supplemental Fig. S2). In addition, flow cytometry 331
showed that the expression levels of all NKG2DLs were low in the Hep3B cell line, 332
while MICA and ULBP2 were highly expressed in the SMMC-7721 and MHCC97H 333
cell lines (Fig. 1C). These results clearly supported the possibility of using NKG2DL 334
as a target in HCC therapy. 335
336
NKG2D-BBz CAR-T cells lysed HCC cells in a NKG2DL-dependent manner 337
We designed the lentiviral expression vectors encoding CD19-BBz and NKG2D-BBz 338
as shown in Fig. 2A. T cells were isolated from PBMCs of healthy donors, and 99.2% 339
of the cells were confirmed to be CD3-positive by flow cytometry (Supplemental Fig. 340
S3). After activation with CD3/28 beads for 48 h, T cells were infected with CD19-341
BBz and NKG2D-BBz lentivirus. After 72 h, CD19 and NKG2D-BBz CAR were 342
detected in 42.3% and 46.1% of the T cells, respectively (Fig. 2B). The results of the 343
cytotoxicity assay showed that at the E:T ratio of 8:1, NKG2D-BBz CAR-T cells 344
could efficiently lyse SMMC-7721 and MHHC97H cells (approximately 100%), but 345
not the NKG2DLs-negative Hep3B cell line (less than 30%). By contrast, CD19-BBz 346
CAR-T cells failed to initiate the specific lysis of these HCC cell lines (Fig. 2C). 347
Cytotoxic T cells secrete several cytokines upon killing target cells. To confirm the 348
specific cytotoxicity of NKG2D-BBz CAR-T cells, cytokine were assessed in the cell 349
culture medium, demonstrating that TNF-α, IFN-γ, IL-10, and IL-2 were significantly 350
increased in SMMC-7721 cells cultured with NKG2D-BBz CAR-T cells, but not in 351
the culture medium of CD19-BBz CAR-T or NTD T cells (Fig. 2D). 352
To investigate if the cytotoxicity of NKG2D-BBz CAR-T cell was positively 353
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
15
correlated with the cell surface expression of NKG2D ligands, lentiviral particles that 354
induced MICA or ULBP2 silencing were constructed and used to infect SMMC-7721 355
cells (Supplemental Fig. S4). Silencing MICA and ULBP2 in SMMC7721-shMICA-356
shULBP2 cells was confirmed by flow cytometry (MICA, 72.5%; ULBP2, 80.1%; 357
Fig 3A). Correspondingly, NKG2D-BBz CAR-T cells showed less potent cytotoxicity 358
against SMMC7721-shMICA-shULBP2 cells compared to other cell lines (Fig 3B). 359
Ectopic NKG2DL-expressed cell lines Hep3B-MICA and Hep3B-ULBP2 were also 360
generated (Fig 3C). The cytotoxicity of NKG2D-BBz CAR-T cells towards the 361
Hep3B-MICA or Hep3B-ULBP2 cells was greater than 60%, even at the lowest E:T 362
ratio of 0.5:1 (Fig 3D), whereas the cytotoxicity towards the wild-type Hep3B cells 363
was only about 4% at the same E:T ratio (Fig 3D). These data indicate that the 364
cytotoxicity of NKG2D-BBz CAR-T on HCC cells is NKG2DL-dependent. 365
366
NKG2D-BBz CAR-T cells suppressed the growth of SMMC-7721 xenografts 367
To explore the therapeutic efficacy of NKG2D-BBZ CAR-T cells in vivo, 368
subcutaneous xenografts were established by injecting transfected SMMC-7721-369
luciferase cells into B-NDG mice, followed by of the CAR T-cell therapy 7 days later. 370
In all mice receiving saline, NTD, or CD19-BBz CAR-T, SMMC-7721 xenografts 371
progressively grew. However, the xenografts in mice receiving NKG2D-BBz CAR-T 372
cells had delayed tumor growth than the three control groups. Overall, 50% (3/6) of 373
the mice showed no tumors 19 days after infusion with NKG2D-BBz CAR-T cells, 374
while the other three mice only had minimal residual tumor remaining (Fig. 4A, B). 375
At the end of the study, four out of the six mice in the group receiving the NKG2D-376
BBz CAR-T cells were tumor-free, and the other two mice had very small tumors 377
remaining with bioluminescence of approximately 5 × 106 photons/second (Fig. 4A, 378
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
16
B). Collectively, these data demonstrate that NKG2D-BBz CAR-T cells can 379
successfully inhibit the tumorigenesis of subcutaneous SMMC-7721 xenografts. 380
Since the direct interaction between CAR-T cells and cancer cells is necessary 381
for a therapeutic effect, human T cells in the xenograft tumor and normal tissues were 382
