See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/292980317

ERIC-PCR Analysis of the Clinical and Environmental strains of V. cholerae

during 2013 Epidemic in Nigeria *

Article · November 2015

CITATION

1READS

77

20 authors, including:

Some of the authors of this publication are also working on these related projects:

Molecular studies of Foodborne Clostridium species View project

Dyspepsia View project

Stella Ifeanyi Smith

Nigerian Institute of Medical Research

157 PUBLICATIONS   1,400 CITATIONS   

SEE PROFILE

Francisca Obiageri Nwaokorie

College of Medicine University of Lagos

52 PUBLICATIONS   195 CITATIONS   

SEE PROFILE

Oluwatoyin B Awoderu

Nigerian Institute of Medical Research

5 PUBLICATIONS   4 CITATIONS   

SEE PROFILE

Tajudeen Bamidele

Nigerian Institute of Medical Research

19 PUBLICATIONS   29 CITATIONS   

SEE PROFILE

All content following this page was uploaded by Stella Ifeanyi Smith on 04 February 2016.

The user has requested enhancement of the downloaded file.

International Journal of Advances in Health Sciences (IJHS) ISSN 2349-7033 Vol2, Issue6, 2015, pp670-680

http://www.ijhsonline.com Research Article

ERIC-PCR Analysis of the Clinical and Environmental strains of V.

cholerae during 2013 Epidemic in Nigeria

*Smith Stella,1 Nwaokorie Francisca,1 Awoderu Oluwatoyin 1, Bamidele Tajudeen,1 Akinsinde

Kehinde,1 Ochoga Michael,2 Oladele David1, Bamidele Moses,1 Fesobi Toun, 1 Afocha

Eberechukwu,1 Amoo Samuel, 1 Ajayi Morakinyo, 1 Atat Prince 1 Ogbonna Francisca, 1 Nduaga

Samuel, 1 Idika Nneoma,1 Oparaugo Chinedu, 1 Musa Adesola,1 Adeneye Adeniyi,1 Ijeh

Margaret1, Ujah Innocent1

1Emergency Preparedness and Response Research Group,

Nigerian Institute of Medical Research, Yaba, Lagos

2 Federal Ministry of Health Abuja

*Corresponding Author Email: stellaismith@yahoo.com Fax: +234 342 5171

[Received-15/10/2015, Accepted-06/11/2015, Published- 21/11/2015]

ABSTRACT

Background: Molecular markers are important tools in the monitoring of toxigenic strains of Vibrio cholerae in environmental and clinical samples. Objectives: The study was aimed at determining the clinical and environmental strains of V. cholerae associated with cholera epidemic and compare their genetic relatedness for epidemiological purposes. Materials and Methods: Clinical and environmental samples were collected from six states (Ogun, Oyo, Lagos, Zamfara, Plateau and Benue) following report of cholera epidemic and identified using biochemical and serological techniques. The molecular markers used were wbe O1, wbe O139, ctx, tcp genes and ERIC-PCR. Results: The serotype of the clinical isolates was Ogawa while eight environmental isolates from Ogun and Oyo identified as V. cholerae were non-Ogawa non-Inaba. Out of a total of 198 samples, 41 (20.7%) were Vibrio species with thirty six (87.8%) comprising V. cholerae. All isolates (clinical and environmental) possessed the tcp and ctxA genes, with the exception of one clinical isolate that did not possess the ctxA gene. Out of 30 isolates genotyped by ERIC-PCR, 16 ERIC fingerprint patterns (FP) were distributed into three major clusters. There were distinct differences between the clinical and the environmental isolates as well as isolates from the different states. Genetic similarities between clinical and environmental strains were also observed. Conclusion: Toxigenic V. cholerae 01 serotype Ogawa was responsible for the cholera outbreak in Nigeria in 2013. Based on DNA finger printing of clinical and environmental isolates, it was observed that the toxigenic V. cholerae strains in human infections could be linked to the environmental strains. ERIC-PCR is a useful tool for discriminating our clinical and environmental isolates. Key words: V. cholerae, cholera, clinical, environmental, ERIC-PCR, Nigeria.

ERIC-PCR Analysis of the Clinical and Environmental strains of V. cholerae during 2013 Epidemic in Nigeria

