Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
Erg4A and Erg4B are required for conidiation and azole 1
resistance via regulation of ergosterol biosynthesis in 2
Aspergillus fumigatus 3
Nanbiao Longa, Xiaoling Xua, Qiuqiong Zengb, Hong Sangb, Ling Lua# 4
5
aJiangsu Key laboratory for Microbes and Functional Genomics, Jiangsu Engineering 6
and Technology Research Center for Microbiology, College of Life Sciences, Nanjing 7
Normal University, Nanjing, 210023, China; 8
bDepartment of Dermatology, Jinling Hospital, School of Medicine, Nanjing 9
University, Nanjing, 210002, China; 10
#Corresponding author: Ling Lu, E-mail: [email protected], 11
Phone/Fax: +86-025-85891791 12
13
Running title: Erg4A and Erg4B of Aspergillus fumigatus 14
15
16
ABSTRACT 17
Ergosterol, a fungal specific sterol enriched in cell plasma membranes, is 18
an effective antifungal drug target. However, current knowledge of the 19
ergosterol biosynthesis process in the saprophytic human fungal pathogen 20
Aspergillus fumigatus remains limited. In this study, we identified that 21
two endoplasmic reticulum-localized sterol C-24 reductases encoded by 22
AEM Accepted Manuscript Posted Online 16 December 2016Appl. Environ. Microbiol. doi:10.1128/AEM.02924-16Copyright © 2016, American Society for Microbiology. All Rights Reserved.
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
both erg4A and erg4B homologs are required to catalyze the reaction 23
during the final step of ergosterol biosynthesis. Loss of one homolog of 24
Erg4 induces the over-expression of the other one, accompanied with 25
almost normal ergosterol synthesis and the wild-type colony growth. 26
However, double deletions of erg4A and erg4B completely block the last 27
step of ergosterol synthesis, resulting in the accumulation of 28
ergosta-5,7,22,24(28)-tetraenol, a precursor compound of ergosterol. 29
Further studies indicate that erg4A and erg4B are required for conidiation 30
but not for hyphal growth. Importantly, Δerg4AΔerg4B still remains the 31
wild-type virulence in a compromised mouse model but displays 32
remarkable increased susceptibility to antifungal azoles. Our data suggest 33
that inhibitors of Erg4A and Erg4B may serve as effective candidates for 34
the adjunct antifungal agent with azoles. 35
Keywords: ergosterol biosynthesis, Aspergillus fumigatus, sterol C-24 36
reductase, azoles 37
38
IMPORTANCE 39
The knowledge for the ergosterol biosynthesis pathway in the human 40
opportunistic pathogen A. fumigatus is useful for designing and finding 41
new antifungal drugs. In this study, we demonstrated that endoplasmic 42
reticulum-localized sterol C-24 reductases Erg4A and Erg4B are required 43
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
for conidiation via regulation of ergosterol biosynthesis. Moreover, 44
inactivation of both Erg4A and Erg4B results in hypersensitivity to the 45
clinically guideline-recommended antifungal drugs itraconazole and 46
voriconazole. Therefore, our finding indicates that inhibiting Erg4A and 47
Erg4B could be an effective approach to alleviate A. fumigatus infection. 48
INTRODUCTION 49
Aspergillus fumigatus is a saprophytic fungus with a large number of 50
small airborne spores that can survive under various environmental 51
conditions. Due to the strong adaptability to environment, A. fumigatus 52
has become the most prevalent opportunistic pathogen which could cause 53
Invasive Aspergillosis (IA) (1). Unfortunately, in recent years, with 54
increased immunosuppressed populations, the incidence of IA has risen 55
simultaneously (2). Though the utilization of antifungal drugs clearly 56
improves the health condition of patients with IA, the continued use of 57
antifungal drugs has also increased the number of drug-resistant strains 58
over the years (3, 4). To date, the most widely used antifungal drugs are 59
azoles, which mainly target ergosterol synthesis since ergosterol is a 60
fungal specific sterol and is primarily distributed in plasma membranes. 61
Moreover, many previous studies have identified that ergosterol is also 62
involved in many biological processes including membrane fluidity, 63
permeability, signal transduction, and others (5-8). For example, in 64
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Aspergillus nidulans, it has been reported that ergosterol-enriched SRDs 65
(sterol-rich membrane domains), which distributed at plasma membranes 66
in hyphal tips, play important roles during the process of polarized 67
growth (9). In addition, oxysterol-binding protein homologs OshA-E, 68
which are involved in the non-vesicular sterol transport for dispatching 69
ergosterol to the distinct site, have also been implicated to regulate the 70
fungal cell growth (10). 71
In the fungal kingdom, the biosynthesis pathway of ergosterol is 72
highly conserved, and approximately 20 enzymes are involved (11). 73
Though the ergosterol biosynthesis pathway in Saccharomyces cerevisiae 74
has been characterized (12), little is known about this pathway in A. 75
fumigatus. To date, components in the ergosterol synthesis pathway in A. 76
fumigatus are known for Erg11, Erg25, and Erg3 (13, 14). Erg11 contains 77
two homologs, Erg11A (Cyp51A) and Erg11B (Cyp51B), which encode 78
two distinct 14-α sterol demethylases. Deletion of erg11A displays no 79
effect on ergosterol levels, whereas the erg11B deletion mutant has a 80
prominent decrease of ergosterol when compared to that of the parental 81
wild-type strain (13). However, double deletions of erg11A and erg11B 82
are lethal in A. fumigatus (15). Likewise, Erg25, an ergosterol synthesis 83
enzyme that is downstream of Erg11, also contains two homologs 84
referred to as Erg25A and Erg25B. Single deletion of erg25A or erg25B 85
leads to no significant differences in production of ergosterol compared to 86
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
that of the parental wild-type strain, while double deletions of erg25A and 87
erg25B are lethal (16). Another verified component of the ergosterol 88
synthesis enzyme in A. fumigatus is Erg3, which contains 3 copies termed 89
Erg3A, Erg3B, and Erg3C (17). Notably, single deletion of erg3A or 90
erg3C does not show obvious difference in total ergosterol production 91
compared to that of the parental wild-type strain. Nevertheless, deletion 92
of erg3B results in dramatically decreased ergosterol production (13, 17). 93
Comparatively, cholesterol present in the mammalian cell membranes 94
serves a similar role to ergosterol of fungi. Cholesterol is known as an 95
essential component of plasma membranes functioning in membrane 96
permeability, fluidity and so on (18, 19). However, most enzyme 97
homologs in early steps of ergosterol and cholesterol biosynthesis 98
pathways share common functions, which limits the possibility for the 99
design of antifungal drugs. Interestingly, Erg4, Erg5, and Erg6 are 100
specific components in the ergosterol synthetic pathway, suggesting that 101
these enzymes could be used as promising targets for antifungal drugs 102
(12). It has been reported that the enzyme involved in the last step 103
catalyzing ergosta-5,7,22,24(28)-tetraenol to ergosterol is encoded by 104
erg4 in S. cerevisiae (20). The Scerg4 deletion mutant fails to 105
biosynthesize ergosterol and significantly increases susceptibilities to 106
divalent cations and to several antifungal drugs miconazole, fluconazole 107
and other azoles (20). Similarly, in the plant pathogen Fusarium 108
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
graminearum, deletion of Fgerg4 causes the absolute deficiency of 109
ergosterol and increases sensitivities to metal cations and osmotic and 110
oxidative stresses (21). Importantly, the Fgerg4-null mutant showed 111
abnormal vegetative differentiation and attenuated virulence in the plant 112