detected via immunohistochemistry using anti-CD3-ξ. The immunohistochemistry 383
results showed that NKG2D-BBz CAR-T cells accumulated in SMMC-7721 384
xenografts, while only small quantities of CD19-BBz CAR-T cells were found in 385
tumors. Human T cells were also detected in the bone marrow of both the NKG2D-386
BBz CAR-T and CD19-BBz CAR-T groups but were absent in the lung, liver, kidney, 387
and brain (Fig. 4C). These results indicate that NKG2D-BBz CAR-T cells 388
preferentially infiltrated and resided in the HCC tumors, correlating to the efficient 389
suppression of tumor growth. 390
391
NKG2D-BBz CAR-T cells derived from HCC patients showed antitumor activity 392
HCC patients have reported abnormalities in their lymphocyte function (36), thus 393
the antitumor activity of NKG2D CAR-T cells derived from HCC patient T cells 394
needed to be verified. Peripheral blood collected from two HCC patients without 395
radiotherapy and chemotherapy was used to isolate T cells. Compared with the T cells 396
of a healthy donor, the patients’ T cells proliferated more slowly (Supplemental Fig. 397
S5). The T cells were infected with CD19-BBz and NKG2D-BBz lentiviral particles 398
and the expression of CARs was detected by flow cytometry. The patients’ CAR-T 399
cells had similar CAR expression efficiency and CD4/CD8 ratios to that of T cells 400
derived from healthy donor (Supplemental Fig. S6&S7). To determine the 401
cytotoxicity of NKG2D-BBz CAR-T cells from different sources against HCC cells, 402
we incubated T cells with SMMC7721 cells at different E:T ratios. The results 403
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
17
showed that patients’ NKG2D CAR-T cell have a comparable antitumor activity with 404
NKG2D CAR-T cell derived from a healthy donor (Fig. 5A). Correspondingly, both 405
NKG2D-BBz CAR-T cells showed effective antitumor activity against xenografts 406
formed by SMMC-7721 cells in B-NDG mice (Fig. 5B&C). As expected, xenografts 407
treated with normal saline (NS), or NTD, CD19-BBz CAR-T cells derived from HCC 408
patients grew rapidly (Fig. 5B&C). 409
Safety evaluation of CAR-T cells 410
The expression of tumor-associated antigens on normal cells often leads to severe off-411
target effects from CAR-T therapy, limiting their clinical application (37). Analysis of 412
the HOrgN090PT02 microarray chip demonstrated the lack of MICA expression in 413
most human tissues (thyroid, tongue, esophageal epithelium, gastric mucosa, jejunal 414
mucous membrane, ileal mucous membrane, appendix, mucous membrane of the 415
rectum, liver, pancreas, trachea, lung, myocardium, artery, skeletal muscle, seminal 416
vesicle, prostate, bladder, testis, medulla oblongata, telencephalon, epencephal, 417
brainstem, and spleen) except for the skin (3/3) (Fig. 6A). Considering gene transfer 418
mediated by lentivirus can possibly induce genome instability and cell malignant 419
transformation, karyotype and proliferation assays were performed to evaluate the 420
safety of CAR expression by lentivral infection. NKG2D-BBz CAR-T cells 421
maintained a normal karyotype compared with that of untransduced T cells for up to 422
14 days post-transduction (Fig. 6B). At 72 h after infection with the lentivirus 423
expressing CD19-BBz CAR and NKG2D-BBz CAR, there were no significant 424
alterations detected in the proliferation and apoptotic status of T cells (Supplemental 425
Fig. S8). 426
427
Discussion 428
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
18
The potential therapeutic efficacy of NKG2D-based CAR-T cells has been tested in 429
several malignant tumors, but their efficacy in liver cancer has not been assessed until 430
now. In this study, we designed a novel NKG2D-BBz CAR using the extracellular 431
domain of NKG2D instead of the full-length sequence, followed by 4-1BB and CD3ζ, 432
and successfully produced NKG2D-BBz CAR-T cells that showed strong cytotoxicity 433
against HCC cell lines in vitro as well as a therapeutic effect against HCC cell 434
xenografts in vivo These results demonstrated that NKG2D-BBz CAR-T can 435