Smith Stella, et al. 671

INTRODUCTION The annual global burden of Vibrio cholerae infection shows that about 1.4 billion people were at risk, with 2.8 million cases in endemic countries recording over 91,000 deaths annually and about 87,000 cases in non-endemic countries1. Between 2007 - 2013 alone, Nigeria reported 91,090 cases, 3358 deaths and case fatality rate of 3.7 making it one of the worst hit regions in the last five years2,3. There are more than 200 distinct serogroups of V. cholerae, however only O1 and O139 were recognized as being responsible for epidemic and pandemic cholera. Analyses of these serogroups isolated during outbreak shows that this acute diarrhoeal infection was due to the pathogenic strains that were able to produce cholera toxins. Infections due to non- toxigenic strains are well documented. Serogroup O1 was further subdivided into Ogawa and Inaba serotypes and El Tor and classical biotypes. The classical and El Tor biotypes are implicated in disease outbreaks4. Overall V. cholerae O1, O139, non-O1 and non-O139 serogroups have been isolated from clinical and environmental samples5,6. Pathogenic strains of V. cholerae differ considerably according to specific phenotypic properties that could be determined by assessing haemolysis of sheep erythrocytes, agglutination of chicken erythrocytes, sensitivity to polymycin B and phage susceptibilities7. In addition, genotypic differences focusing at assessing the toxin regulator (tox), cholera toxin (ctx), ompU, toxin-coregulated pilus (tcp), accessory cholera enterotoxin (ace), zot and srtR virulence genes have been used to monitor the variants associated with pandemic infections5,8-10. The present 7th pandemic strains differs in two major genomic regions described as vibrio seventh pandemic pathogenicity island- 1 (vsp-I) and vsp- II11 with hybrids of both classical (CL) and ET biotypes in existence12. The tcp and ctx toxin genes are the main virulence factors which over the years have been used to assess the virulence and pathogenic potentials of clinical and environmental stains. Pathogenic

strains of V. cholerae may be found in the environments especially, sewage lines, farm products, edible ice and rivers, ponds, wells and other water storage devices13 which serve as reservoirs. Identification of epidemic strains and associated sources of infection is important in defining disease epidemiology, management and control. PCR techniques have been used to detect the presence of microbial species, their virulence potentials and genetic types. One of such methods is ERIC-PCR designed for intraspecies profiling of enteric bacteria species due to its highly conserved sequences present as multiple copies in the genome of all bacteria. This method has been shown to provide better discrimination among Escherichia coli14 as well as enhanced use as a molecular marker of genetic diversity in clinical and environmental Vibrio species15–19 in preference to other genetic finger printing methods. The genetic pattern of V. cholerae species responsible for disease outbreaks varies considerably across countries. To the best of our knowledge no study in Nigeria has described the genetic variation of V. cholerae circulating in the entire population. Therefore, there was a need to define the genetic relatedness of clinical and environmental strains using ERIC-PCR from isolates obtained during the cholera outbreak in 2013 in Nigeria. MATERIALS AND METHODS Survey, Bacterial isolation and identification of Toxigenic V. cholerae strains. During the period from July to November, 2013, Clinical and environmental samples (well water, sewage, drainage and soil) were collected from six states (Ogun Oyo, and Lagos in South West, Zamfara in North West in addition to Plateau and Benue in North Central) in Nigeria following report of cholera epidemic and analysed at the Cholera Research Laboratory, Nigerian Institute of Medical Research (NIMR), Yaba, Lagos. Samples were collected and transported in Alkaline Peptone

ERIC-PCR Analysis of the Clinical and Environmental strains of V. cholerae during 2013 Epidemic in Nigeria

Smith Stella, et al. 672

water (Oxoid, UK) and Cary-Blair medium (Oxoid, UK). The isolates in the Cary-Blair medium were subcultured into alkaline peptone water (pH 8.6) for growth enrichment and incubated at 37 oC for 6 h along with the isolates transported in Alkaline Peptone water (Oxoid, UK). Each bacterial culture was then subcultured onto TCBS agar (Oxoid, UK) at 37 0C for 24 h. V. cholerae were confirmed using biochemical and serological techniques and then stored in 10% skimmed milk at -80°C in ultra low freezer (Thermo Scientific, Germany) for further studies. MOLECULAR ANALYSIS Genomic DNA preparation The Vibrio cholerae 01 strains were grown in Tryptone soy broth at 370C for 24 h. Thereafter 1 ml of the liquid culture was transferred to micro tube of 1.5 ml volume. Bacterial cells were harvested by centrifugation at 10, 000 rpm for 2 min. The supernatant was discarded and the pellet washed twice with sterile distilled water and resuspended in 1.5 ml sterile distilled water. The bacteria suspension was boiled for 10 min to lyse the cells and release the DNA followed by a ‘cold shock’ treatment in ice for 10 min, centrifuged at 12,000 rpm for 5 min and the clear supernatant was transferred to a new micro tube. The supernatant containing bacterial template DNA was used directly in specific PCR for the detection of wbe, wbf 0139, ctxA and tcp genes and ERIC-PCR fingerprinting. PCR Amplifications and cycling conditions PCR amplifications for wbe, ctxA and tcp were performed on a thermocycler (Eppendorf Mastercycler Pro, Hamburg, Germany.). The primer pairs used is shown in Table 1. The reaction volume was 25 µl and consisted of 10x PCR buffer, 25 mM MgCl2, 10 mM dNTP’s mixture, 5 U/µl of Taq DNA polymerase (Fermentas, USA), 10 pmol of each primer set, and 5 ng of extracted bacterial DNA. Amplifications were performed as follows: an initial denaturation at 940C for 4 min followed by 35 cycles defined by denaturation at 940C for 1 min, primer annealing at 600C for 1 min

