Upload
doantuong
View
215
Download
2
Embed Size (px)
Citation preview
Slide 1 / 143 Slide 2 / 143
www.njctl.org
EukaryotesJanuary 2014
Slide 3 / 143
Vocabulary
alternative splicing
central vacuolecell junction
chitin
adhering junction
contractile vacuolechromatin modifying enzyme
chloroplastchromatin
cytoskeletonendocytosis
eukaryoteendosymbiosis
5' cap exocytosisexonextracellular matrixfood vacuolefungigap junctionglycoproteingolgi appartushistone
intermediate filamentintermembrane spaceintronlumenlysosome
endomembrane system
hydrolytic enzyme
Click on each word below to go to the definition.
Slide 4 / 143
Vocabulary
microtubule
mRNA processingmitochondrion
nuclear envelope
microfilament
nucleusnucleosome
nuclear porenucleolus
organelleperoxisome
plasmodesmatapinocytosis
matrix poly-A tailpre-mRNAprotistreceptor-mediated endocytosisRNA splicingrough endoplasmic reticulumsmooth endoplasmic reticulumstromatight junction
transport vesicleturgor pressure
phagocytosis
transcription factor
Click on each word below to go to the definition.
Slide 5 / 143
Eukaryotes Unit Topics
· The Eukaryotic Cell
· The Nucleus & Gene Expression
Click on the topic to go to that section
· Other Organelles & Cell Structures
· The Endomembrane System
· Energy-Converting Organelles
Slide 6 / 143
The Eukaryotic
Cell
Return toTable ofContents
Slide 7 / 143
All cells have 4 things in common.
· They are surrounded by a plasma membrane (or cell membrane).
· They contain a semifluid substance called the cytosol/cytoplasm .
· They contain structures called chromosomes, which carry the cell's genes.
· They have ribosomes, which assemble amino acids into proteins.
All Cells
Slide 8 / 143
There are 3 key differences between prokaryotic and eukaryotic cells.
· Eukaryotic cells are usually larger than prokaryotic cells.
· Eukaryotic cells have small compartments inside them call organelles.
· Most eukaryotes (but not all) are multi-cellular organisms.
Eukaryotes vs. Prokaryotes
Slide 9 / 143
1Which is NOT a basic feature of all cells?
A All cells are surrounded by a plasma membrane.
B Al cells contain a semifluid substance called the cytoplasm.
C All cells contain structures called chromosomes, which are contained in the nucleus.
D All cells have ribosomes.
Slide 10 / 143
Animal Cell (Eukaryote)
Bacterium (Prokaryote)
Eukaryotic cells are, on average, much larger than prokaryotic cells. The average diameter of most prokaryotic cells is between 1 and 10µm. By contrast, most eukaryotic cells are between 5 to 100µm in diameter.
Cell Size
Slide 11 / 143
Surface Area to Volume Ratio
At the time when prokaryotic cells were evolving, there were most likely different sizes of cells. A cell's efficiency and ability to survive depended on its surface area to volume ratio.
The volume of the cell determines the amount of chemical activity it can carry out per unit time. The surface area of the cell determines the amount of substances the cell can take in from the environment and the amount of waste it can release.
As a cell grows in size, it's surface area to volume ratio decreases. It performs chemical reactions faster, but it has a harder time getting nutrients in and waste out.
Slide 12 / 143
We know that cells need to be small enough so that they have an increased surface area to volume ratio, but be large enough toperform the chemical reactions of metabolism.
Most Efficient Least Efficient
The smaller the cell, the larger its surface area and the smaller its volume.
Limits of Cell Size
The bigger the cell, the smaller the surface area is compared to its large volume inside.
Slide 13 / 143
OrganellesTo increase efficiency in the larger cell, eukaryotes evolved many bacterium-sized parts known as organelles.
Organelles subdivide the cell into specialized compartments.
They play many important roles in the cell. Some transport waste to the cell membrane. Others keep the molecules required for specific chemical reactions located within a certain compartment so they do not need to diffuse long distances to be useful.
Slide 14 / 143
Organelles making up Eukaryotic cells include:
Organelles
· Nucleus
· Lysosomes
· Ribosomes
· Peroxisomes
· Mitochondria
· Vacuoles
· Smooth Endoplasmic Reticulum
· Rough Endoplasmic Reticulum
· Chloroplasts
· Golgi Apparatus
Slide 15 / 143
Multicellular Organisms
Even with organelles, the size of the cell is limited to about 1000µm3. This is why large organisms must consist of many smaller cells.