specifically eradicate HCC cells in an NKG2DL-dependent manner, providing a 436
scientific basis for proceeding to a clinical trial for NKG2DL-positive patients. 437
CAR-T immunotherapy has excellent effects in hematologic malignancies (38). 438
Accordingly, many studies have been performed to extrapolate the success to solid 439
tumors, yet few have shown success (39). To date, several tumor-associated antigens 440
(TAA) expressed in liver tumor cells have been exploited for CAR-T therapy, and 441
were demonstrated to lyse HCC cells in vitro and eliminate mouse xenografts in vivo, 442
including GPC-3 (40), MUC1 (41), AFP (42), and CEA (43). However, the clinical 443
results of CAR-T cells in the treatment of HCC have yielded poor therapeutic 444
responses (18,44). The immunosuppressive tumor microenvironment is one of the 445
main contributors to the limited antitumor effects of CAR-T in liver cancers (18,36). 446
NKG2D-based CAR-T cells eliminate the inhibitive tumor microenvironment through 447
the following mechanisms: 1) killing the tumor neovasculature expressing NKG2DLs 448
to ameliorate the microenvironment and enhance the immunotherapy effect (45); 2) 449
killing immunosuppressive myeloid-derived suppressor cells and regulatory T cells; 450
and 3) recruiting myeloid cells and activated macrophages to modulate the immune 451
tumor microenvironment (46,47). Tumor heterogeneity is a major cause of tumor 452
immune escape and often leads to recurrence and metastasis. NKG2D-based CAR-T 453
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
19
cells can target multiple ligands expressed in tumor cells and thus may be beneficial 454
for the radical treatment of tumors (48). T lymphocytes, both CD4+ T helper cells and 455
CD8+ cytotoxic T cells usually play an important role in tumor suppression, and a 456
significant decrease in T cell activity has been observed in HCC patients (36). 457
However, in the present study, the CD4+/CD8+ ratio in NKG2D CAR-T cells in HCC 458
patients was still within the normal range (from 0.39 to 7.43) (49). In addition, 459
NKG2D CAR-T derived from patient T cells showed strong killing activity 460
specifically toward liver cancer cells. These findings suggest NKG2D CAR-T as a 461
potential multi-functional CAR-T therapy. 462
A major concern of CAR-T cells in clinical practice is their potential off-tumor 463
effects. For example, treatment with the receptor tyrosine-protein kinase ERBB2-464
CART resulted in acute respiratory distress syndrome in a patient with colorectal liver 465
metastasis due to the expression of Erbb2 in the lungs (50). In addition, treatment of 466
CEA antigen-directed CAR-T cells in colon cancer patients resulted in severe colitis 467
due to antigen recognition of the normal colonic tissue (51). Therefore, the specificity 468
of TAAs is of great importance in the application of CAR-T therapy. Using a tissue 469
chip including 96 samples from 27 tissue types, we confirmed that MICA, one of the 470
most important NKG2DLs, is not expressed in most normal tissues, which is in line 471
with previous reports (52,53). MICA is localized in the cytoplasm of most MICA-472
positive epithelial cells (54), suggesting that these MICA-positive epithelial cells 473
would not be targeted by NKG2D-BBz CAR-T cells. CAR NKR-2 (developed by 474
Celyad) was the first-generation NKG2D CAR with infusion of full-length NKG2D, 475
DAP10, and the CD3ζ cytoplasmic domain. Although MICA was found to be slightly 476
expressed in the skin, a phase I clinical trial of NKR-2 (NCT02203825) revealed that 477
seven patients with acute myeloid leukemia and five patients with multiple myeloma 478
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
20
were successfully treated with NKR-2 cells without obvious toxicities or other 479
adverse events (55). These data demonstrated the safety of NKG2D-based CAR-T 480
therapy. 481
Taken together, this study clarified the therapeutic roles of NKG2D-BBz CAR-T 482
cells in preclinical HCC models. Considering the proven safety of NKG2D CAR-T 483
cells in clinical trials with other cancers, their use can be expected to be applied in 484