host (21). 113
Given the difference between the biosynthesis process of ergosterol 114
and cholesterol, the present study examines whether blocking the final 115
step of ergosterol biosynthesis would affect hyphal growth, drug 116
resistance and virulence in A. fumigatus. We identified two predicted 117
homologs of Erg4 in A. fumigatus, here referred to as Erg4A and Erg4B, 118
and indicated that these homologs are required to catalyze the reaction in 119
the final step of ergosterol biosynthesis. Deletion of one homolog induces 120
the overexpression of the other such that either deletion of erg4A or 121
erg4B has almost no effect on ergosterol biosynthesis or conidiation. 122
However, double deletions of erg4A and erg4B completely block the 123
conversion of ergosta-5,7,22,24(28)-tetraenol, a precursor compound of 124
ergosterol, to ergosterol. Further, concurrent inactivation of erg4A and 125
erg4B results in a severe defect for conidiation rather than for hyphal 126
growth. Accordingly, Δerg4AΔerg4B displayed the wild-type virulence in 127
A. fumigatus. Importantly, Δerg4AΔerg4B showed hyper-sensitivities to 128
azole drugs itraconazole and voriconazole, suggesting that inhibitors 129
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
of Erg4A and Erg4B may serve as effective candidates for the adjunct 130
antifungal agent with azoles. 131
132
133
MATERIALS AND METHODS 134
Strains, media, and culture conditions. All strains of A. fumigatus 135
used in this study were given in Table 1. Generally, A. fumigatus strains 136
were grown on YAG or YUU (YAG supplemented with 5 mM uridine and 137
10 mM uracil) rich media, according to Jiang et al., containing 2% 138
glucose, 0.5% yeast extract, and 1 ml/L 1000× trace elements (22). To 139
test the sensitivity of A. fumigatus to stresses, NaCl, D-sorbitol, H2O2, 140
menadione, congo red, calcofluor white, itraconazole, voriconazole, 141
terbinafine, amphotericin B, and caspofungin were supplemented in the 142
YAG or YUU medium. For the plate-point assay, 2-μl slurry of the 143
indicated spores from the stock suspensions (107, 106, 105/ml) was 144
spotted onto YAG or YUU. All plates were incubated at 37°C for 1.5-2 145
days. For screen media of transformants, generally, 0.1 μg/ml 146
pyrithiamine (Sigma) or 200 μg/ml hygromycin B (Sangon) was added to 147
the related medium, respectively (23). 148
Deletion and complementation of erg4A and/or erg4B. All primers 149
used in this study were shown in Table 2. For the construction of erg4A 150
deletion cassette, the fusion PCR was used as previously described (24). 151
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Briefly, approximately 1 kb of the upstream and downstream flanking 152
sequences of the erg4A gene were amplified using primers erg4A P1/P3 153
and erg4A P4/P6, respectively. The selection marker hph (approximately 154
4 kb in length) from the plasmid pAN7-1 was amplified with primers hph 155
F/R. Next, the three aforementioned PCR products were combined and 156
used as the template to generate the erg4A deletion cassette using primers 157
erg4A P2/P5, and then transformed into A1160, which belonged to a 158
ku80 null mutant. For the construction of erg4B-null mutant, a similar 159
strategy was used in that the selection marker used in erg4B was pyr4, 160
which was amplified from the plasmid pAL5. For double deletions of 161
erg4A and erg4B, we deleted erg4B in the background of the erg4A-null 162
mutant using the same method. For complementation of Δerg4AΔerg4B 163
receipt strain with wild-type erg4A and/or erg4B gene, the follow strategy 164
was used. First, the basic plasmid pEASY-ptrA was generated. Briefly, 165
the fragment of pyrithiamine resistance cassette (ptrA) that amplified with 166
primers ptrA F/R was subcloned into pEASY-Blunt zero (TransGen 167
Biotech) according to the manufacturer’s directions. Then, the 168
Δerg4AΔerg4B receipt strain was co-transformed with pEASY-ptrA and 169
erg4A and/or erg4B gene, which was amplified with primers erg4A F/R 170
and erg4B F/R respectively. Similar strategy was used to complement 171
ku80 cassette, which was under the control of AngpdA. All transformation 172
procedure in A. fumigatus was performed as described previously (24). 173
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Construction of Erg4A and Erg4B GFP-tagging strains. For 174
generating the Erg4B-GFP strain, approximately 1.5 kb upstream 175
sequence (except the termination codon) and downstream sequence 176
(including the termination codon) of erg4B were amplified using 177
erg4B-gfp P1/P3 and erg4B-gfp P4/P6, respectively. The fragment that 178
containing 5×GA linker, eGFP, and the selection marker AfpyrG was 179
amplified from the plasmid pFNO3 using primers gfp-pyrG F/R. Next, 180
the above three fragments were combined and used as the template to 181
generate the erg4B-gfp cassette using primers erg4B-gfp P2/P5. 182
For generating the GFP-Erg4A strain, we labeled Erg4A with GFP in 183
the N terminal under the control of AngpdA promoter. Briefly, we first 184
amplified gfp (without termination codon) and erg4A using primers 185
gfp-erg4A P1/P2 and gfp-erg4A P3/P4, respectively. After purification, 186
two fragments were used as a template to generate gfp-erg4A cassette 187
using primers gfp-erg4A P1 and gfp-erg4A P4 and then subcloned into 188
the ClaI site of pBARGPE-1 (25) to construct the GFP-Erg4A vector. To 189
label Erg11A with RFP in the GFP-tagged Erg4A and Erg4B strains, an 190
erg11A-rfp (C-tag) cassette under the control of an AngpdA promoter was 191
introduced into the GFP-tagged Erg4A and Erg4B strains respectively as 192
described previously (25). 193
Microscopic observation. To visualize the subcellular localization of 194
GFP-Erg4A and Erg4B-GFP, the indicated strains were incubated in 3 ml 195
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
liquid YUU media on coverslips for 18 hours. For nucleus staining, 4, 196
6-diamidino-2-phenylindole (DAPI) (Sigma) that dissolved in phosphate 197
buffer saline (PBS) was used at a final concentration of 0.8 μg/ml and 198
incubated for 5 min at the room temperature after fixing with 4% 199
paraformaldehyde (Polyscience, Warrington, PA). For chitin and 200
sterol-rich membrane domains staining, calcofluor white (Sigma) and 201
filipin (Sigma) were used at a final concentration of 2 μg/ml. For 202
observation of conidiophore structure, coverslips were stuck into the plate 203
in which each strain was spread and incubated at 37°C for 1.5-2 days. 204
Images were captured using a Zeiss Axio imager A1 microscope (Zeiss, 205
Jena, Germany), and the photos were managed with Adobe Photoshop. 206
RNA extraction for qRT-PCR. Total RNA of the indicated strains 207
was isolated from the fresh mycelia using TRIzol (Roche) as described by 208
manufacturer’s instructions. For qRT-PCR, methods were used as 209
previously described (26). 210
Ergosterol extraction and analysis. The extraction and analysis of 211
ergosterol were performed as described previously (13, 27). Briefly, 212
108 spores of each strain were incubated in 100 ml YG or YUU media at 213
the speed of 220 rpm at 37°C for 24 h. Mycelia were obtained via 214
filtration with gauze, washed 3 times with distilled water, and lyophilized. 215
Approximately 100~200 mg dry mycelia were treated with 3 ml of 25% 216
alcoholic potassium hydroxide (3:2, methanol to ethanol) incubated at 217
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
85 °C for 1 h. Thereafter, 1 ml of distilled water and 3 ml of pentane were 218
added and vortex for 3 min. It was then set-aside for ten minutes, and the 219
upper layer was transferred to a clear tube and evaporated in a fume hood 220
at room temperature. Before analysis, all samples were dissolved in 1 ml 221