for the ctxA gene and wbe O1 gene, 55 ⁰C for 1 min for wbf O139 and 500C for tcpA gene, The primer extension for the four genes was 720C for 1 min followed by a final elongation at 720C for 5 min. ERIC-PCR Reactions were performed in a 25 µl volume in 0.2 ml micro tube and with mixture of 8 µl sterile ultra pure water,12.5µl of master mix, 1µl of MgCl2 (Fermentas, USA), 0.5 µl each of 10 pmol ERIC 1 and ERIC 2, 0.5 µl of 5 U/µl Taq DNA polymerase and 2 µl of DNA template. PCR was done by an initial denaturation at 900C for 7 min, the 30 amplification cycles of denaturing at 900C for 30 s, annealing at 450C for 1 min, extension at 650C for 3 min, final extension at 700C for 10 min. Agarose Gel Electrophoresis The PCR amplification products were fractionated by electrophoresis through 1.2% agarose in 1 X TAE buffer (0.04 M Tris-acetate, 0.001 M EDTA [pH 8.0]) visualized by staining the gel with ethidium bromide (10 µg/ml). The gel pictures were taken using a Gel Documentation System (Clinix, Model 1500, China). A 100 bp DNA marker (Promega, USA) was used as a molecular weight marker. Statistical analysis After gel documentation, the stored images were analysed using GelCompar Software version 3.1 (Applied Maths). Each DNA fragment generated was treated as a separate character and scored as a discrete variable using 1 to indicate presence, and 0 for absence. Dendrograms for cluster analysis were based on similarity matrices calculated from the Pearson product-moment correlation coefficient and the unweighted pair group method using arithmetic averages (UPGMA) algorithm. The percentage of similarity denoted the relatedness of one strain to another where 100% similarity showed that the strains were identical. RESULTS

A total of 198 samples were collected of which 137 were clinical samples and 61 environmental (Table 2). Zamfara had the

ERIC-PCR Analysis of the Clinical and Environmental strains of V. cholerae during 2013 Epidemic in Nigeria

Smith Stella, et al. 673

highest number of isolates and Plateau the lowest. Forty one clinical and environmental isolates were identified as Vibrio spp with 36 (87.8%) confirmed as V. cholerae. Out of the 36 confirmed V. cholerae, 28 (77.8%) were clinical isolates while 8 (22.2%) were environmental isolates. The serological analysis showed that the clinical isolates were of the Ogawa serotype and El Tor biotype while eight environmental isolates from Ogun and Oyo states identified as V. cholerae were non-Ogawa non-Inaba with all isolates from Benue state negative for V. cholerae. All isolates were positive for wbe 01 gene and negative for wbe O139 gene. The eight environmental isolates from Ogun and Oyo were positive for tcpA and ctxA gene by PCR (Table 3). All clinical isolates except IJR2V showed amplification for ctxA while all were positive for tcpA genes. Thirty confirmed isolates from Ogun and Zamfara states were typed by the ERIC primer. The 30 isolates gave rise to 16 fingerprint patterns (FP) comprising of one to seven bands. Ten clinical isolates from Ogun state gave rise to four fingerprint patterns, while the seven environmental isolates from Ogun state gave six distinct fingerprint patterns. On the other hand, the 13 clinical isolates from Zamfara gave rise to eight FP. The genetic pattern of the isolates is as shown in Figure 1 with band fragments ranging from 50-600 bp. There were also identical fingerprint profiles which showed that some isolates belonged to the same clone as follows: 1, 2, 12, 14 and 25; 24 and 28; 20 - 22; 29 and 30; 26 and 27; 3 -7 and 8 and 9. The distinct groups and origin of isolates are shown in Table 2. Majority of the environmental samples had distinct profiles. However, Ogun environmental isolates E2 and E2BP (both from sewage water) shared the same FP with clinical samples IJR2V and IJR 1 obtained from infected patients in the same Ijaye community from Ogun state. Interestingly, one of the strains isolated from clinical samples from Zamfara belong to this clone. Fig 2 shows dendrogram analysis of discriminating genetic profile of V. cholerae strains and with a similarity of 74%,

three major clusters were observed. Most isolates from Zamfara fell into one distinct cluster except for isolates 24, 25, and 28 that were in cluster A1 and 19 in B1.