clinical trials for NKG2DL-positive patients. 485
486
Acknowledgements 487
We would like to thank Guolan Ma from the Public Technology Service Center, 488
Kunming Institute of Zoology, Chinese Academy of Sciences for her technical 489
support in the flow cytometric analysis. 490
491
References 492
1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer 493
statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 494
cancers in 185 countries. CA Cancer J Clin 2018;68(6):394-424 doi 495
10.3322/caac.21492. 496
2. Llovet JM, Zucman-Rossi J, Pikarsky E, Sangro B, Schwartz M, Sherman M, et al. 497
Hepatocellular carcinoma. Nat Rev Dis Primers 2016;2:16018 doi 498
10.1038/nrdp.2016.18. 499
3. Llovet JM, Montal R, Sia D, Finn RS. Molecular therapies and precision medicine for 500
hepatocellular carcinoma. Nat Rev Clin Oncol 2018;15(10):599-616 doi 501
10.1038/s41571-018-0073-4. 502
4. Yang JD, Roberts LR. Hepatocellular carcinoma: A global view. Nat Rev 503
Gastroenterol Hepatol 2010;7(8):448-58 doi 10.1038/nrgastro.2010.100. 504
5. Dimitroulis D, Damaskos C, Valsami S, Davakis S, Garmpis N, Spartalis E, et al. 505
From diagnosis to treatment of hepatocellular carcinoma: An epidemic problem for 506
both developed and developing world. World J Gastroenterol 2017;23(29):5282-94 507
doi 10.3748/wjg.v23.i29.5282. 508
6. Llovet JM, Real MI, Montana X, Planas R, Coll S, Aponte J, et al. Arterial 509
embolisation or chemoembolisation versus symptomatic treatment in patients with 510
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
21
unresectable hepatocellular carcinoma: a randomised controlled trial. Lancet 511
2002;359(9319):1734-9 doi 10.1016/S0140-6736(02)08649-X. 512
7. Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF, et al. Sorafenib in 513
advanced hepatocellular carcinoma. N Engl J Med 2008;359(4):378-90 doi 514
10.1056/NEJMoa0708857. 515
8. Bruix J, Qin S, Merle P, Granito A, Huang YH, Bodoky G, et al. Regorafenib for 516
patients with hepatocellular carcinoma who progressed on sorafenib treatment 517
(RESORCE): a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet 518
2017;389(10064):56-66 doi 10.1016/S0140-6736(16)32453-9. 519
9. Lee S, Loecher M, Iyer R. Immunomodulation in hepatocellular cancer. J Gastrointest 520
Oncol 2018;9(1):208-19 doi 10.21037/jgo.2017.06.08. 521
10. Chen ZB, Shen SQ, Peng BG, Tao JP. Intratumoural GM-CSF microspheres and 522
CTLA-4 blockade enhance the antitumour immunity induced by thermal ablation in a 523
subcutaneous murine hepatoma model. Int J Hyperther 2009;25(5):374-82 doi 524
10.1080/02656730902976807. 525
11. El-Khoueiry AB, Sangro B, Yau T, Crocenzi TS, Kudo M, Hsu C, et al. Nivolumab in 526
patients with advanced hepatocellular carcinoma (CheckMate 040): an open-label, 527
non-comparative, phase 1/2 dose escalation and expansion trial. Lancet 528
2017;389(10088):2492-502 doi 10.1016/S0140-6736(17)31046-2. 529
12. Maude SL, Frey N, Shaw PA, Aplenc R, Barrett DM, Bunin NJ, et al. Chimeric 530
antigen receptor T cells for sustained remissions in leukemia. N Engl J Med 531
2014;371(16):1507-17 doi 10.1056/NEJMoa1407222. 532
13. Curran KJ, Brentjens RJ. Chimeric antigen receptor T cells for cancer 533
immunotherapy. J Clin Oncol 2015;33(15):1703-6 doi 10.1200/JCO.2014.60.3449. 534
14. Yip A, Webster RM. The market for chimeric antigen receptor T cell therapies. Nat 535
Rev Drug Discov 2018;17(3):161-2 doi 10.1038/nrd.2017.266. 536
15. Kershaw MH, Westwood JA, Parker LL, Wang G, Eshhar Z, Mavroukakis SA, et al. A 537
phase I study on adoptive immunotherapy using gene-modified T cells for ovarian 538
cancer. Clinical Cancer Research 2006;12(20):6106-15 doi 10.1158/1078-0432.Ccr-539
06-1183. 540
16. Gilham DE, Debets R, Pule M, Hawkins RE, Abken H. CAR-T cells and solid tumors: 541
tuning T cells to challenge an inveterate foe. Trends Mol Med 2012;18(7):377-84 doi 542
10.1016/j.molmed.2012.04.009. 543
17. Kakarla S, Gottschalk S. CAR T cells for solid tumors: armed and ready to go? 544
Cancer J 2014;20(2):151-5 doi 10.1097/PPO.0000000000000032. 545
18. Chen Y, E CY, Gong ZW, Liu S, Wang ZX, Yang YS, et al. Chimeric antigen 546