of methanol and filtered with a pore-size 0.2-μm filter. Total ergosterol 222
was analyzed using high-performance liquid chromatograph (HPLC) 223
(Agilent Technologies) and detected at 282 nm on an AQ-C18 column 224
(250 mm by 4.6 mm, 5 μm) with a flow rate of 1 ml/min. 225
Virulence assay. Virulence assays used in this study were performed 226
according to the method developed by Li and Zhang (28, 29). Briefly, 6-8 227
weeks old male mice (ICR) were immunosuppressed on day -3 and -1 228
with cyclophosphamide (150 mg/kg) and on day -1 with hydrocortisone 229
acetate (40 mg/kg). On day 0, after anesthetization with pentobarbital 230
sodium, mice were infected intratracheally with 50-μl slurry that contains 231
106 conidia or 50-μl PBS as the control. After infection, 232
cyclophosphamide (75 mg/kg) was injected every three days to maintain 233
immunosuppression. For mortality statistics, mice were monitored for 14 234
days after inoculation. For histopathological analysis, lungs were isolated 235
from the sacrificed mice and fixed in 4% formaldehyde (v/v) before 236
periodic acid-schiff staining. All animal experiments in this study were 237
performed according to the Guide for the Care and Use of Laboratory 238
Animals of the U.S. National Institutes of Health. The animal 239
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
experimental protocol was approved by the Animal Care and Use 240
Committee of Nanjing Normal University, China (permit no. 2090658) 241
according to the governmental guidelines for animal care. 242
243
RESULTS 244
A. fumigatus includes two homologs of S. cerevisiae Erg4. To 245
identify homologs of Erg4 of S. cerevisiae in A. fumigatus, the amino acid 246
sequence of ScErg4 was used as query to perform BLASTP analysis in 247
the genome database of A. fumigatus. The result showed that 248
AFUB_062080 (EDP52170.1, identity 53%, E-value 7e-166) and 249
AFUB_007490 (EDP56047.1, identity 50%, E-value 1e-152) were 250
possible homologs of ScErg4 in A. fumigatus. Subsequent BLASTP 251
analysis using AFUB_062080 and AFUB_007490 as queries were 252
performed in S. cerevisiae database, and results showed that ScErg4 was 253
the best match, suggesting that AFUB_062080 and AFUB_007490, here 254
referred to as Erg4A and Erg4B, might be potential homologs of ScErg4 255
in A. fumigatus. Based on the fact that A. fumigatus contains two 256
predicted Erg4 homologs while S. cerevisiae has only one, we were 257
interested in exploring whether other fungi also contain two Erg4 258
homologs. To this end, Erg4 family members of more than ten fungi were 259
identified from the NCBI GenBank using the BLAST algorithm with a 260
cut-off value of e-55. Interestingly, in the selected yeast-form fungi, 261
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
including S. cerevisiae, Candida albicans, Schizosaccharomyces pombe 262
and Cryptococcus gattii, there only has a single homolog of Erg4, 263
whereas many selected filamentous fungi contain two Erg4 homologs, 264
suggesting that the ergosterol biosynthesis pathway in filamentous fungi 265
may be more complicated than that in single-cell yeasts (Fig. 1A). 266
The deduced DNA sequence of erg4A is 1510 bp in length and 267
encodes 471 amino acids, while erg4B has a 2066-bp genomic DNA in 268
length and encodes 568 amino acids. Sequence analysis showed that 269
Erg4A and Erg4B share 62% identity with each other. Intriguingly, 270
compared to Erg4A or ScErg4, Erg4B displays an extended N-terminus 271
with approximately 95 amino acids. The transmembrane domain analysis 272
predicted by the TMHMM v2.0 program 273
(http://www.cbs.dtu.dk/services/TMHMM-2.0) or SMART protein search 274
(http://smart.embl-heidelberg.de/) revealed that both Erg4A and Erg4B 275
contain nine transmembrane structures. In comparison, ScErg4 only 276
contains seven predicted transmembrane structures. This suggests that the 277
function of ScErg4 may be different from that of Erg4A and Erg4B in A. 278
fumigatus (Fig. 1B). 279
Double deletions of erg4A and erg4B result in fluffy colonies with 280
severely impaired conidiation. To investigate the function of Erg4A and 281
Erg4B, we constructed erg4A, erg4B, erg4A and erg4B-null mutants in 282
the background strain A1160 (Δku80, pyrG). Diagnostic PCR showed 283
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
that the selection marker hph or pyr4 completely replaced the open 284
reading frame (ORF) of erg4A or erg4B, respectively, suggesting that the 285
ORF of erg4A or erg4B was fully deleted (Fig. S1). As shown in Fig. 2A, 286
the erg4B single deletion mutant showed a similar phenotype to that of its 287
parental wild type with normal colony growth and conidiation in YUU 288
media (Fig. S2A and B). In contrast, the erg4A single deletion mutant 289
displayed a slightly attenuated colony diameter at approximately 20% to 290
that of its parental wild type while conidia numbers per unit area in the 291
Δerg4A mutant was not affected compared to that of its parental wild type 292
(Fig. 2A, S2A and B). However, the Δerg4AΔerg4B double mutant 293
exhibited a nearly white and fluffy colony plus a decreased colony 294
diameter at approximately 26% to that of its parental wild type. The 295
severely impaired conidiation phenomenon suggests that Erg4A and 296
Erg4B are essential for conidiation of A. fumigatus (Fig. 2A, S2A and B). 297
To elucidate how the defect of conidiation occurred in the 298
aforementioned double deletion mutant, we compared the conidiophores 299
of Δerg4A, Δerg4B, Δerg4AΔerg4B, and its parental wild type. As shown 300
in Fig. 2A, for Δerg4A and Δerg4B single mutants, the conidiophore 301
structure was normal and similar to that of its parental wild type with 302
numerous conidia in it, whereas in Δerg4AΔerg4B there were no 303
detectable conidiophore structures. Instead, there were several abnormal 304
septa at the stalk of the foot cell in Δerg4AΔerg4B, while Δerg4A, Δerg4B 305
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
single mutants or the parental wild-type strain did not show any 306
detectable septa at the same site (Fig. 2A). To address whether the 307
impaired conidiation of Δerg4AΔerg4B was due to the 308
absence of ergosterol, we tested its colony morphology and conidiation 309
structure with the extra ergosterol addition in solid media. As expected, in 310
the presence of ergosterol, the formation of conidia and conidiophores of 311
Δerg4AΔerg4B was recovered significantly (Fig. 2B), which suggests that 312
the defect in conidiation may be partially caused by ergosterol deficiency. 313
To further identify whether the defected phenotype in Δerg4AΔerg4B was 314
really due to deletions of these two genes, we carried out the 315
complementation experiment. The result in Fig. 2C clearly showed that 316
introducing either erg4A or erg4B gene or both into the Δerg4AΔerg4B 317
receipt strain was able to completely rescue mutant defects in conidiation. 318
Further, to exclude the side effect of ku80 for defect phenotypes, the 319
wild-type ku80 cassette was also introduced into the Δerg4AΔerg4B 320
mutant under the control of AngpdA. Semi-quantitative RT-PCR analysis 321
showed that ku80 was expressed successfully in the tested transformants 322
(Fig. S2C). Phenotypic analysis indicates that wild-type ku80 323
transformants displayed similar phenotypes to Δerg4AΔerg4B with the 324
colony-size reduction as well as the impaired conidial formation (Fig. 2C). 325
It demonstrates that the defect phenotype of Δerg4AΔerg4B was 326
specifically caused by deletions of erg4A and erg4B rather than the result 327
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
from any second mutations. Next, we asked if deletion of erg4A and/or 328
erg4B would affect the hyphal growth. We compared the hyphal 329