DISCUSSION Cholera is endemic in Nigeria and cases of severe outbreaks have consistently been recorded in Nigeria since 2010 with a case fatality ratio of 5.1%2. During the 2013 outbreak, 23 out of 36 states were affected. Zamfara State in North West Nigeria was worst hit and in this study the highest number of samples and corresponding isolates were obtained from this state. This study was corroborated by earlier studies by Dalhat et al.,2 where potential endemicity of cholera was reported in the northern part of Nigeria. The cholera outbreaks in these regions were attributed to be due mainly to limited access to safe water, poor sanitation and effective surveillance and response2,20. All isolates from Benue states were negative for V. cholerae. This gave the indication that the suspected gastroenteritis outbreak that occurred in Otukpo LGA, between October and November 2013 was not due to V. cholerae. Other isolates were however obtained from the samples analysed. All our isolates were of the El Tor biotype and previous reports have corroborated this7,21–22 while Utsalo et al.23 reported on the presence of V. cholerae 01 El Tor and Classical biotypes from the south-south. Species of Ogawa serotype were obtained from all the clinical samples; however non-Ogawa and non-Inaba serotypes were obtained from some environmental samples from Ogun and Oyo states. This is actually unclear as none of our clinical isolates were of the non-Ogawa and non-Inaba serotypes. Although this study did not analyse samples from all the states, similar studies carried out in some other states in 2013 and previous cholera outbreaks in the north and other parts of the country agreed with the involvement of the Ogawa serotype22,24–26 with the exception of a report by Usman et al.21 where the cholera outbreaks was caused by V. cholerae of Inaba serotype. A recent report by

ERIC-PCR Analysis of the Clinical and Environmental strains of V. cholerae during 2013 Epidemic in Nigeria

Smith Stella, et al. 674

Shrestha et al.27 from Nepal confirmed all their clinical and environmental isolates to be serogroup 01of the V. cholerae serotype Ogawa but in their own study the isolates were of the classical biotype. Furthermore, all but one of the isolates possessed cholera toxin gene ctxA and tcpA. This confirms that toxigenic V. cholerae were responsible for the cholera outbreak in Nigeria in 2013. Surprising, the clinical isolate from a patient’s vomitus was negative for the ctxA gene but isolate from the rectal swab was positive for the ctxA gene. Even more surprising is the fact that both isolates belonged to the same genetic FP, suggesting that as previously reported variations occur mainly in the genetic determinants of virulence24. All our environmental isolates possessed the ctxA and tcpA genes suggesting that the aquatic environment from where the samples were collected could pose a continued impending threat of cholera outbreak in the region4,19. There is therefore the need to promote good sanitary condition and provide potable water to these communities. In contrast to our study were those of Rivera et al15 and Patrick et al.28 where the ctx gene was absent in their environmental isolates. Previous reports had shown that environmental strains of V. cholerae lacked the ability to produce cholera toxin29, but it has now been widely accepted that the aquatic environment is a reservoir of toxigenic V. cholerae30. To support our results were studies by Chakraborty et al31 and Shrestha et al27 where all their environmental isolates possessed the ctx gene. ERIC-PCR was useful in differentiating our clinical as well as environmental isolates from different geographical locations in the country. There were distinct differences between the clinical and the environmental isolates as well as isolates from the different states although our study observed identical FP among some clinical and environmental isolates. Of the 36 isolates obtained and genotyped by ERIC-PCR, majority of the environmental samples had distinct profiles with seven environmental isolates giving rise to six distinct FPs indicating

the presence of heterogeneous group of organisms in the environmental, as corroborated by Rivera et al.15. However, Ogun environmental isolates E2 and E2BP both obtained from sewage water showed the same genetic FP with clinical samples IJR2V and IJR 1 obtained from infected patients in the same Ijaye community. This could probably indicate the source of the cholera outbreak to be from the sewage water. A similar report by Ranjbar et al.16 confirmed well water to be the source of cholera outbreak during a wedding ceremony in Iran using the ERIC-PCR while Zo et al30 concluded that the aquatic environment was the reservoir for cholera and was associated with shifts in the dynamics of the disease. Other reports by Colombo et al32, Teh et al17, Wutarangi et al18 and Ramazanzadeh et al13 all corroborated the usefulness of ERIC-PCR in analysis of V. cholerae diversity. In addition, the toxigenic environmental isolates that shared the same profile with the clinical strains were all non-01/0139 strains and this indicates similarity with the epidemic strains on the molecular level. Non-01/0139 has been shown to cause gastroenteritis and extraintestinal infections33; and so the presence of V. cholerae non-01 strains in any environment should not be ignored. One of the strains isolated from a clinical sample from Zamfara in the northern region was of the same genetic FP with the strains from Ogun state in southern region of Nigeria. This alludes to the fact that no correlation could be inferred between genetic similarity and geographical source of isolates in this case. Therefore any program designed to address the management of V. cholerae in Nigeria should focus on this high level of diversity. A comparison of clinical and environmental isolates by Zo et al30 led to the conclusion that clinical V. cholerae 01 populations in Bangladesh were relatively homogeneous in contrast to environmental populations that may be separated by geographical isolation. Our study however did no compare environmental

ERIC-PCR Analysis of the Clinical and Environmental strains of V. cholerae during 2013 Epidemic in Nigeria