Slide 16 / 143
Diversity of Eukaryotes
Protists: The first eukaryotic cells. Protists are single-celled eukaryotes. They range from protozoans to algae.
Fungi: These organisms evolved second in time along with plants. Examples include mushrooms, molds, and mildews.
Plants: Plants vary in type from the first plants called mosses to the modern flowering plants.
Animals : Animals were the last eukaryotes to evolve. Animals range from ancient sponges and hydra to primates.
Slide 17 / 143
2Which of the following are prokaryotic cells?
A Plants
B Fungi
C Bacteria
D Animals
Slide 18 / 143
3 How did eukaryotes solve the problem of small surface area to volume ratio?
A by remaining the same size as prokaryotesB by becoming multicellular organismsC by compartmentalizing functions into organellesD they haven't solved the problem
Slide 19 / 143
4 All eukaryotes are multi-cellular.
TrueFalse
Slide 20 / 143
The Nucleus & Gene Expression
Return toTable ofContents
Slide 21 / 143
prokaryotes: pro: before karyon: kernel/seed (nucleus)
The Nucleus
eukaryote: eu: truekaryon: kernel/seed (nucleus)
So prokaryote = "before a nucleus"And eukaryote = "true nucleus"
The defining organelle in eukaryotic cell is the nucleus. The nucleus of the cell contains the DNA and controls the cell's activities by directing protein synthesis from DNA.
Slide 22 / 143
The nucleus from chemistry with protons and neutrons is not the same nucleus involved with cells.
The biological nucleus is usually, but not always, in the center of a cell and it is sometimes referred to as the "control center" of the cell.
The Biological Nucleus
BiologicalNucleus
Slide 23 / 143
Inside the Nucleus
The nucleus is enclosed by a double cell membrane structure called the nuclear envelope.
The nuclear envelope has many openings called nuclear pores. Nuclear pores help the nucleus "communicate" with other parts of the cell.
Inside the nucleus is a dense region known as the nucleolus.The nucleolus is where rRNA is made and ribosomes are assembled. They then exit through the nuclear pores.
Slide 24 / 143
3 Main Functions of the Nucleus
1. To keep and contain a safe copy of all chromosomes (DNA) and pass them on to daughter cells in cell division.
2. To assemble ribosomes (specifically in the nucleolus).
3. To copy DNA instructions into RNA (via transcription).
Slide 25 / 143
5Cells that contain a "true nucleus" and other membrane bound organelles are _______________.
A archaea.
B bacteria.
C eukaryotes.
D prokaryotes.
Slide 26 / 143
6 Where is the DNA of a eukaryote found?
A NucleusB NucleolusC NucleoidD Mitochondria
Slide 27 / 143
7 How does the nucleus control the activities of the cell?
A By making DNA.
B By directing protein synthesis.
C By allowing DNA to leave the nucleus to make proteins.
D By sending instructions to the mitochondria.
Slide 28 / 143
Many Cells = Same DNAAll cells in a multicellular eukaryote contain the same genome. Every cell has all the genes necessary to make all parts of the organism.
Cells become specialized by only expressing (turning on) certain genes, a small fraction of all the genes in the genome.
These muscle cells and brain cells (neurons) have the same DNA but they are expressing different genes, that is why their structure and function are so different.
Slide 29 / 143
Transcription and translation occur in Eukaryotes the same as in Prokaryotes, but there are extra steps that help regulate expression.
Transcription and Translation
Transcription
Slide 30 / 143
Gene Expression in Prokaryotes
Gene expression is regulated using operons that turn genes on and off depending on the chemical environment of the cell.
Slide 31 / 143
Gene Expression in Eukaryotes Overview
Eukaryotes have much more complex chromosomes that require multiple levels of regulation including:· "unpacking" of genes · transcription factors· RNA processing
Slide 32 / 143
8A particular triplet of bases in the template strand of DNA is AGT. The corresponding codon for the mRNA transcribed is
A AGT.
B UGA.
C TCA.
D ACU.
E UCA
Slide 33 / 143
9 A codon
A consists of two nucleotides.
B may code for the same amino acid as another codon.
C consists of discrete amino acid regions.
D catalyzes RNA synthesis.
E is found in all eukaryotes, but not in prokaryotes.