morphology feature of Δerg4A, Δerg4B, Δerg4AΔerg4B and its parental 330
wild type under the liquid culture condition. First, through the 331
microscopy study for examining the hyphal tips of erg4A and/or 332
erg4B-null mutants, we found that all tested mutants had similar hyphal 333
phenotypes compared to that of its parental wild type, suggesting that 334
deletions of erg4A and/or erg4B have no detectable effect on polarized 335
growth under liquid conditions (Fig. 2D). Due to the abnormal septa 336
displayed in the conidiophore structure of Δerg4AΔerg4B, we then 337
stained the hyphal septa with the chitin dye-calcofluor white. The result 338
showed that no significant difference exists in the septum formation 339
between mutants and the parental wild-type strain (Fig. 2D). As the 340
ergosterol-enriched SRDs are mainly located in hyphal tip membrane, we 341
then stained the SRDs of the indicated strains with the sterol dye-filipin to 342
visualize the sterol distribution. As shown in Fig. 2D, there was no 343
detectable difference between mutants and the parental wild-type strain, 344
which suggests that deletion of erg4A and/or erg4B has no significant 345
effect on the SRDs formation and sterol distribution. Taken together, 346
these data demonstrate that erg4A and erg4B are required for conidiation 347
but not for hyphal growth in A. fumigatus. 348
The Δerg4AΔerg4B mutant demonstrates the wild-type virulence. 349
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Because Δerg4AΔerg4B displayed impaired colony growth and blocked 350
conidiation, we compared its virulence with that of the parental wild-type 351
strain in an immunosuppressed mouse model of invasive aspergillosis. 352
Mice infected with the parental wild-type strain or Δerg4AΔerg4B began 353
to die at day 2 or 3, respectively. Survival of mice was monitored during 354
14 days after infection. As shown in survival curves of Fig. 3A, both 355
parental wild type and the Δerg4AΔerg4B strain caused similar 356
mortalities (about 87%) with no significant difference by the log-rank 357
analysis (p = 0.874) (Fig. 3A). To address whether the death of mice was 358
caused by the infected A. fumigatus strain, we then cultured the lung 359
tissue isolated from the infected dead mice on YAG media. The results in 360
Fig. 3B showed that each tested plate inoculated by lung tissue isolated 361
from relative infection mice displayed the respectively infected live 362
colonies of A. fumigatus. Next, histopathological examinations of lung 363
sections were performed with the periodic acid-schiff staining. As shown 364
in Fig. 3C, a large amount of growing hyphae appeared around the lung 365
airway which were infected by both the parental wild-type and the 366
Δerg4AΔerg4B strains. Therefore, data in the survival curve combined 367
with the histopathological analysis strongly suggest that despite having 368
defects in colony size and conidiation, the Δerg4AΔerg4B mutant exhibits 369
similar virulence to the parental wild-type strain. 370
Erg4A and Erg4B are required for the biosynthesis of ergosterol. 371
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
In S. cerevisiae, it has been demonstrated that ScErg4 is the enzyme 372
which catalyzes the final step of ergosterol biosynthesis and the absolute 373
deficiency of ergosterol can be observed without this enzyme (20). To 374
investigate whether A. fumigatus Erg4A and Erg4B are involved in the 375
last step of ergosterol biosynthesis (Fig. 4A), we analyzed the content of 376
ergosterol extracted from Δerg4A, Δerg4B, Δerg4AΔerg4B mutants and 377
its parental wild type by high-performance liquid chromatography 378
(HPLC). In this assay, a commercial purified ergosterol was used as a 379
standard to determine the retention time of ergosterol. As shown in Fig. 380
4B, there has a single absorption peak, which suggests that the specific 381
absorption peak of ergosterol was at the retention time of ~10.6 min (Fig. 382
4B). Next, a similar approach was used to detect the content of ergosterol 383
in extracts from the above-mentioned strains. Intriguingly, both Δerg4A 384
and Δerg4B mutants showed no detectable differences to that of its 385
parental wild type in HPLC profile for the ergosterol synthesis analysis 386
(Fig. 4B and 4C). However, different from the single mutant, 387
Δerg4AΔerg4B had no ergosterol-specific absorption peak at the time of 388
~10.6 min. Instead, at the retention time of ~8.7 min, an absorption peak 389
was detected that probably belonged to the sterol intermediate (Fig. 4B). 390
To determine whether this sterol intermediate was the precursor of 391
ergosterol, we then authenticated it by LC-MS. As expected, this sterol 392
intermediate was identified as ergosta-5,7,22,24(28)-tetraenol (Fig. S3). 393
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Taken together, our data suggest that Erg4A and Erg4B in combination, 394
but neither one individually, are required for the biosynthesis of 395
ergosterol in A. fumigatus. 396
Loss of ER-localized Erg4A induces the over-expression of Erg4B 397
and vice versa. To further explore the function of Erg4A and Erg4B in A. 398
fumigatus, we studied the subcellular localization of them. Through 399
homologous recombination, we labeled Erg4B with GFP in the C 400
terminus under the control of its native promoter successfully. 401
Unfortunately, using this strategy, we were unable to obtain the 402
functional Erg4A-GFP strain. Instead, we labeled Erg4A in the N 403
terminus under the control of AngpdA promoter. As shown in Fig. 5A and 404
5B, both GFP-Erg4A and Erg4B-GFP fusion proteins had the ER-like 405
localization pattern, with a network of strands around the nucleus, which 406
were predicted and consistent with most of the proteins involved in the 407
ergosterol biosynthesis (25). Further, to investigate whether tagging 408
Erg4A or Erg4B would affect its function, we transformed the Δerg4A 409
and Δerg4B mutants with gfp-erg4A and erg4B-gfp cassettes respectively. 410
As result shown in Fig. S4, the localization and colony characteristics of 411
the Erg4A and Erg4B GFP-tagged strains are both similar to that of the 412
parental wild type, which suggest that the GFP-tagged Erg4A and Erg4B 413
proteins are functional. To directly demonstrate whether Erg4A and 414
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Erg4B are localized in ER, we performed an experiment labeling the ER 415
marker-Erg11A with RFP in its C terminus in the background strains of 416
GFP-Erg4A and Erg4B-GFP. Microscopic observations showed that both 417
GFP-Erg4A and Erg4B-GFP were co-localized with Erg11A-RFP, which 418
directly demonstrate that both Erg4A and Erg4B proteins have the 419
ER-localization (Fig. 5A and 5B). 420
As aforementioned, in Δerg4A or Δerg4B single mutants, the 421
ergosterol content was similar to that of the parental wild type while in 422
Δerg4AΔerg4B, ergosterol content was nearly undetectable. Therefore, 423
we hypothesized that Erg4A and Erg4B may have redundant functions 424
during ergosterol biosynthesis. To verify this hypothesis, we first detected 425
the mRNA level of erg4A and erg4B, respectively in the parental 426
wild-type strain. As shown in Fig. 5C, relative to the transcription of tubA, 427
the mRNA level of erg4B was approximately 2.5 times higher than that 428
of erg4A in the parental wild-type strain. Next, we examined the mRNA 429
level of erg4A in the Δerg4B mutant and erg4B in the Δerg4A mutant 430
compared to its parental wild type. Remarkably, the mRNA level of 431
erg4A in the absence of erg4B was increased to 3.4 times of its parental 432
wild type (Fig. 5D). Similarly, under the condition of erg4A deficiency, 433
the mRNA level of erg4B was increased up to 1.6 times compared to that 434