Smith Stella, et al. 675

isolates from different geographical regions by ERIC-PCR. The dendrogram analysis showed that most isolates from Zamfara fell into one distinct cluster while the Ogun isolates exhibited a high degree of genetic diversity having an isolate falling into three different clusters. Samples from Oyo and Lagos states were not genotyped due to the limited number of isolates obtained. This limited our ability to compare environmental and clinical strains from those affected communities. The ERIC-PCR used for DNA finger printing of clinical and environmental isolates was able to type majority of the isolated obtained. Similarly the primer used to detect the biotypes and presence of toxigenic strains can be used to detect virulent strain in a cholera-endemic region during an outbreak directly from the clinical specimen. CONCLUSION: Toxigenic V. cholerae 01 serotype Ogawa was responsible for the cholera outbreak in Nigeria. ERIC-PCR is a useful tool for discriminating our clinical and environmental isolates and more importantly the unique FPs will help investigate the relatedness of isolates from different sources and map sources of V. cholerae in future outbreaks. ACKNOWLEDGEMENTS The authors wish to acknowledge Alexander von Humboldt stiftung for the equipment donation of refrigerated microcentrifuge to SIS used in this study. The authors also wish to acknowledge the States Ministry of Health of Lagos, Ogun, Oyo, Benue, Zamfara and Plateau states for their support during the field work to collect samples. REFERENCES 1. Ali, M., Nelson, A.R., Lopez, A.L., Sack,

D.A. 2015: Updated global burden of cholera in endemic countries. PLoS Negl Trop Dis 9: e0003832. doi: 10.1371/journal.pntd.0003832.

2. Dalhat, M.M., Isa, A.N., Nguku, P., Nasir, S.G., Urban, K., Abdulaziz, M., Dankoli, R.S., Nsubuga, P., Poggensee, G. 2014: Descriptive characterization of the 2010 cholera outbreak in Nigeria. BMC Public Health 14:1167. doi: 10.1186/1471-2458-14-1167.

3. Ujah, Innocent I.A., Francisca Nwaokorie, Adeniyi Adeneye, David Oladele, Tajudeen Bamidele, Sola Musa, Kehinde Akinside, Jerry Iwuora, Stella Smith. 2015:A review of perception and myth on causes of cholera infection in endemic areas of Nigeria. Afr J Med Res 9: 557 – 564.

4. Kumar, P., Mishra, D.K., Deshmukh, D.G., Jain, M., Ingole, K.V., Goel, A.K., Yadava, P.K. 2014: Vibrio cholerae 01 Ogawa El Tor strains with the ctxB7 allele driving cholera outbreaks in south-western India in 2012. Infect Genet Evol 25: 93 – 96.

5. Oyedeji, K.S., Niemogha, M.T., Nwaokorie, F.O., Bamidele, T.A., Ochoga, M., Akinsinde, K.A., Brai, B.I., Oladele, D., Omonigbehin, E.A., Bamidele, M., Fesobi, T.W., Musa, A.Z., Adeneye, A.K., Smith, S.I., Ujah, I.A. 2013: Molecular characterization of the circulating strains of Vibrio cholerae during 2010 cholera outbreak in Nigeria. J Health Popul Nutr 31:178-84.

6. Schirmeister, F., Wieczorek, A., Dieckmann, R., Taureck, K., Strauch, E. (2014): Evaluation of molecular methods to discriminate the closely related species Vibrio fluvialis and Vibrio furnissii. Int J Med Microbiol 304:851-7. doi: 10.1016/j.ijmm.2014.09.001.

7. Akinsinde, K.A., Iwalokun, B.A., Oluwadun, A., Smith, S.I., Fowora, M., Nwaokorie, F.O., Bamidele, T.A., Olukoya, D.K. and Ujah, I.A.O. 2015: Distribution of phage types of Vibrio cholerae 01 biotype El Tor in Nigeria (2007 – 2013): Implication in cholera mortality. Int J Med Med Sci 6: 245 – 250.

ERIC-PCR Analysis of the Clinical and Environmental strains of V. cholerae during 2013 Epidemic in Nigeria

Smith Stella, et al. 676

8. Kaper, J.B., Morris, J.G. Jr, Levine, M.M. 1995: Cholera. Clin Microbiol Rev 8:48-86.

9. Talkington, D., Bopp, C., Tarr, C., Parsons, M.B., Dahourou, G., Freeman, M., Joyce, K., Turnsek, M., Garrett, N., Humphrys, M., Gomez, G., Stroika, S., Boncy, J., Ochieng, B., Oundo, J., Klena, J., Smith, A., Keddy, K., Gerner-Smidt, P. 2011: Characterization of toxigenic Vibrio cholerae from Haiti, 2010-2011. Emerg Infect Dis:2122-9. doi: 10.3201/eid1711.110805.

10. Trucksis, M., Galen, J.E., Michalski, J., Fasano, A., Kaper, J.B. 1993: Accessory cholera enterotoxin (Ace), the third toxin of a Vibrio cholerae virulence cassette. Proc Natl Acad Sci USA 90:5267-71.