Slide 34 / 143
10If the triplet CCC codes for the amino acid proline in bacteria, then in plants CCC should code for
A leucine.
B valine.
C cystine.
D phenylalanine.
E proline.
Slide 35 / 143
Chromosomes
DNA is configured into structures called chromosomes.
Recall that prokaryotes have one chromosome that is double-stranded and circular.
The number of chromosomes a eukaryote has depends on the species. These chromosomes are made up of a complex of tightly coiled DNA and associated proteins called chromatin.
Species Chromosome #
Adders-tongue (a fern) 1440
Dog 78
Human 46
Rat 42
Pig 38
Cat 38
Rice 24
Slime Mold 12
Jack Jumper Ant 2*
*2 for females, 1 for males Source: Wikipedia.com
Slide 36 / 143
Chromatin
The DNA is tightly wound around proteins called histones, like thread wrapped on a spool. The combination of eight histones and DNA is called a nucleosome.
Video on how DNA is packaged
Slide 37 / 143
Chromatin's Role in Gene ExpressionWhen DNA is packed in chromatin it is not accessible to RNA polymerase so transcription can not happen.
The main factor in the specialization of cells in multi-cellular organisms is what genes are "unpacked" from the chromatin to be exposed to RNA polymerase.
All gene sequences are exposed to RNA polymerase
Some genes exposed
No genes exposed
Slide 38 / 143
Chromatin Modifying Enzymes
The genes that need to be expressed are unwound from histones by chromatin modifying enzymes in order to expose their nucleotide sequences.
Genes that are unnecessary to a particular cell will remain packed while the neccessary ones are unpacked.
Slide 39 / 143
11 No two cells in the human body have exactly the same DNA.
TrueFalse
Slide 40 / 143
12 How many spools of DNA and proteins make a nucleosome?
Slide 41 / 143
TranscriptionTranscription of DNA into RNA occurs in the nucleus of the eukaryotic cell. Eukaryotic RNA polymerase needs the assistance of proteins called transcription factors to help regulate when a gene is expressed.
If all the necessary transcription factors are present for a specific gene, then the gene can be expressed. If any are missing, transcription will not start.
There can be thousands of transcription factors in an organism's cells (3,000 in humans). The kind and number of them present in the nucleus at any given time dictate what genes are expressed.
Slide 42 / 143
Transcription Factors
Transcription factors are proteins that are capable of binding with DNA. When they bind to areas near the promoter region of the gene they work with RNA polymerase to begin the transcription of that gene.
They are produced in response to cues from the external environment of the cell.
These proteins make the cell capable of turning on genes in response to external stimulus. This is essential to multicellular eukaryotes because it allows the different cells of the organism to communicate and respond to situations in unison.
Video on regulated transcription
Slide 43 / 143
External Signals
Receptor Metabolic pathway that produces a specific transcription factor in response to signal. The product enters the nucleus.
Nucleus
External signal activates membrane bound protein (receptor)
SignalTranscription Factor
Cell
Slide 44 / 143
13 The first step in eukaryotic gene expression is...
A transcriptionB translationC RNA processingD unraveling the gene
Slide 45 / 143
14 Where does transcription occur in eukaryotic cells?
A nucleusB nucleiodC cytoplasmD cell membrane
Slide 46 / 143
15 Once the DNA is unwound from the chromatin, which of the following is necessary to begin transcription?
A RNA polymeraseB ribosomeC transcription factorsD both A & C
Slide 47 / 143
16 Transcribe the following eukaryotic gene sequence: AACTGATTATGGGCT
A AACTGATTATGGGCTB TTCACTAATACCCGAC UUGACUAAUACCCGAD UUCUGAUUAUGGGCU
Slide 48 / 143
mRNA Processing
After Transcription, the transcript is known as pre-mRNA. Enzymes in the nucleus modify pre-mRNA before the genetic messages are sent to the cytoplasm. This is know mRNA processing.
During mRNA processing, both ends of the pre-mRNA are altered.
Some interior sequences of pre-mRNA may be cut out, and other parts spliced together.
Slide 49 / 143
Alteration of mRNA Ends
The 5`end of the pre-mRNA receives a molecule known as a nucleotide (or 5') cap.
This cap is a modified guanine molecule (the G in A, T, C, G)
AUGCCCUUAGCC
GAUGCCCUUAGCC
pre-mRNA
5' cap added
Slide 50 / 143
Alteration of mRNA Ends The 3` end of the pre-mRNA gets a poly-A tail. This tail is series of adenosine (A) nucleotides.