receptor-engineered T-cell therapy for liver cancer. Hepatobiliary Pancreat Dis Int 547
2018;17(4):301-9 doi 10.1016/j.hbpd.2018.05.005. 548
19. Raulet DH. Roles of the NKG2D immunoreceptor and its ligands. Nat Rev Immunol 549
2003;3(10):781-90 doi 10.1038/nri1199. 550
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
22
20. Zhang J, Basher F, Wu JD. NKG2D Ligands in Tumor Immunity: Two Sides of a 551
Coin. Front Immunol 2015;6:97 doi 10.3389/fimmu.2015.00097. 552
21. Champsaur M, Lanier LL. Effect of NKG2D ligand expression on host immune 553
responses. Immunol Rev 2010;235(1):267-85 doi 10.1111/j.0105-2896.2010.00893.x. 554
22. El-Gazzar A, Groh V, Spies T. Immunobiology and conflicting roles of the human 555
NKG2D lymphocyte receptor and its ligands in cancer. J Immunol 2013;191(4):1509-556
15 doi 10.4049/jimmunol.1301071. 557
23. Dhar P, Wu JD. NKG2D and its ligands in cancer. Curr Opin Immunol 2018;51:55-61 558
doi 10.1016/j.coi.2018.02.004. 559
24. Bauer S, Groh V, Wu J, Steinle A, Phillips JH, Lanier LL, et al. Activation of NK cells 560
and T cells by NKG2D, a receptor for stress-inducible MICA. Science 561
1999;285(5428):727-9. 562
25. Cerwenka A, Baron JL, Lanier LL. Ectopic expression of retinoic acid early inducible-563
1 gene (RAE-1) permits natural killer cell-mediated rejection of a MHC class I-bearing 564
tumor in vivo. Proc Natl Acad Sci U S A 2001;98(20):11521-6 doi 565
10.1073/pnas.201238598. 566
26. Barber A, Zhang T, Megli CJ, Wu JL, Meehan KR, Sentman CL. Chimeric NKG2D 567
receptor-expressing T cells as an immunotherapy for multiple myeloma. Exp Hematol 568
2008;36(10):1318-28 doi 10.1016/j.exphem.2008.04.010. 569
27. Barber A, Zhang T, DeMars LR, Conejo-Garcia J, Roby KF, Sentman CL. Chimeric 570
NKG2D receptor-bearing T cells as immunotherapy for ovarian cancer. Cancer 571
Research 2007;67(10):5003-8 doi 10.1158/0008-5472.Can-06-4047. 572
28. Fernandez L, Metais JY, Escudero A, Vela M, Valentin J, Vallcorba I, et al. Memory T 573
Cells Expressing an NKG2D-CAR Efficiently Target Osteosarcoma Cells. Clinical 574
Cancer Research 2017;23(19):5824-35 doi 10.1158/1078-0432.Ccr-17-0075. 575
29. Weiss T, Schneider H, Silginer M, Steinle A, Pruschy M, Polic B, et al. NKG2D-576
Dependent Antitumor Effects of Chemotherapy and Radiotherapy against 577
Glioblastoma. Clin Cancer Res 2018;24(4):882-95 doi 10.1158/1078-0432.CCR-17-578
1766. 579
30. Demoulin B, Cook WJ, Murad J, Graber DJ, Sentman ML, Lonez C, et al. Exploiting 580
natural killer group 2D receptors for CAR T-cell therapy. Future Oncol 581
2017;13(18):1593-605 doi 10.2217/fon-2017-0102. 582
31. Sallman DA, Brayer J, Sagatys EM, Lonez C, Breman E, Agaugue S, et al. NKG2D-583
based chimeric antigen receptor therapy induced remission in a relapsed/refractory 584
acute myeloid leukemia patient. Haematologica 2018 doi 585
10.3324/haematol.2017.186742. 586
32. Kamimura H, Yamagiwa S, Tsuchiya A, Takamura M, Matsuda Y, Ohkoshi S, et al. 587
Reduced NKG2D ligand expression in hepatocellular carcinoma correlates with early 588
recurrence. J Hepatol 2012;56(2):381-8 doi 10.1016/j.jhep.2011.06.017. 589
33. Fang L, Gong JY, Wang Y, Liu RR, Li ZS, Wang Z, et al. MICA/B expression is 590
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
23
inhibited by unfolded protein response and associated with poor prognosis in human 591
hepatocellular carcinoma. J Exp Clin Canc Res 2014;33 doi ARTN 76 592
10.1186/s13046-014-0076-7. 593
34. Yang D, Sun B, Zhang XH, Cheng DM, Yu XP, Yan LZ, et al. Huwe1 Sustains 594
Normal Ovarian Epithelial Cell Transformation and Tumor Growth through the 595
Histone H1.3-H19 Cascade. Cancer Res 2017;77(18):4773-84 doi 10.1158/0008-596
5472.Can-16-2597. 597
35. Chou CH, Yang NK, Liu TY, Tai SK, Hsu DS, Chen YW, et al. Chromosome 598
instability modulated by BMI1-AURKA signaling drives progression in head and neck 599
cancer. Cancer Res 2013;73(2):953-66 doi 10.1158/0008-5472.CAN-12-2397. 600
36. Sachdeva M, Chawla YK, Arora SK. Immunology of hepatocellular carcinoma. World 601
J Hepatol 2015;7(17):2080-90 doi 10.4254/wjh.v7.i17.2080. 602