11. Dziejman, M., Balon, E., Boyd, D., Fraser, C.M., Heidelberg, J.F., Mekalanos, J.J. 2002: Comparative genomic analysis of Vibrio cholerae: genes that correlate with cholera endemic and pandemic disease. Proc Natl Acad Sci 99:1556-61.

12. Nair, G.B., Qadri, F., Holmgren, J., Svennerholm, A.M., Safa, A., Bhuiyan, N.A., Ahmad, Q.S., Faruque, S.M., Faruque, A.S., Takeda, Y., Sack, D.A. 2006: Cholera due to altered El Tor strains of Vibrio cholerae O1 in Bangladesh. J Clin Microbiol 44:4211-4213.

13. Ramazanzadeh, R., Rouhi, S., Shakib, P., Shahbazi, B., Bidarpour, F., Karimi, M. 2015: Molecular Characterization of Vibrio cholerae Isolated From Clinical Samples in Kurdistan Province, Iran. Jundishapur J Microbiol 8:e18119. doi: 10.5812/jjm.8(5)2015.18119.

14. Ramazanzadeh, R., Zamani, S., Zamani, S. 2013:Genetic diversity in clinical isolates of Escherichia coli by enterobacterial repetitive intergenic consensus (ERIC)-PCR technique in Sanandaj hospitals. Iran J Microbiol 5:126-31.

15. Rivera, I.G., Chowdhury, M.A.R., Huq, A., Jacobs, D., Martins, M.T., Colwell, R.R. 1995: Enterobacterial Repetitive Intergenic Consensus Sequences and the

PCR to Generate Fingerprints of Genomic DNAs from Vibrio cholerae 01, 0139 and Non-01 Strains. Appl Environ Microbiol 61: 2898 – 2904.

16. Ranjbar, R., Rahbar, M., Naghoni, A., Farshad, S., Darvari, A., Scagcheraghi, F. 2011: A cholera outbreak associated with drinking contaminated well water. Arch Iran Med 14: 339 – 340.

17. Teh, C.S.J., Thong, K.L., Oawa, R., Chua, K.H. 2011: Comparative PCR-based fingerprinting of Vibrio cholerae isolated in Malaysia. J Gen Appl Microbiol 57: 19 – 26.

18. Waturangi, D.E., Joanito, I., Yogi, Y., Thomas, S. 2012: Use of REP- and ERIC-PCR to reveal genetic heterogeneity of Vibrio cholerae from edible ice in Jakarta, Indonesia. Gut Pathog 4:2. doi: 10.1186/1757-4749-4-2.

19. Dalusi, L., Lyimo, T.J., Lugomela, C., Hosea, K.M., Sjoling, S. 2015: Toxigenic Vibrio cholerae identified in estuaries of Tanzania using PCR techniques. FEMS Microbiol Lett 362: pii:fnv009. Doi:10.1093/femsle/fnv009.

20. Hutin, Y., Luby, S., Paquet, C. 2003: A large cholera outbreak in Kano City, Nigeria: the importance of hand washing with soap and the danger of street-vended water. J Water Health 1:45-52.

21. Usman, A., Sarkinfada, F., Mufunda, J., Nyarango, P., Mansur, K., Daiyabu, T.M. 2005: Recurrent cholera epidemics in Kano-northern Nigeria. Cent Afr J Med 51: 34 – 8.

22. Onyemelukwe, G.C., and Lawande, R.V. 1991: Serotype variation in Vibrio cholerae El Tor diarrhoea in northern Nigeria. Cent Afr J Med 37: 186 – 9.

23. Utsalo, S.J., Eko, F.O., Antia-Obong, E.O. 1992: Features of cholera and Vibrio parahaemolyticus diarrhoea endemicity in Calabar, Nigeria. Eur J Epidemiol 8: 856 – 60.

24. Quilici, M-L., Massanet, D., Gake, B., Bwalki, B., Olson, D.M. 2010: Vibrio cholerae 01 variant with reduced

ERIC-PCR Analysis of the Clinical and Environmental strains of V. cholerae during 2013 Epidemic in Nigeria

Smith Stella, et al. 677

susceptibility to ciprofloxacin, Western, Africa. Emerg Infect Dis 16: 1804 – 1805.

25. Ishaku, A.A., Shadrack, B.E., Ajumobi, O., Olayinka, A., Nguku, P. 2014: Investigation of cholera outbreak in an Urban North Central Nigerian Community-The Akwanga Experience. Public Health Research 4: 7 -12.

26. Umoh, J.U., Adesiyun, A.A., Adekeye, J.O., Nadarajah, M. 1983: Epidemiological features of an outbreak of gastroenteritis/cholera in Katsina, Northern Nigeria. J Hyg (Lond) 91:101-11.