A A A A A A A A A A A A
AUGCCCUUAGCC
GAUGCCCUUAGCCAAAAAAAA
original pre-mRNA
3' tail added
Slide 51 / 143
Alteration of mRNA Ends
The modifications to the ends of the pre-mRNA have several functions: · They facilitate the export of mRNA from the nucleus to the cytoplasm.· They protect mRNA from hydrolytic enzymes once it is in the cytoplasm.· They help ribosomes attach to the mRNA so they can be translated into a protein.
Slide 52 / 143
RNA SplicingMost eukaryotic genes and their RNA transcripts have long noncoding stretches of nucleotides that lie between coding regions. These noncoding regions are called intervening sequences, or introns.
The other regions called exons (because they are eventually expressed), are usually translated into amino acid sequences.
RNA splicing removes introns and joins exons, creating an mRNA molecule with a continuous coding sequence.
Slide 53 / 143
17What are the coding segments of a stretch of eukaryotic DNA called?
A introns
B exons
C codons
D replicons
Slide 54 / 143
mRNA Processing
This is an example of a pre-mRNA becoming a final transcript.
Slide 55 / 143
Some genes can code more than one kind of polypeptide, depending on which segments are treated as exons during RNA splicing.
Alternative splicing allows the number of different proteins an organism can produce to be much greater than its number of genes.
Alternative RNA Splicing
Slide 56 / 143
Alternative RNA Splicing
DNA sequenceAAATTTCCCGGGAAATTTCCCGGG
Pre-mRNA(Cap)-UUUAAAGGGCCCUUUAAAGGGCCC-(Tail)
Alternate splices(Cap)-UUU AAA UUU AAA-(Tail) OR (Cap)-GGC CCG GGC-(Tail)
Resulting polypeptide (protein)Phe - Lys - Phe - Lys OR Gly - Pro - Gly
Alternate splicing can dramatically change the length and/or the sequence of the polypeptide chain that will be made
Slide 57 / 143
18Which of the following helps to stabilize mRNA by inhibiting its degradation?
A RNA polymerase
B ribosomes
C 5' cap
D poly-A tail
E both C and D
Slide 58 / 143
19A transcription unit that is 8,000 nucleotides long may use 1,200 nucleotides to make a protein consisting of 400 amino acids. This is best explained by the fact that
A many noncoding nucleotides are present in mRNA.
B there is redundancy and ambiguity in the genetic code.
C many nucleotides are needed to code for each amino acid.
D nucleotides break off and are lost during the transcription process.
Slide 59 / 143
20Once transcribed, eukaryotic pre-mRNA typically undergoes substantial alteration that includes
A removal of introns.
B fusion into circular forms known as plasmids.
C linkage to histone molecules.
D union with ribosomes.
E fusion with other newly transcribed mRNA.
Slide 60 / 143
21A mutation in which of the following parts of a gene is likely to be most damaging to a cell?
A intron
B exon
C would be equally damaging.
Slide 61 / 143
22Alternative RNA splicing
A can allow the production of proteins of dramatically different sizes from a single mRNA.
B can allow the production of proteins of dramatically different amino acid sequences from a single mRNA.
C Both can happen
Slide 62 / 143
After the finalized mRNA transcript is complete and correct, the pores in the nuclear envelope allow it to pass to the cytoplasm where it can be translated into proteins by ribosomes.
The nuclear pore is a protein structure that controls the traffic flow of the nucleus. Each nuclear pore is made up of hundreds of individual proteins that insure only mRNAs with proper caps and tails can make it to the cytoplasm.
Entrance into the Cytoplasm
Slide 63 / 143
Hydrolytic enzymes in the cytoplasm breakdown mRNA molecules. The length of time an mRNA suvives in the cytoplasm relates to how much protein is made from it. Longer time in the cytoplasm means more translation by ribosomes.
The length of the poly-A tail is one of many factors that determines the time of survival in the cytoplasm. The longer the tail, the longer it's survival.
Degradation of mRNA
Slide 64 / 143
23 What is the importance of nuclear pores?
A They allow the nucleus to communicate with other parts of the cell.
B They allow DNA to leave the nucleus in order to direct protein synthesis.
C They allow RNA to leave the nucleus in order to be translated in the cytoplasm.