37. Bonifant CL, Jackson HJ, Brentjens RJ, Curran KJ. Toxicity and management in CAR 603
T-cell therapy. Mol Ther-Oncolytics 2016;3 doi UNSP 16011 604
10.1038/mto.2016.11. 605
38. Gauthier J, Yakoub-Agha I. Chimeric antigen-receptor T-cell therapy for 606
hematological malignancies and solid tumors: Clinical data to date, current limitations 607
and perspectives. Curr Res Transl Med 2017;65(3):93-102 doi 608
10.1016/j.retram.2017.08.003. 609
39. Harper K. CAR T-cell Therapy for Solid Tumors? Cancer Discov 2018;8(11):1341- doi 610
Doi 10.1158/2159-8290.Cd-Nd2018-008. 611
40. Gao H, Li K, Tu H, Pan X, Jiang H, Shi B, et al. Development of T cells redirected to 612
glypican-3 for the treatment of hepatocellular carcinoma. Clin Cancer Res 613
2014;20(24):6418-28 doi 10.1158/1078-0432.CCR-14-1170. 614
41. Ma YD, Wang Z, Gong RZ, Li LF, Wu HP, Jin HJ, et al. Specific cytotoxicity of MUC1 615
chimeric antigen receptor-engineered Jurkat T cells against hepatocellular 616
carcinoma. 2014. 1177-82 p. 617
42. Liu H, Xu Y, Xiang J, Long L, Green S, Yang Z, et al. Targeting Alpha-Fetoprotein 618
(AFP)-MHC Complex with CAR T-Cell Therapy for Liver Cancer. Clin Cancer Res 619
2017;23(2):478-88 doi 10.1158/1078-0432.CCR-16-1203. 620
43. Burga RA, Thorn M, Point GR, Guha P, Nguyen CT, Licata LA, et al. Liver myeloid-621
derived suppressor cells expand in response to liver metastases in mice and inhibit 622
the anti-tumor efficacy of anti-CEA CAR-T. Cancer Immunol Immunother 623
2015;64(7):817-29 doi 10.1007/s00262-015-1692-6. 624
44. Li K, Lan Y, Wang J, Liu L. Chimeric antigen receptor-engineered T cells for liver 625
cancers, progress and obstacles. Tumour Biol 2017;39(3):1010428317692229 doi 626
10.1177/1010428317692229. 627
45. Zhang T, Sentman CL. Mouse tumor vasculature expresses NKG2D ligands and can 628
be targeted by chimeric NKG2D-modified T cells. J Immunol 2013;190(5):2455-63 doi 629
10.4049/jimmunol.1201314. 630
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
24
46. Barber A, Rynda A, Sentman CL. Chimeric NKG2D Expressing T Cells Eliminate 631
Immunosuppression and Activate Immunity within the Ovarian Tumor 632
Microenvironment. Journal of Immunology 2009;183(11):6939-47 doi 633
10.4049/jimmunol.0902000. 634
47. Spear P, Barber A, Rynda-Apple A, Sentman CL. Chimeric Antigen Receptor T Cells 635
Shape Myeloid Cell Function within the Tumor Microenvironment through IFN-gamma 636
and GM-CSF. Journal of Immunology 2012;188(12):6389-98 doi 637
10.4049/jimmunol.1103019. 638
48. Soriani A, Fionda C, Ricci B, Iannitto ML, Cippitelli M, Santoni A. Chemotherapy-639
elicited upregulation of NKG2D and DNAM-1 ligands as a therapeutic target in 640
multiple myeloma. Oncoimmunology 2013;2(12) doi ARTN e26663 641
10.4161/onci.26663. 642
49. Amadori A, Zamarchi R, Desilvestro G, Forza G, Cavatton G, Danieli GA, et al. 643
Genetic-Control of the Cd4/Cd8 T-Cell Ratio in Humans. Nat Med 1995;1(12):1279-644
83 doi DOI 10.1038/nm1295-1279. 645
50. Morgan RA, Yang JC, Kitano M, Dudley ME, Laurencot CM, Rosenberg SA. Case 646
report of a serious adverse event following the administration of T cells transduced 647
with a chimeric antigen receptor recognizing ERBB2. Mol Ther 2010;18(4):843-51 doi 648
10.1038/mt.2010.24. 649
51. Parkhurst MR, Yang JC, Langan RC, Dudley ME, Nathan DAN, Feldman SA, et al. T 650
Cells Targeting Carcinoembryonic Antigen Can Mediate Regression of Metastatic 651
Colorectal Cancer but Induce Severe Transient Colitis. Molecular Therapy 652
2011;19(3):620-6 doi 10.1038/mt.2010.272. 653
52. Groh V, Bahram S, Bauer S, Herman A, Beauchamp M, Spies T. Cell stress-654
regulated human major histocompatibility complex class I gene expressed in 655
gastrointestinal epithelium. Proc Natl Acad Sci U S A 1996;93(22):12445-50. 656
53. Groh V, Rhinehart R, Secrist H, Bauer S, Grabstein KH, Spies T. Broad tumor-657
associated expression and recognition by tumor-derived gamma delta T cells of 658
MICA and MICB. Proc Natl Acad Sci U S A 1999;96(12):6879-84. 659
54. Hue S, Mention JJ, Monteiro RC, Zhang S, Cellier C, Schmitz J, et al. A direct role for 660