of its parental wild type (Fig. 5D). Therefore, our data verified that 435
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
ER-located Erg4A and Erg4B have redundant functions during ergosterol 436
biosynthesis and loss of one paralog would induce the 437
increased-expression of the other one. 438
Sensitivities of the erg4 mutant to osmotic and oxidative stresses, 439
and cell wall-perturbing agents. Ergosterol is an important sterol 440
constituent in cellular plasma membranes and it involves in cell 441
membrane integrity, fluidity and permeability of fungal cells (5, 30, 31). 442
Given the predominant function of ergosterol, we speculated that 443
deficiency of ergosterol might change the susceptibility of A. fumigatus to 444
some plasma stresses or cell wall-perturbing agents. To test this 445
hypothesis, we analyzed phenotypes of Δerg4A, Δerg4B, Δerg4AΔerg4B 446
and its parental wild type in the YUU solid medium supplemented by 447
different reagents. Interestingly, under the osmotic stress condition 448
generated by D-sorbitol, all tested mutants showed a similar colony 449
growth to that of its parental wild type while under the stress condition 450
induced by NaCl, Δerg4A and Δerg4AΔerg4B showed a slight sensitivity 451
compared to the reference strain (Fig. 6A and 6B). In a similar manner, 452
we tested and compared the phenotypes of those mutants to the parental 453
wild-type strain in oxidative stresses induced by H2O2 and menadione. 454
Under the condition of H2O2, both Δerg4A and Δerg4AΔerg4B mutants 455
exhibited the increased susceptibility. However, compared to the parental 456
wild-type strain, Δerg4AΔerg4B displayed a slight resistance in the 457
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
presence of menadione, whereas Δerg4A showed an increased sensitivity 458
under the same condition (Fig. 6A and 6B). Erg4 is involved in cell wall 459
assembly in S. cerevisiae (32). Thus, we examined a potential role for 460
Erg4A and Erg4B in cell wall integrity. To this end, we tested the 461
sensitivity of erg4A and/or erg4B deletions to cell wall-perturbing agents 462
such as congo red, calcofluor white. Notably, in the presence of congo 463
red, compared to the parental wild-type strain, both the Δerg4A single 464
mutant and the Δerg4AΔerg4B double mutant showed 465
hyper-susceptibility while Δerg4B displayed a similar phenotype to that 466
of its parental wild type. Likewise, similar results were obtained to congo 467
red under the treatment of calcofluor white, which suggests that erg4A 468
may play more important roles than that of erg4B in the cell wall integrity 469
in A. fumigatus (Fig. 6A and 6B). Collectively, the above data 470
demonstrate that Erg4A and/or Erg4B are critical to protect fungal cells 471
against the plasma and cell wall stresses. 472
Susceptibilities of the erg4 mutant to antifungal drugs. Because 473
the widely used anti-fungal azole drugs mainly inhibit the biosynthesis of 474
ergosterol, we then tested the sensitivity of those mutants to some azole 475
drugs. As depicted in Fig. 7A, under the treatment of itraconazole or 476
voriconazole, which inhibit the lanosterol 14-alpha-demethylase enzyme, 477
Δerg4AΔerg4B showed increased susceptibility to the tested azoles 478
compared to single mutants, erg4A and/or erg4B complemented strain or 479
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
the parental wild-type strain. Because Δerg4AΔerg4B showed 480
hypersensitivity to itraconazole and voriconazole, we subsequently tested 481
its minimum inhibitory concentrations (MICs) using commercial E-test 482
strips. As shown in Fig. 7B, the MIC value of itraconazole for the 483
Δerg4AΔerg4B mutant (1.2 µg/ml) was significantly lower than that of 484
the parental wild-type strain (3 µg/ml) under the same condition. 485
Similarly, as observed with the voriconazole E-test strip, the MIC value 486
of Δerg4AΔerg4B (0.032 µg/ml) was dramatically lower than that of the 487
parental wild-type strain (0.125 µg/ml). This MIC test further 488
demonstrates that Δerg4AΔerg4B is much more sensitive to antifungal 489
azoles than the parental wild-type strain. Interestingly, all mutants 490
showed slight resistance to terbinafine, which interferes with the 491
biosynthesis of ergosterol by inhibition of squalene epoxidase (Fig. 7C). 492
Moreover, because the polyene drug amphotericin B was known to kill 493
fungal cells by binding ergosterol to form a pore to disrupt the integrity of 494
membranes, we then tested the drug susceptibility for the indicated strains. 495
As shown in Fig. 7C, we found that compared to the parental wild-type 496
strain, Δerg4AΔerg4B showed the significant resistance to amphotericin 497
B. As the aforementioned fact that Δerg4A and Δerg4AΔerg4B mutants 498
displayed increased susceptibility to cell wall perturbing agents, such as 499
congo red and calcofluor white, we then examined the sensitivity of 500
erg4A and/or erg4B mutants to caspofungin, an echinocandin drug which 501
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
inhibits β-1,3 glucan synthase. Unexpectedly, the susceptibility of both 502
single and double mutants of erg4A and erg4B did not show any 503
difference to that of its parental wild type (Fig. 7C). 504
Given the aforementioned fact that addition of ergosterol can partly 505
rescue the conidiation defect of Δerg4AΔerg4B, we carried out another 506
experiment to test whether ergosterol supplementation could affect the 507
drug susceptibility in mutants. Unexpectedly, adding ergosterol did not 508
significantly change the susceptibility of erg4A and/or erg4B mutants as 509
shown in Fig. S5. Collective data suggest that inactivation of erg4A 510
and/or erg4B obviously alter the susceptibility of A. fumigatus to 511
itraconazole, voriconazole, terbinafine and amphotericin B but not to 512
caspofungin. 513
514
DISCUSSION 515
The knowledge of the ergosterol biosynthesis pathway in human 516
opportunistic pathogen A. fumigatus is useful for novel antifungal drug 517
design. In this study, through bioinformatics analysis, we characterized 518
two homologs of yeast Erg4 in A. fumigatus. In the absence of one 519
homolog of A. fumigatus Erg4, its function could be complemented by 520
the increasing expression of the other one. Thus, neither deletion of erg4A 521
nor erg4B would affect the biosynthesis of ergosterol. However, 522
concurrent deletions of erg4A and erg4B completely block the 523
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
biosynthesis of ergosterol and result in severely impaired conidiation. 524
Moreover, hypersensitivity to clinically first-line antifungal azoles in 525
Δerg4AΔerg4B suggests that Erg4A and Erg4B could be used as 526
promising targets for antifungal drugs. 527
Erg4A and Erg4B are required for conidiation but not for hyphal 528
growth. As shown in Fig. 2A, when losing the function of ergosterol 529
biosynthesis, Δerg4AΔerg4B was still viable, which demonstrates that 530
ergosterol is not necessary for fungal survival. It also indicates that other 531
intermediate products of the ergosterol biosynthesis pathway may play a 532
substitute role for the function of ergosterol. Moreover, it is possible that 533
the filipin staining could not distinguish between ergosterol and 534
ergosta-5,7,22,24(28)-tetraenol so that wild type and the double mutant 535
which lacks ergosterol but profoundly accumulates the intermediate 536
precursor of ergosterol, showed no detectable difference (Fig. 2D). In 537
contrast, previous studies have reported that genes involved in early steps 538
in ergosterol biosynthesis, such as erg11 (cyp51A and cyp51B) and erg25 539
(erg25A and erg25B), are essential. These data suggest enzymes which 540
involved in different steps of biosynthesis pathway of ergosterol have 541
unique functions for fungal survival. 542