D They allow single stranded DNA molecules to enter the nucleus and assemble into the double helix.
Slide 65 / 143
Summary of Gene Expression Regulation in Eukaryotes
· The gene must be unpacked from chromatin· The right transcription factors must be present
Transcription occurs
· Cap and tail must be added to the mRNA
· Pre-mRNA must be edited (spliced)· Nuclear pores allow passage to the cytoplasm· mRNA comes into contact with a ribosome
Translation occurs
· Protein is used within the cell or exported to the environment
Slide 66 / 143
Endomembrane System
Return toTable ofContents
Slide 67 / 143
The Endomembrane System
Several organelles, some made up mainly of membranes, form a type of assembly line in the cell. They make a protein, then process and ship it to its final destination whether that be inside or outside the cell. Organelles included in this system include the nucleus, rough and smooth endoplasmic reticulum, golgi appartus, and lysosomes.
Collectively, we refer to them as the endomembrane system.
Note: The plasma membrane is also considered part of this system
Slide 68 / 143
The Endomembrane System
Slide 69 / 143
Endoplasmic Reticulum
When RNA leaves the nucleus, it enters the endoplasmic reticulum (ER). This organelle is a series of membrane-bound sacs and tubules. It is continuous with the outer membrane of the nuclear envelope (reticulum comes from the latin word for little net). There are two types of endoplasmic reticulum: rough and smooth.
Slide 70 / 143
Rough Endoplasmic Reticulum
Rough ER has ribosomes attached to its membrane (thus a rough appearance).
These ribosomes synthesize proteins that will be used in the plasma membrane, secreted outside the cell or shipped to another organelle called a lysosome.
As proteins are made by the ribosomes, they enter the lumen (opening) of the ER where they are folded and processed.
Slide 71 / 143
Ribosomes
Large subunit
Small subunit
Recall that the ribosome is made of rRNA and proteins. This is where translation occurs.
Ribosomes consist of two subunits, a small and a large. Each subunit consists of proteins and rRNA. The two subunits come together when proteins need to be made.
Slide 72 / 143
Ribosomes
Recall ribosomes make peptide bonds between amino acids in translation.
The instructions for making ribosomes are in the DNA. From DNA, rRNA is made. Some of the rRNA is structural and other rRNA holds the code from the DNA to make the ribosomal proteins from mRNA.
DNA mRNA Proteintranscription translation
Slide 73 / 143
24 Where are ribosomal subunits made in the cell?
A Cytoplasm
B Nucleus
C Nucleolus
D On the Plasma membrane
Slide 74 / 143
25 What do ribosomes consist of?
A proteins and DNA
B proteins and rRNA
C proteins only
D DNA only
Slide 75 / 143
26 List all the parts of the endomembrane system.
Arough and smooth endoplasmic reticulum, golgi appartus, lysosomes
Bnucleus, rough and smooth endoplasmic reticulum, golgi appartus, lysosomes
Cnucleus, rough and smooth endoplasmic reticulum, golgi appartus
Dnucleus, rough and smooth endoplasmic reticulum, golgi appartus, lysosomes, plasma membrane
Slide 76 / 143
27 Which of the following is involved in making proteins?
A Smooth E.R.
B Ribosomes
C DNA
D Nuclear membrane
Slide 77 / 143
Smooth Endoplasmic Reticulum
This type of ER is called Smooth because it lacks ribosomes on its surface. (it looks smooth compared to rough ER)
There are a variety of functions of this organelle, which include:· making lipids.· processing certain drugs and poisons absorbed by the cell.· storing calcium ions (for example, in muscle cells).
Note: The liver is an organ that detoxifies substances that are brought into the body. Therefore, liver cells have huge amounts of Smooth ER.
Slide 78 / 143
Protein Transport
Once the proteins are processed, short chains of sugars are sometimes linked to these proteins, which are then known as glycoproteins. These glycoproteins serve as "zip codes" that will tell the protein where it will go.
When the molecule is ready to be exported out of the ER, it gets packaged into a transport vesicle. This vesicle is made of membranes from the ER itself. The transport vesicle travels to another organelle known as the Golgi apparatus.