27. Shrestha, U.T., Adhikari, N., Maharjan, R., Banjara, M.R., Rijal, K.R., Basnyat, S.R. and Agrawal, V.P. 2015: Multidrug Resistant Vibrio cholerae 01 from Clinical and Environmental samples in Kathmandu City. BMC Infect Dis 15: 104 DOI 10.1186/s12879-015-0844-9.

28. Patrick, G.B., Nishibuchi, M., Tunung, R., Son, R. 2012: Molecular characterisation of clinical isolate of Vibrio cholerae isolated from outbreaks in Malaysia. Int Food Res J 19: 1267 – 1274.

29. Kaper, J.B., Moseley, S.L., Falkow, S. 1981: Molecular characterisation of environmental and nontoxigenic strains of Vibrio cholerae. Infect Immun 32: 661 – 667.

30. Zo, Y-G., Rivera, I.N.G., Russek-Cohen, E., Islam, M.S., Siddique, A.K., Yunus, M., Sack, R.B., Huq, A., Colwell, R.R. 2002: Genomic profiles of clinical and environmental isolates of Vibrio cholerae 01 in cholera-endemic areas of Bangladesh. PNAS 99:12409 – 12414.

31. Chakraborty, S., Mukhopadhyay, A.K., Bhandra, R.K., Ghosh, A.N., Mitra, R., Shimada, T. et al. 2000: Virulence genes in Environmental strains of Vibrio cholerae. Appl Environ Microbiol 66: 4022 – 4028.

32. Colombo, A.M., Mastrandrea, S., Leie, F., Santona, A., Uzzau, S., Rapelli, P., Pisano, M., Rubino, S., Cappuccinelli, P.1997: Tracking of clinical and environmental Vibrio cholerae 01 strains by combined analysis of the presence of the toxin cassette, plasmid content and ERIC-PCR. FEMS Immunol Med Microbiol 19: 33 – 45.

33. Kaper, J.B., Fasano, A., Trucksis, M. 1994: Toxins in Vibrio cholerae p. 145 – 176. In IK Wachsmuth, PA Blake and O Olsvik (ed), Vibrio cholerae: Molecular to global perspectives. Am Soc for Microbiol, Washington DC.

34. Mantri, C.K., Mohapatra, S.S., Ramamurthy, T., Ghosh, R., Colwell, R.R., Singh, D.V. 2006: Septaplex PCR assay for rapid identification of Vibrio cholerae including detection of virulence and int SXT genes. FEMS Microbiol Lett 265:208-14.

35. Lipp, E.K., Rivera, I.N., Gil, A.I., Espeland, E.M., Choopun, N., Louis, V.R., Russek-Cohen, E., Huq, A., Colwell, R.R. 2003: Direct detection of Vibrio cholerae and ctxA in Peruvian coastal water and plankton by PCR. Appl Environ Microbiol 69:3676-80.

36. Chatterjee, S., Ghosh, K., Raychoudhuri, A., Chowdhury, G., Bhattacharya, M.K., Mukhopadhyay, A.K., Ramamurthy, T., Bhattacharya, S.K., Klose, K.E., Nandy, R.K. 2009: Incidence, virulence factors, and clonality among clinical strains of non-O1, non-O139 Vibrio cholerae isolates from hospitalized diarrheal patients in Kolkata, India. J Clin Microbiol 47:1087-95. doi: 10.1128/JCM.02026-08.

37. Mehrabadi, J.F., Morsali, P., Nejad, H.R., Fooladi, A.A., Najafy, S. 2011: Evaluation of new primers for detecting toxigenic Vibrio cholerae by multiplex PCR. Microbiol Res 3: e1.

ERIC-PCR Analysis of the Clinical and Environmental strains of V. cholerae during 2013 Epidemic in Nigeria

Smith Stella, et al. 678

Table 1: Primers used in the study for identification, serogrouping, biotying, toxin detection and genotypic

analysis

Primer DNA sequence (5´ to 3´) Amplicon size (bp) Reference

Wbe01 GTTTCACTGAACAGATGGG

GGTCATCTGTAAGTACAAC 192 34

Wbf 0139 AGCCTCTTTATTACGGGTGG

449 35 GTCAAACCCGATCGTAAAGG

ctxA VCT CTCAGACGGGATTTGTTAGGCACG

301 36 VCT2 TCTATCTCTGTAGCCCCTATTACG

tcpA ATTCTTGGTGATCTCATGATAAGG

295 37 TTAATTCACCACAAATATCTGCC

ERIC1 ATGTAAGCTCCTGGGGATTCAC

ERIC 2 AAGTAAGTGACTGGGGTGAGCG 126 15

Table 2: Frequency distribution of V. cholerae according to states

States No. of Clinical Samples collected

No. positive for

V. cholerae (%)

No. of Environmental

samples analyzed

No. Positive for V. cholerae

(%)

Total No. of Samples

Collected (Clinical+Environ.)