Interestingly, our findings indicate that inactivation of both erg4A and 543
erg4B exhibits a severe conidiation defect with a white and fluffy colony 544
(Fig. 2A and S2), demonstrating that ergosterol is required for conidiation. 545
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Indeed, in the presence of extra ergosterol addition in culture media, the 546
conidiation of Δerg4AΔerg4B was partially rescued (Fig. 2B). However, 547
there have not been reported yet until now regarding how ergosterol 548
could affect conidiation. In yeasts, previous studies have verified that 549
ergosterol was able to interact with the long acyl chain of sphingolipids to 550
form microdomains within membranes to participate in pheromone 551
signaling and plasma membranes fusion (7, 8). In Aspergillus, many lines 552
of evidence have identified that the signal to control asexual development 553
or vegetative growth is tightly regulated in a sequence (33). To date, a 554
large number of proteins related to asexual development regulation have 555
been reported, such as FluG, BrlA, and FlbB (34). Interestingly, the 556
conidiation-defected phenotype in Δerg4AΔerg4B was similar to that of 557
ΔfluG, ΔbrlA, and ΔflbB with a fluffy appearance, which implies that loss 558
of both erg4A and erg4B may cause dysfunction of asexual 559
development-related proteins (33). In addition, trimeric G-protein 560
signaling has been reported to be involved in the regulation of vegetative 561
growth and asexual development (35-37). Therefore, we speculate that 562
ergosterol-enriched in plasma membranes may be necessary for the 563
transduction of the extracelluar signal into cells. Given that it is true, 564
under the condition of ergosterol deficiency, trimeric G-protein or other 565
relevant molecules might be unable to be localized to the appropriate 566
functioning sites so that the signaling of asexual development is blocked. 567
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Of course, the assumption that there may also exist other mechanisms 568
such that Erg4A and Erg4B could interact with some unknown proteins, 569
which are required for conidiation, is also possible. 570
Previous study has indicated that ScErg4 is able to interact with Ste20 571
(the p21-activated kinase) to regulate cell polarity and without which the 572
apical growth is significantly affected (32). Different from the yeast 573
Scerg4 mutant, our data indicate that Δerg4AΔerg4B showed a similar 574
morphology to that of the parental wild-type strain in hyphal polarized 575
growth (Fig. 2D), which demonstrates that Erg4A and Erg4B are not 576
essential for hyphal growth. Possibly, this may also explain why 577
Δerg4AΔerg4B still has the wild-type virulence in a compromised mouse 578
model (Fig. 3). Compared to Erg4 in F. graminearum, erg4A and erg4B 579
of A. fumigatus also encode sterol C-24 reductase so they may share 580
functions during the fungal development (21). However, Fgerg4 is 581
required for full virulence of F. graminearum whereas Erg4A and Erg4B 582
are not essential for virulence of A. fumigatus, suggesting they may have 583
different functions in vivo (21). 584
Erg4A and Erg4B mediate susceptibility to azole drugs. In fungi, 585
the widely used azoles, such as itraconazole and voriconazole, mainly 586
target lanosterol 14-α-demethylase, which is encoded by Erg11. The 587
inhibition of lanosterol 14-α-demethylase caused by azoles results in 588
accumulation of toxic sterol and thus lead to cell death (38). In our study, 589
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
we found that inactivation of erg4A and erg4B resulted in hypersensitivity 590
to itraconazole and voriconazole (Fig. 7A and 7B), suggesting that Erg4A 591
and Erg4B are required for drug resistance. To explain the reason for the 592
increased sensitivity of Δerg4AΔerg4B to itraconazole and voriconazole, 593
we first may exclude the mechanism mediated by ergosterol deficiency 594
since a previous study in erg3 mutants with a decreased ergosterol 595
content has demonstrated that there was no significant difference in the 596
voriconazole susceptibility (17). Second, the possibility due to that 597
induced by ergosta-5,7,22,24(28)-tetraenol accumulation might also be 598
excluded as the Δerg5 mutant with a blocked production of 599
ergosta-5,7,22,24(28)-tetraenol in N. crassa or Fusarium verticillioides, 600
exhibited increased susceptibility to azole as well (39). Therefore, it 601
suggests that reason for the increased susceptibility is probably due to the 602
changed fluidity of membranes or the varied activities of 603
membrane-located azole pumps, which may be affected in the absence of 604
Erg4A and Erg4B. Under this defect condition, azoles might be easy to be 605
up-taken or difficult to be drained off, causing hypersensitivity to azoles. 606
Moreover, it has been reported that ketoconazole can directly bind Erg5 607
with a similar affinity as with Erg11 in S. cerevisiae (40). Thus, we 608
hypothesize that itraconazole and voriconazole may also have the binding 609
ability with Erg4. If this case is true, the absence of Erg4 would increase 610
the targeting probability of drugs to Erg11, resulted in the increasing 611
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
sensitivity to these antifungals. Another possible reason of the increased 612
susceptibility of Δerg4AΔerg4B to itraconazole and voriconazole might 613
be due to the altered cell wall integrity compared to the parental wild-type 614
strain (41). Additionally, previous studies in fungi have demonstrated that 615
when azoles were used, the drug target-lanosterol 14-demethylase 616
enzyme activity encoded by erg11 was inhibited, resulting in an abnormal 617
accumulation of a toxic sterol 618
(14α-methylergosta-8,24(28)-dien-3β,6α-diol). It suggests that a toxic 619
sterol accumulation could be a reason for arresting the fungal cell growth 620
(38, 42). In yeasts, inactivation of Δ5,6 desaturase encoded by erg3 was 621
able to suppress the growth defect under the treatment of azoles and 622
losing Δ5,6desaturase could decrease accumulation of a toxic sterol 623
(14α-methylergosta-8,24(28)-dien-3β,6α-diol) (43, 44). Based on this 624
information, we hypothesize that hypersensitivity to azoles in 625
Δerg4AΔerg4B may be due to accumulation of the toxic sterols induced 626
by azoles. However, evidences for verifying the above hypothesis need 627
further investigation. 628
629
ACKNOWLEDGMENTS 630
We thank Dr Shizhu Zhang for helpful comments for this study and 631
thanks for Dr. Hechun Jiang for the A. fumigatus strain A1160C (Nanjing 632
Normal University). A. fumigatus strain A1160 was obtained from FGSC 633
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
(http://www.fgsc.net). 634
635
FUNDING INFORMATION 636
This work was financially supported by the National Natural Science 637
Foundation of China (NSFC)(Grant No. 81330035 to L. Lu) and the 638
Special Fund for the Doctoral Program of Higher Education of China (No. 639
20123207110012) to L. Lu; the Priority Academic Program Development 640
(PAPD) of Jiangsu Higher Education Institutions; the Postgraduate 641
Research and Innovation Plan Project of Jiangsu Province (No. 642
KYLX16_1283) to N. Long. 643
644
REFERENCES 645
1. Latge JP. 1999. Aspergillus fumigatus and aspergillosis. Clin Microbiol 646
Rev 12:310-350. 647
2. Chamilos G, Luna M, Lewis RE, Bodey GP, Chemaly R, Tarrand JJ, 648
Safdar A, Raad, II, Kontoyiannis DP. 2006. Invasive fungal infections in 649
patients with hematologic malignancies in a tertiary care cancer center: an 650
autopsy study over a 15-year period (1989-2003). Haematologica 651
91:986-989. 652
3. van der Linden JW, Snelders E, Kampinga GA, Rijnders BJ, Mattsson 653
E, Debets-Ossenkopp YJ, Kuijper EJ, Van Tiel FH, Melchers WJ, 654