Slide 79 / 143
28 The endomembrane system serves to
A ship cell products to places in and out of the cell
B assemble DNA
C give directions to other organelles
D create pathways for organelles to travel
Slide 80 / 143
29 What determines if we classify endoplasmic reticulum as smooth or rough?
A presence or absence of nuclear pores
B presence or absence of genetic material
C presence or absence of ribosomes
D presence of absence of DNA
Slide 81 / 143
30 Where in the cell are lipids made?
A Nucleus
B Ribosomes
C Rough endoplasmic reticulum
D Smooth endoplasmic reticulum
Slide 82 / 143
Golgi Apparatus
The main function of this organelle is to finish, sort, and ship cell products. It works like the postal department of the cell.
Structurally, the golgi consists of stacked flattened sacs (sort of looks like a stack of pita bread).
Slide 83 / 143
The Golgi is located near the cell membrane. The Golgi works closely with the ER of a cell.
It receives and modifies substances manufactured by the ER. Once the substances are modified, they are shipped out to other areas of the cell.
One key difference between the Golgi apparatus and endoplasmic reticulum is that the sacs comprising the Golgi are not interconnected.
Golgi Apparatus
Slide 84 / 143
The Golgi receives transport vesicles that bud off from the ER and contain proteins. It takes the substances contained in these vesicles and modifies them chemically in order to mark them and sort them into different batches depending on their destination.
The finished products are then packaged into new transport vesicles which will then move to lysosomes, or will be inserted into the plasma membrane or dumped out of the cell if the protein is a secretory protein.
The Golgi Apparatus & the ER
Video on Protein Trafficking through the Golgi
Slide 85 / 143
31 A difference between the Golgi Apparatus and the ER is that
A The ER takes the vesicles from the Golgi to transport
B The sacs making the Golgi are not interconnected
C The Golgi has ribosomes, the ER does not
D There is no difference, they are part of the same organelle
Slide 86 / 143
32 Which organelle receives and modifies substances from the endoplasmic reticulum?
A Nucleus
B Ribosomes
C Lysosomes
D Golgi Bodies
Slide 87 / 143
LysosomesSome proteins from the Golgi Apparatus are transported to the lysosomes. As the name suggests, a lysosome is an organelle that breaks down other substances.(lyse: to cause destruction)
They consist of hydrolytic enzymes enclosed within a membrane. Hydrolytic enzymes break polymers into monomers through hydrolysis.
Slide 88 / 143
Lysosomes
Lysosomes may fuse with food-containing organelles called vacuoles and then the enzymes digest the food, releasing nutrients into the cell. Protists do this.
Damaged or unneeded proteins may become enclosed within a membranous vesicle which then fuses with a lysosome.
The organic molecules from the breakdown process are recycled and reused by the cell.
Slide 89 / 143
A peroxisome is a specific type of lysosome that forms and breaks down hydrogen peroxide (H2 O2 ) which is toxic to cells.
In all cells, hydrogen peroxide forms constantly (from the combining of hydrogen and oxygen as bi-products of metabolism) and needs to be broken down quickly.
Important note: Peroxisomes are not part of the endomembrane system.
Peroxisomes
Slide 90 / 143
33 Which organelle contains hydrolytic enzymes that break down other substances?
A Endoplasmic Reticulum
B Golgi Bodies
C Lysosomes
D Vacuoles
Slide 91 / 143
34 Which is not a function of lysosomes?
A aiding the cell in creating ribosomes
B fusing with vacuoles to digest food
C breaking polymers into monomers
D recycling worn out cell parts
Slide 92 / 143
Remember the plasma membrane is a phospholipid bilayer with proteins and other molecules interspersed throughout.
Plasma Membrane
Some proteins from the Golgi Apparatus become embedded in the membrane. Others are transported through the membrane to the external environment.
Slide 93 / 143
Plasma Membrane
· Selective Permeability · Protection· Structural support
The 3 main functions of the plasma membrane:
Slide 94 / 143
Passive transport is the movement of substances from an area of high concentration to an area of low concentration without the requirement an energy input. Types include diffusion, osmosis, and facilitated diffusion.
Membrane Transport - Review
Active transport is the movement of substances from an area of low concentration to an area of high concentration and requires an input of energy.