Total No. of Vibrio sp.

obtained (%)

Ogun 13 10(77 ) 14 7(50) 27 17 (63)

Oyo 5 2 ( 40) 13 1(8) 18 3(16.7)

Lagos 5 1( 20) 12 0 (0) 17 1(5.8

Zamfara 62 19 (31) 12 0(0) 74 19(26)

Plateau 1 1 (100) 0 0(0) 1 1(100)

Benue 51 0 (0) 10 0(0) 61 0(0)

Total 137 33 (24.1) 61 8(13.11) 198 41(20.7)

Table 3: Serotype, biotypes and genotypes detected among V. cholerae population during 2013 outbreak in

Nigeria

S/N Lab No. State Source Serogroup Biotype

Wbe01

CtxA

Gene

TcpA

Gene Group of Genetic Profile

1 IJR2V Ogun Vomitus Ogawa 01 - + 1

2 IJR1 Ogun Rectal Swab Ogawa 01 + + 1

3 SHR2 Ogun Rectal Swab Ogawa 01 + + 11

4 IJR2S Ogun Rectal Swab Ogawa 01 + + 11

5 IJR5 Ogun Rectal Swab Ogawa 01 + + 11

6 IJR7 Ogun Rectal Swab Ogawa 01 + + 11

7 IJR6 Ogun Rectal Swab Ogawa 01 + + 11

ERIC-PCR Analysis of the Clinical and Environmental strains of V. cholerae during 2013 Epidemic in Nigeria

Smith Stella, et al. 679

8 IJR8 Ogun Rectal Swab Ogawa 01 + + 12

9 IJR9 Ogun Rectal Swab Ogawa 01 + + 12

10 IJR3 Ogun Rectal Swab Ogawa 01 + + 14

11 E1 Ogun Well Water Non Ogawa/Inaba Non01/0139 + + 2

12 E2 Ogun Sewage Water Non Ogawa/Inaba Non01/0139 + + 1

13 E6 Ogun Gutter Water Non Ogawa/Inaba Non01/0139 + + 3

14 E2BP Ogun Sewage Water Non Ogawa/Inaba Non01/0139 + + 1

15 E8 Ogun Well Water Non Ogawa/Inaba Non01/0139 + + 15

16 E10 Ogun Well Water Non Ogawa/Inaba Non01/0139 + + 16

17 E12 Ogun Fresh Soil Non Ogawa/Inaba Non01/0139 + + 5

18 ZM2 Zamfara Rectal Swab Ogawa 01 + + 6

19 ZM6 Zamfara Rectal Swab Ogawa 01 + + 13

20 ZM29 Zamfara Rectal Swab Ogawa 01 + + 7

21 ZM32 Zamfara Rectal Swab Ogawa 01 + + 7

22 ZM39 Zamfara Rectal Swab Ogawa 01 + + 7

23 ZM41 Zamfara Rectal Swab Ogawa 01 + + 10

24 ZM42 Zamfara Rectal Swab Ogawa 01 + + 4

25 ZM44 Zamfara Rectal Swab Ogawa 01 + + 1

26 ZM48 Zamfara Rectal Swab Ogawa 01 + + 9

27 ZM49 Zamfara Rectal Swab Ogawa 01 + + 9

28 ZM51 Zamfara Rectal Swab Ogawa 01 + + 4

29 ZM52 Zamfara Rectal Swab Ogawa 01 + + 8

30 ZM64 Zamfara Rectal Swab Ogawa 01 + + 8

31 ZM66 Zamfara Rectal Swab Ogawa 01 + + NA

32 ZM68 Zamfara Rectal Swab Ogawa 01 + + NA

33 LAP1RS Lagos Rectal Swab Ogawa 01 + + NA

34 BCE1 Ogun Well Water Ogawa 01 + + NA

35 BC E2 Ogun Sewage Water Ogawa 01 + + NA

36 BC E6 Ogun Gutter Water Ogawa 01 + + NA

37 BCE2

BP

Ogun Sewage Water Ogawa 01 + + NA

38 BC

E2BP

Ogun Sewage Water Ogawa 01 + + NA

39 OY5 Oyo Rectal Swab Ogawa 01 + + NA

40 OY7 Oyo Rectal Swab Ogawa 01 + + NA

41 OYE Oyo - Non Ogawa/

Inaba

Non01/0139 + + NA

Key: NA -Not analyzed with ERIC-PCR, IJ: Ijaye, E: environmental sample, ZM: Zamfara, LA: Lagos, Oy,

Oyo samples.

ERIC-PCR Analysis of the Clinical and Environmental strains of V. cholerae during 2013 Epidemic in Nigeria

Smith Stella, et al. 680

Fig.1: Genetic profile produced with ERIC-PCR using ERIC2 primer, Lanes 1-30 show V. cholerae isolates,

lanes N,N,N are negative control. Lane M is 100 bp DNA Marker.

Fig 2: Dendrogram analysis of discriminating genetic profile of V. cholerae strains by ERIC primers.

View publication statsView publication stats