NKG2D/MICA interaction in villous atrophy during celiac disease. Immunity 661
2004;21(3):367-77 doi 10.1016/j.immuni.2004.06.018. 662
55. Nikiforow S, Werner L, Murad J, Jacobs M, Johnston L, Patches S, et al. Safety Data 663
from a First-in-Human Phase 1 Trial of NKG2D Chimeric Antigen Receptor-T Cells in 664
AML/MDS and Multiple Myeloma. Blood 2016;128(22). 665
666
Figures 667
668
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
25
Figure 1. NKG2D ligands were overexpressed in liver cancer. The 32 liver cancer 669
specimens in the OD-CT-DgLive02-002 microarray were stained with MICA 670
antibody (A) and ULBP2 antibody (B), respectively. The samples with overexpression 671
of MICA or ULBP2 are marked with a triangle, scale bar = 500 μm. (C) NKG2D 672
ligand expression in Hep3B, SMMC-7721, and MHCC97H cell lines was detected by 673
flow cytometry. Data are representative or two independent experiments. Percentage 674
of positive cells is detailed in the histograms. 675
676
Figure 2. NKG2D-BBz CAR-T cells efficiently lysed HCC cells. (A) Schematic 677
representation of CD19-BBz CAR and NKG2D-BBz CAR. (B) CD19 and NKG2D 678
CAR expression on human T cells transduced with a lentivirus and analyzed using 679
flow cytometry. Data are representative of three independent experiments. Percentage 680
of positive cells is detailed in the histograms. (C). Primary human T cells transduced 681
with the indicated lentivirus were co-incubated with the three HCC cell lines at 682
varying effector: target (E: T) ratios for 16 h, respectively. Cell lysis was determined 683
by a standard nonradioactive cytotoxic assay. Two independent experiments were 684
performed. Data are presented as the mean ± SD of triplicates, statistical significance 685
between the NKG2D-BBz group and the other two groups was calculated using one-686
way ANOVA with Sidak correction, * P < 0.05, *** P < 0.001. (D) Cytokines released 687
in the co-culture supernatant by NTD, CD19-BBz, and NKG2D-BBz CAR-T cells 688
when co-cultured with SMMC-7721 cells at E:T ratios of 0:1 and 5:1; TNF-α, IL-10, 689
IL-2, and IFN-γ were detected in the supernatant collected 16 h after the culture. Two 690
independent experiments were performed. Data are presented as the mean ± SD of 691
triplicates and analyzed by two-tailed unpaired Student t test with Welch correction, 692
***P < 0.001. 693
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
26
694
Figure 3. Cytotoxic effect of NKG2D-BBz CAR-T was dependent on expression 695
of NKG2D ligands. (A) MICA and ULBP2 expression in indicated cells was assessed 696
by flow cytometry. Data are representative of two independent experiments. 697
Percentage of positive cells is detailed in the histograms. (B) Cytotoxicity of NKG2D-698
BBz CAR-T cells on SMMC7721-shCOO2, SMMC7721-shMICA, SMMC7721-699
shULBP2 and SMMC7721-shMICA-shULBP2 cells. Two independent experiments 700
were performed. Data are presented as the mean ± SD of triplicates, statistical 701
significance between the SMMC7721-shMICA-shULBP2 group and the other three 702
groups was calculated using one-way ANOVA with Sidak correction, * P < 0.05, ** P 703
< 0.01. (C) Flow cytometry analysis of MICA and ULBP2 expression in Hep3B-704
MICA or Hep3B-ULBP2 cells. Data are representative of three independent 705
experiments. Percentage of positive cells is detailed in the histograms. (D) Cytotoxic 706
effect of NKG2D-BBz CAR-T on Hep3B-MICA and Hep3B-ULBP2. Two 707
independent experiments were performed. Data are presented as the mean ± SD of 708
triplicates, statistical significance between the Hep3B-vector and the other two groups 709
was analyzed by one-way ANOVA with Sidak correction, ***P < 0.001. 710
711
Figure 4. NKG2D-BBz CAR-T potently suppressed tumorigenesis in an SMMC-712
7721 xenograft model. (A) B-NDG mice bearing SMMC-7721-luciferase xenografts 713
were i treated with 100 l of saline (N=5), 1 × 107 non-transduced T cells (N=5), 1 × 714
107 CD19-BBz CAR-T cells (N=6), and 1 × 10
7 NKG2D-BBz CAR-T cells (N=6) by 715
tail vein injection. All the mice were imaged with an IVIS imager at the indicated 716