Verweij PE. 2011. Clinical implications of azole resistance in Aspergillus 655
fumigatus, The Netherlands, 2007-2009. Emerg Infect Dis 17:1846-1854. 656
4. Howard SJ, Arendrup MC. 2011. Acquired antifungal drug resistance in 657
Aspergillus fumigatus: epidemiology and detection. Med Mycol 49 Suppl 658
1:S90-95. 659
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
5. Kodedova M, Sychrova H. 2015. Changes in the Sterol Composition of the 660
Plasma Membrane Affect Membrane Potential, Salt Tolerance and the 661
Activity of Multidrug Resistance Pumps in Saccharomyces cerevisiae. 662
PLoS One 10:e0139306. 663
6. Bard M, Lees ND, Turi T, Craft D, Cofrin L, Barbuch R, Koegel C, 664
Loper JC. 1993. Sterol synthesis and viability of erg11 (cytochrome P450 665
lanosterol demethylase) mutations in Saccharomyces cerevisiae and 666
Candida albicans. Lipids 28:963-967. 667
7. Jin H, McCaffery JM, Grote E. 2008. Ergosterol promotes pheromone 668
signaling and plasma membrane fusion in mating yeast. J Cell Biol 669
180:813-826. 670
8. Morioka S, Shigemori T, Hara K, Morisaka H, Kuroda K, Ueda M. 671
2013. Effect of sterol composition on the activity of the yeast 672
G-protein-coupled receptor Ste2. Appl Microbiol Biotechnol 97:4013-4020. 673
9. Takeshita N, Higashitsuji Y, Konzack S, Fischer R. 2008. Apical 674
sterol-rich membranes are essential for localizing cell end markers that 675
determine growth directionality in the filamentous fungus Aspergillus 676
nidulans. Mol Biol Cell 19:339-351. 677
10. Buhler N, Hagiwara D, Takeshita N. 2015. Functional Analysis of Sterol 678
Transporter Orthologues in the Filamentous Fungus Aspergillus nidulans. 679
Eukaryot Cell 14:908-921. 680
11. Ferreira ME, Colombo AL, Paulsen I, Ren Q, Wortman J, Huang J, 681
Goldman MH, Goldman GH. 2005. The ergosterol biosynthesis pathway, 682
transporter genes, and azole resistance in Aspergillus fumigatus. Med Mycol 683
43 Suppl 1:S313-319. 684
12. Espenshade PJ, Hughes AL. 2007. Regulation of sterol synthesis in 685
eukaryotes. Annu Rev Genet 41:401-427. 686
13. Alcazar-Fuoli L, Mellado E, Garcia-Effron G, Lopez JF, Grimalt JO, 687
Cuenca-Estrella JM, Rodriguez-Tudela JL. 2008. Ergosterol biosynthesis 688
pathway in Aspergillus fumigatus. Steroids 73:339-347. 689
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
14. Alcazar-Fuoli L, Mellado E. 2012. Ergosterol biosynthesis in Aspergillus 690
fumigatus: its relevance as an antifungal target and role in antifungal drug 691
resistance. Front Microbiol 3:439. 692
15. Hu W, Sillaots S, Lemieux S, Davison J, Kauffman S, Breton A, Linteau 693
A, Xin C, Bowman J, Becker J, Jiang B, Roemer T. 2007. Essential gene 694
identification and drug target prioritization in Aspergillus fumigatus. PLoS 695
Pathog 3:e24. 696
16. Blosser SJ, Merriman B, Grahl N, Chung D, Cramer RA. 2014. Two 697
C4-sterol methyl oxidases (Erg25) catalyse ergosterol intermediate 698
demethylation and impact environmental stress adaptation in Aspergillus 699
fumigatus. Microbiology 160:2492-2506. 700
17. Alcazar-Fuoli L, Mellado E, Garcia-Effron G, Buitrago MJ, Lopez JF, 701
Grimalt JO, Cuenca-Estrella JM, Rodriguez-Tudela JL. 2006. 702
Aspergillus fumigatus C-5 sterol desaturases Erg3A and Erg3B: role in 703
sterol biosynthesis and antifungal drug susceptibility. Antimicrob Agents 704
Chemother 50:453-460. 705
18. Barenholz Y. 2002. Cholesterol and other membrane active sterols: from 706
membrane evolution to "rafts". Prog Lipid Res 41:1-5. 707
19. Rog T, Vattulainen I. 2014. Cholesterol, sphingolipids, and glycolipids: 708
what do we know about their role in raft-like membranes? Chem Phys 709
Lipids 184:82-104. 710
20. Zweytick D, Hrastnik C, Kohlwein SD, Daum G. 2000. Biochemical 711
characterization and subcellular localization of the sterol C-24(28) reductase, 712
erg4p, from the yeast Saccharomyces cerevisiae. FEBS Lett 470:83-87. 713
21. Liu X, Jiang J, Yin Y, Ma Z. 2013. Involvement of FgERG4 in ergosterol 714
biosynthesis, vegetative differentiation and virulence in Fusarium 715
graminearum. Mol Plant Pathol 14:71-83. 716
22. Jiang H, Shen Y, Liu W, Lu L. 2014. Deletion of the putative 717
stretch-activated ion channel Mid1 is hypervirulent in Aspergillus fumigatus. 718
Fungal Genet Biol 62:62-70. 719
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
23. Zhang C, Meng X, Wei X, Lu L. 2016. Highly efficient CRISPR 720
mutagenesis by microhomology-mediated end joining in Aspergillus 721
fumigatus. Fungal Genet Biol 86:47-57. 722
24. Szewczyk E, Nayak T, Oakley CE, Edgerton H, Xiong Y, Taheri-Talesh 723
N, Osmani SA, Oakley BR. 2006. Fusion PCR and gene targeting in 724
Aspergillus nidulans. Nat Protoc 1:3111-3120. 725
25. Song J, Zhai P, Zhang Y, Zhang C, Sang H, Han G, Keller NP, Lu L. 726
2016. The Aspergillus fumigatus Damage Resistance Protein Family 727
Coordinately Regulates Ergosterol Biosynthesis and Azole Susceptibility. 728
MBio 7:e01919-01915. 729
26. Long N, Xu X, Qian H, Zhang S, Lu L. 2016. A Putative Mitochondrial 730
Iron Transporter MrsA in Aspergillus fumigatus Plays Important Roles in 731
Azole-, Oxidative Stress Responses and Virulence. Front Microbiol 7:716. 732
27. Yasmin S, Alcazar-Fuoli L, Grundlinger M, Puempel T, Cairns T, 733
Blatzer M, Lopez JF, Grimalt JO, Bignell E, Haas H. 2012. Mevalonate 734
governs interdependency of ergosterol and siderophore biosyntheses in the 735
fungal pathogen Aspergillus fumigatus. Proc Natl Acad Sci U S A 736
109:E497-504. 737
28. Li P, Xu X, Cao E, Yu B, Li W, Fan M, Huang M, Shi L, Zeng R, Su X, 738
Shi Y. 2014. Vitamin D deficiency causes defective resistance to Aspergillus 739
fumigatus in mice via aggravated and sustained inflammation. PLoS One 740
9:e99805. 741
29. Zhang C, Kong Q, Cai Z, Liu F, Chen P, Song J, Lu L, Sang H. 2015. 742
The newly nonsporulated characterization of an Aspergillus fumigatus 743
isolate from an immunocompetent patient and its clinic indication. Fungal 744
Genet Biol 81:250-260. 745
30. Parks LW, Smith SJ, Crowley JH. 1995. Biochemical and physiological 746
effects of sterol alterations in yeast--a review. Lipids 30:227-230. 747
31. Mollinedo F. 2012. Lipid raft involvement in yeast cell growth and death. 748
Front Oncol 2:140. 749
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
32. Tiedje C, Holland DG, Just U, Hofken T. 2007. Proteins involved in 750
sterol synthesis interact with Ste20 and regulate cell polarity. J Cell Sci 751
120:3613-3624. 752
33. Krijgsheld P, Bleichrodt R, van Veluw GJ, Wang F, Muller WH, 753
Dijksterhuis J, Wosten HA. 2013. Development in Aspergillus. Stud 754
Mycol 74:1-29. 755
34. Park HS, Yu JH. 2012. Genetic control of asexual sporulation in 756
filamentous fungi. Curr Opin Microbiol 15:669-677. 757
35. Affeldt KJ, Carrig J, Amare M, Keller NP. 2014. Global survey of 758
canonical Aspergillus flavus G protein-coupled receptors. MBio 759
5:e01501-01514. 760
36. Grice CM, Bertuzzi M, Bignell EM. 2013. Receptor-mediated signaling in 761
Aspergillus fumigatus. Front Microbiol 4:26. 762
37. Cai ZD, Chai YF, Zhang CY, Qiao WR, Sang H, Lu L. 2015. The 763
Gbeta-like protein CpcB is required for hyphal growth, conidiophore 764
morphology and pathogenicity in Aspergillus fumigatus. Fungal Genet Biol 765
81:120-131. 766
38. Ghannoum MA, Rice LB. 1999. Antifungal agents: mode of action, 767
mechanisms of resistance, and correlation of these mechanisms with 768
bacterial resistance. Clin Microbiol Rev 12:501-517. 769
39. Sun X, Wang W, Wang K, Yu X, Liu J, Zhou F, Xie B, Li S. 2013. Sterol 770
C-22 Desaturase ERG5 Mediates the Sensitivity to Antifungal Azoles in 771
Neurospora crassa and Fusarium verticillioides. Front Microbiol 4:127. 772
40. Kelly SL, Lamb DC, Baldwin BC, Corran AJ, Kelly DE. 1997. 773
Characterization of Saccharomyces cerevisiae CYP61, sterol 774