Passive Transport
Active Transport
(REQUIRES ENERGY)
Slide 95 / 143
35 Which of the following statements about the role of phospholipids in forming membranes is correct?
A they are completely insoluble in water
B they form a single sheet in water
C they form a structure in which the hydrophobic portion faces outward
D they form a selectively permeable structure
Slide 96 / 143
36 Active transport moves molecules
A with their concentration gradients without the use of energy
B with their concentration gradients using energy
C against their concentration gradients without the use of energy
D against their concentration gradients using energy
Slide 97 / 143
37 Which of the following processes includes all others?
A passive transport
B facilitated diffusion
C diffusion of a solute across a membrane
D osmosis
Slide 98 / 143
Many proteins created by the cell are too large to pass through the membrane, even using protein carrier or integral proteins. How do these macromolecules exit the cell?
When the substance needs other ways of getting into or out of a cell, they will enter and exit by fusing with the cell membrane.
Large Molecules and the Plasma Membrane
There are several special functions of the membrane as larger substances enter and exit the cell.
Slide 99 / 143
To excrete a macromolecule from the cell, the vesicles that enclose the proteins fuse with the plasma membrane and the vesicles then open up and spill their contents outside of the cell. This process is known as exocytosis. The vesicle will become part of the cell membrane.
Exocytosis
Exocytosis
This is how secretory proteins from the Golgi exit the cell. This is true for insulin in the pancreas.
Slide 100 / 143
Insulin is a protein hormone made by certain cells of the pancreas that enable cells to take glucose (sugar) in from the blood.
Insulin is a secretory protein made in the rough ER. Specifically, it is secreted out of the pancreas cells into the blood stream.
Insulin - A Secretory Protein
Slide 101 / 143
The opposite of exocytosis is endocytosis.
In this process, the cell takes in macromolecules or other particles by forming vesicles or vacuoles from its plasma membrane.
Endocytosis
This is how many protists ingest food particles
Slide 102 / 143
3 Types of Endocytosis
Slide 103 / 143
Phagocytosis Is for taking in solid particles. ("phago" mean to eat)
Pinocytosis Is for taking in liquids. However what the cell wants is not the liquid itself, but the substances that are dissolved in the liquid. ("pino" means to drink)
Receptor-mediated endocytosis requires the help of a protein coat and receptor on the membrane to get through.
3 Types of Endocytosis
Slide 104 / 143
38 The process by which a cell ingests large solid particles, therefore it is known as "cell eating".
A Pinocytosis
B Phagocytosis
C Exocytosis
D Osmoregulation
Slide 105 / 143
39 Protein coated vesicles move through the plasma membrane via this process:
A Phagocytosis
B Active Transport
C Receptor-Mediated Endocytosis
D Pinocytosis
Slide 106 / 143
40 After a vesicle empties its contents outside a cell, the vesicle becomes part of:
A the Golgi
B the plasma membrane
C another vesicle
D the extracellular fluid
Slide 107 / 143
Energy-Converting Organelles
Return toTable ofContents
Slide 108 / 143
Energy-Converting Organelles
Chloroplasts reside in plant cells and some protists and convert solar radiation into energy stored in the cell for later use.
Mitochondria reside in all eukaryotic cells and convert chemical energy from glucose into ATP.
Interestingly, both chloroplasts and mitochondria have their own DNA, separate from that found in the nucleus of the cell. They also have a double cell membrane.
Slide 109 / 143
eukaryotic chloroplast
Chloroplasts
These organelles convert solar energy to chemical energy through photosynthesis. Chloroplasts are partitioned into three major compartments by internal membranes:
· Thylakoids
· Stroma
· Intermembrane space
Slide 110 / 143
Thylakoids
In prokaryotes, thylakoids are areas of highly folded membranes.
In eukaryotes, they are stacked in the chloroplasts. The fluid outside these stacks of thylakoids is called the stroma; this is where the Calvin cycle takes place.
eukaryotic chloroplast
Remember that during photosynthesis it is on the thylakoid that the Light Dependent Reactions take place.
Slide 111 / 143
Mitochondria
Mitochondria are sometimes referred to as the "powerhouses" of the cell. They convert chemical energy (glucose) into a more usable and regenerative form of chemical energy (ATP).
The mitochondria is also partitioned like the chloroplast. They only have two compartments as opposed to three in the chloroplast.
· Matrix
· Intermembrane space
Slide 112 / 143
Remember cell respiration must take place near a membrane so that a proton gradient can be built in a "membrane space" that is separate from the rest of the cell. Thus, the membrane would separate the inner volume, with a deficit of protons, from the outside, with an excess.
In prokaryotes, the "inter-membrane space" is between the cell membrane and the cell wall.
In eukaryotes, that membrane is the inter-membrane space of the mitochondria in between the inner membrane and outer membrane.