times. Tumor growth was assessed by total bioluminescence signals. Data are 717
representative of two independent experiments. (B) Growth curve of SMMC-7721-718
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
27
luciferase xenografts treated as described above. (C) NKG2D-BBz CAR-T cells 719
accumulated in SMMC-7721-luciferase xenograft tumors. Tumors and normal tissues 720
were collected from mice bearing SMMC-7721-luciferase subcutaneous xenografts 721
treated with CD19-BBz CAR-T cells and NKG2D-BBz CAR-T cells. Formalin-fixed, 722
paraffin-embedded tumor sections were consecutively cut and stained for human CD3 723
expression (brown), data are representative of two independent experiments, scale bar 724
= 100 μm. 725
726
Figure 5. Patient derived NKG2D-BBz CAR-T potently suppress liver cancer 727
both in vitro and in vivo. (A) Cytotoxic effect of patient derived NKG2D-BBz CAR-728
T cells on SMMC-7721 cells. Two independent experiments were performed. Data 729
are presented as the mean ± SD of triplicates, statistical significance between the 730
NKG2D-BBz group and the corresponding CD19-BBz group was calculated using 731
two-tailed unpaired Student t test with Welch correction, ***P < 0.001. (B) B-NDG 732
mice bearing SMMC-7721-luciferase xenografts were treated with 100 l of saline or 733
1 × 107 patient derived T cells by tail vein injection. NKG2D-BBz CAR-T cells derived 734
healthy donor were used as the positive control. Mice were imaged at the indicated 735
times. Tumor growth was assessed by total bioluminescence signals. This experiment 736
was done once. (C) Growth curve of SMMC-7721-luciferase xenografts treated with 737
indicated T cells or saline (n = 4 per group). 738
739
Figure 6. Safety assessment of NKG2D-BBz CAR-T. (A) The 90 normal human 740
tissues in the HOrgN09PT02 microarray were stained with MICA antibody. The 741
samples containing more than 10% MICA positive cells are marked in red. A1–A4 : 742
Thyroid; A5–A7: tongue; A8–A11: esophageal epithelium; A12–B5: gastric mucosa; 743
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
28
B6–B7: duodenal mucosa; B8–C1: jejunal mucous membrane; C2–C4: ileal mucous 744
membrane; C5–C9: appendix; C10–D1: mucous membrane of the colon; D2–D3: 745
mucous membrane of the rectum; D4–D5: liver; D6–D7: pancreas; D8–D10: trachea; 746
D11–E3: lung; E4–E6: myocardium; E7–E9: artery; E10–F4: skeletal muscle; F5–F7: 747
skin; F8: seminal vesicle; F9–F11: prostate; F12–G6: testis; G7–G10: bladder; G11: 748
medulla oblongata; G12–H1: telencephalon; H2–H3: epencephala; H4: brainstem; 749
H5–H6: spleen, scale bar = 500 μm. (B) Karyotype of non-transduced T cells and 750
NKG2D-BBz CAR-T cells, data are representative of two independent experiments. 751
752
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/
Published OnlineFirst September 4, 2019.Cancer Immunol Res Bin Sun, Dong Yang, Hongjiu Dai, et al. CAR T-cellsEradication of hepatocellular carcinoma by NKG2D-specific
Updated version
10.1158/2326-6066.CIR-19-0026doi:
Access the most recent version of this article at:
Material
Supplementary
C1
http://cancerimmunolres.aacrjournals.org/content/suppl/2019/09/04/2326-6066.CIR-19-0026.DAccess the most recent supplemental material at:
Manuscript
Authorbeen edited. Author manuscripts have been peer reviewed and accepted for publication but have not yet
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://cancerimmunolres.aacrjournals.org/content/early/2019/09/04/2326-6066.CIR-19-0026To request permission to re-use all or part of this article, use this link
on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026
http://cancerimmunolres.aacrjournals.org/lookup/doi/10.1158/2326-6066.CIR-19-0026http://cancerimmunolres.aacrjournals.org/content/suppl/2019/09/04/2326-6066.CIR-19-0026.DC1http://cancerimmunolres.aacrjournals.org/content/suppl/2019/09/04/2326-6066.CIR-19-0026.DC1http://cancerimmunolres.aacrjournals.org/cgi/alertsmailto:[email protected]://cancerimmunolres.aacrjournals.org/content/early/2019/09/04/2326-6066.CIR-19-0026http://cancerimmunolres.aacrjournals.org/
Article FileFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6