delta22-desaturase, and inhibition by azole antifungal agents. J Biol Chem 775
272:9986-9988. 776
41. Chung D, Thammahong A, Shepardson KM, Blosser SJ, Cramer RA. 777
2014. Endoplasmic reticulum localized PerA is required for cell wall 778
integrity, azole drug resistance, and virulence in Aspergillus fumigatus. Mol 779
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Microbiol 92:1279-1298. 780
42. Munayyer HK, Mann PA, Chau AS, Yarosh-Tomaine T, Greene JR, 781
Hare RS, Heimark L, Palermo RE, Loebenberg D, McNicholas PM. 782
2004. Posaconazole is a potent inhibitor of sterol 14 alpha-demethylation in 783
yeasts and molds. Antimicrob Agents Chemother 48:3690-3696. 784
43. Kelly SL, Lamb DC, Corran AJ, Baldwin BC, Kelly DE. 1995. Mode of 785
action and resistance to azole antifungals associated with the formation of 786
14 alpha-methylergosta-8,24(28)-dien-3 beta,6 alpha-diol. Biochem 787
Biophys Res Commun 207:910-915. 788
44. Watson PF, Rose ME, Ellis SW, England H, Kelly SL. 1989. Defective 789
sterol C5-6 desaturation and azole resistance: a new hypothesis for the 790
mode of action of azole antifungals. Biochem Biophys Res Commun 791
164:1170-1175. 792
793
794
FIGURE LEGENDS 795
FIG 1 Bioinformatics analysis of Erg4. (A) Phylogenetic analysis of Erg4 796
homologs from selected fungi, including A. fumigatus, S. cerevisiae, 797
Ustilago maydis, F. graminearum, Candida albicans, Cryptococcus gattii, 798
Neurospora crassa, Talaromyces marneffei, Schizosaccharomyces pombe, 799
A. nidulans, Trichoderma reesei, Rhizoctonia solani, Coccidioides 800
immitis, Histoplasma capsulatum. The phylogenetic tree 801
(Neighbor-Joining tree) were created using MEGA 5 software. (B) 802
Putative protein domains in A. fumigatus Erg4A and Erg4B and S. 803
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
cerevisiae Erg4. To find the putative protein domains, TMHMM Server v. 804
2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0) was utilized. 805
FIG 2 Phenotypic characterization of the erg4A and/or erg4B-null 806
mutants. (A) Colony and conidiophore morphology of the parental 807
wild-type strain, and the Δerg4A, Δerg4B, and Δerg4AΔerg4B mutants. 808
(B) Colony and conidiophore morphology of the Δerg4AΔerg4B mutant 809
under the condition with or without extra ergosterol addition (40 µM). (C) 810
Colony and conidiophore morphology of the Δerg4AΔerg4B derived 811
strains that complemented with ku80, erg4A and/or erg4B genes. (D) 812
Hyphal morphology of the parental wild-type, Δerg4A, Δerg4B, and 813
Δerg4AΔerg4B strains stained with calcofluor white (CFW) or filipin. 814
Scale bar = 5 μm. 815
FIG 3 Virulence test of Δerg4AΔerg4B in a murine model of invasive 816
pulmonary aspergillosis. (A) Survival curve of mice infected with wild 817
type, Δerg4AΔerg4B, and the control PBS. (B) Plate cultured A. 818
fumigatus isolated from the relative lung tissue of post-infected mice . (C) 819
Histopathological sections of lung tissue of the sacrificed mice infected 820
with each strain. Periodic acid-schiff (PAS) stains were utilized to 821
visualize fungal growth. 822
FIG 4 Erg4A and Erg4B are required for the biosynthesis of ergosterol. 823
(A) Schematic line of ergosterol biosynthetic pathway. (B) and (C) The 824
ergosterol production of the parental wild-type, Δerg4A, Δerg4B, and 825
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Δerg4AΔerg4B strains analyzed by HPLC assays. NS represents no 826
significant difference. ***P< 0.001 compared with the parental wild-type 827
strain. P-values were determined using analysis of variance. 828
FIG 5 Loss of ER-localized Erg4A induces the over-expression of Erg4B 829
and vice versa.. (A) and (B) GFP-tagged Erg4A and Erg4B were located 830
in endoplasmic reticulum. DAPI was used to visualize nucleus. Erg11A 831
was used to label endoplasmic reticulum. Scale bar = 5 μm. Transcript 832
level of erg4A and erg4B (relative to tubA) in the parental wild-type 833
strain (C) and in Δerg4B or Δerg4A mutants (D). 834
FIG 6 Comparison of the sensitivity of the parental wild-type, Δerg4A, 835
Δerg4B, and Δerg4AΔerg4B strains to cell stresses mediated by NaCl 836
(800 mM), D-sorbitol (1.2 M), H2O2 (3 mM), menadione (25 µM), 837
calcofluor white (CFW) (40 µg/ml), and congo red (CR) (150 µg/ml). 838
FIG 7 Δerg4AΔerg4B shows increased susceptibility to azoles 839
(itraconazole and voriconazole) but decreased susceptibility to terbinafine 840
or amphotericin B. (A) and (C) Colony growth of the related strains in 841
the presence of itraconazole (0.75 µg/ml), voriconazole (0.1 µg/ml), 842
terbinafine (0.2 µg/ml), amphotericin B (6 µg/ml), and caspofungin (0.3 843
µg/ml). (B) Minimum inhibitory concentrations (MICs) test. 844
1×105 conidia of the parental wild-type strain or Δerg4AΔerg4B was 845
mixed in YAG, and E-test strips of itraconazole or voriconazole was 846
placed on the plates incubated at 37°C for 1.5 days. 847
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
848
Table 1 A. fumigatus strains used in this study. 849
Strain Genotype Reference or source
A1160 Δku80, pyrG FGSC
A1160C Δku80, A1160::pyrG (22)
LN01 Δku80, pyrG, Δerg4A::hph This study
LN02 Δku80, pyrG, Δerg4B::pyr4 This study
LN03 Δku80, pyrG, Δerg4A::hph,
Δerg4B::pyr4
This study
LN04 Δku80, pyrG, erg4B::gfp::pyrG This study
LN05
LN06
LN07
LN08
LN09
LN10
LN11
Δku80, pyrG, gpdA(p)-gfp-erg4A, hph
Δku80, pyrG, Δerg4A::hph,
gpdA(p)-gfp-erg4A, pyr4
Δku80, pyrG, Δerg4B::pyr4,
erg4B(p)-erg4B-gfp, hph
Δku80, pyrG, Δerg4A::hph,
Δerg4B::pyr4, erg4A, ptrA
Δku80, pyrG, Δerg4A::hph,
Δerg4B::pyr4, erg4B, ptrA
Δku80, pyrG, Δerg4A::hph,
Δerg4B::pyr4, erg4A, erg4B, ptrA
Δku80, pyrG, Δerg4A::hph,
Δerg4B::pyr4, gpdA(p)-ku80, ptrA
This study
This study
This study
This study
This study
This study
This study
850
851
852
853
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 2 Primers used in this study. 854
Primer name Primer sequence 5' - 3'
erg4A P1 TGTTCAGACAGTAGTTCGCTTTTC
erg4A P2 CTACTGCGCTGATTCCGTTCT
erg4A P3 GTAGAGATACAAGGGAATTCGGTCTGTTGTACTCCGAAGTCAAT
erg4A P4 CCACTCCACATCTCCACTCGACTTTATTCCAGTAAGTTTCGCTGAT
erg4A P5 CATTGACGATGTACTCTTACCAACC
erg4A P6 GCTACTGAGTCGGAAAGGTTGA
erg4A S1 AGCAAAATGGCAGCAAAAGAC
erg4A S2
erg4A F
erg4A R
CAATAGTGAGATACCACGACGACA
GGTTCTGTGCATTTGCTAGATGC
TGCAGCTATCTGTCTATCATAC
erg4B P1 AGGTGGTCTTATGGGCGTGTA
erg4B P2 GAAATGTCTAATGCCCTCTTGAA
erg4B P3 CGATTAAGTTGGGTAACGCCACCCAGTTAAGAGGCAAGCAAT
erg4B P4 ATAAGTAGCCAGTTCCCGAAAGCGCGACGAACAGGCTGACTAAT
erg4B P5 CCAGGAATAGTGGGATGGAAC
erg4B P6 TGAACACTACGACACCAGGGA
erg4B S1 AAACCTACCTTTTGCGACAGC
erg4B S2
erg4B F
erg4B R
GAACCCGATCATCATGGACAG
GTGCAGGTGGTCTTATGGGCGTG
GTGAACCGCCGATGGACATCGAG
erg4B-gfp P1 TCCTTCGTCGCATACTTCT
erg4B-gfp P2 CAATCCTAGAATGTTCGGTAT
erg4B-gfp P3 CCAGCGCCTGCACCAGCTCCAGATGAGGAATAGCTTACAGGG
erg4B-gfp P4 CATCAGTGCCTCCTCTCAGACAGTGAAACGCGACGAACAGGCTGAC
erg4B-gfp P5 CTTGCTTGGCGTCTTGGAG
erg4B-gfp P6
gfp-pyrG F
GAACACTACGACACCAGGGA
GGAGCTGGTGCAGGCGCTGG
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
gfp-pyrG R
gfp-erg4A P1
gfp-erg4A P2
gfp-erg4A P3
gfp-erg4A P4
CTGTCTGAGAGGAGGCACTGATG
CCTTTAATCAAGCTTATCGATATGAGTAAAGGAGAAGAACTTTTCAC
CTGGATCTCGGAGATTTTGTATAG
CTATACAAAATCTCCGAGATCCAGAAGAGCAAAATGGCAGCAAAAGAC
CTCGAGGTCGACGGTATCGATCTAATCTGTCAGCTTATCCTTG
pyr4 F TGGCGTTACCCAACTTAATCG
pyr4 R GCTTTCGGGAACTGGCTACTTAT
hph F GAATTCCCTTGTATCTCTACACACAGGC
hph R
ptrA F
ptrA R
d-hph F
d-hph R
ku 80 F
ku 80 R
TCGAGTGGAGATGTGGAGTGGGCGCTTA
GCCTAGATGGCCTCTTGCATC
CATGGCAGACACTGAAGCAAC
CTCCTCTTCTTTACTCTGA
TCCATGTTGGTAGTTGTGA
CCTTTAATCAAGCTTATCGATATGGCTGAAAAGGAAGCAACCG
CTCGAGGTCGACGGTATCGATTCAGTATATGCCTCTCGAACTC
RT-erg4A F GTTCTTCGCTATTTCCTGG
RT-erg4A R GCGGTTGATATCTCGTCTC
RT-erg4B F AGACTTTCCCTCAGCTCCC
RT-erg4B R CCAGTTCAAGGCGAAATAA
RT-tubA F ACGTTACCTCACCTGCTCTGC
RT-tubA R GATGTTGTTGGGAATCCACTCA
855
on January 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from