Mitochondria and Respiration
Slide 113 / 143
The mitochondria and chloroplast are different from other eukaryotic organelles because they have their own DNA, their own ribosomes, and have a double cell membrane.
In 1970, Lynn Margulis published the "Theory of Endosymbiosis" to explain these facts. The theory states that the mitochondria and chloroplast were once free-living prokaryotes that got taken up (or "eaten") by another prokaryote.
The mitochondria was a bacteria that could make its own ATP. The chloroplast was a bacteria that could perform photosynthesis.
The Evolution of Eukaryotes
endo: within sym: together
bio: life sis: condition
endosymbiosis = living together, within
Slide 114 / 143
When they got taken up by another prokaryote, they dragged the one prokaryote's cell membrane around theirs, thus the double cell membrane. This now allowed the "new" eukaryote to make its own ATP or be able to do photosynthesis and make its own food. Thus the evolution of eukaryotes.
Note: The nucleus and flagella could also have the same possible roots although they are not as heavily supported with evidence as the mitochondria and chloroplast.
Endosymbiotic Theory
Slide 115 / 143
Evidence for Symbiosis
Both mitochondria and chloroplasts have their own protein-synthesizing machinery, and it more closely resembles that of bacteria than that found in the cytoplasm of eukaryotes.
Both mitochondrial and chloroplast genomes consist of a single circular molecule of DNA, just like in prokaryotes.
Both mitochondria and chloroplasts can arise only from preexisting mitochondria and chloroplasts. They cannot be form in a cell that lacks them.
Both mitochondria and chloroplasts have their own DNA and it resembles the DNA of bacteria not the DNA found in the nucleus
Slide 116 / 143
Since mitochondrial DNA is not in the cell nucleus, it is only passed along from mother to child; animals, including you, inherit your mitochondria from your mother only.
This is because the egg from our mothers contained her organelles. (Dad's sperm only contains the chromosomes, none of his organelles usually).
All of our organelles we inherited from our mothers. Mitochondrial DNA is a way to trace maternal heritage through a family or through a species. The "Mitochondrial Eve" is the first human female that gave rise to all humans. In theory, we can trace all humans back to her through our mitochondrial DNA.
The Mitochondrial Eve
Slide 117 / 143
41 Which organelle converts food energy into chemical energy that the cell can use?
A Nucleus
B Chloroplast
C Mitochondrion
D Golgi
Slide 118 / 143
42 Which organelle converts solar energy into chemical energy in plants and other photosynthetic organisms?
A Nucleus
B Chloroplast
C Mitochondrion
D Golgi
Slide 119 / 143
43 Which of the following is not true of mitochondria and chloroplasts?
A They are present in all eukaryotic cellsB They have their own DNAC They have their own ribosomesD They are surrounded by a double membrane
Slide 120 / 143
44 Which of the following does NOT provide evidence for the endosymbiotic theory?
A Mitochondria and chloroplasts both have their own DNA.
B Mitochondria and chloroplasts both come from pre-existing mitochondria and chloroplasts.
C The DNA of mitochondria and chloroplasts resembles the DNA found in nuclei.
D The DNA of mitochondria and chloroplasts resembles that of bacteria.
Slide 121 / 143
Other Organelles and Cellular Structures
Return toTable ofContents
Slide 122 / 143
VacuolesVacuoles are membranous sacs and they come in different shapes and sizes and have a variety of functions.
Central Vacuole
PLANTCELL
PROTIST
Slide 123 / 143
Central Vacuoles
Central Vacuoles in plants store water. Absorbing water makes a plant cell more turgid, or having more pressure inside - leading to strength and rigidity.
Central vacuoles that are full will take over most of the cytoplasm and literally push the organelles to the sides of the cell. It can also store vital chemicals, pigments and waste products.
Slide 124 / 143
Increased turgor pressure results from the central vacuole being full with water. It presses out on the cell membrane which then presses out on the cell wall.
Turgor Pressure
The plant cell will not explode or lose its shape like an animal cell would in a hypotonic environment.
When the turgor pressure decreases the cell is limp and droopy. This is associated with wilted, limp lettuce, as well as droopy flowers.
Slide 125 / 143
Contractile Vacuoles
Contractile vacuoles can be found in certain single-celled protists. These act as a pump to expel excess water from the cell. This is especially helpful to those organisms living in a freshwater environment to keep the cell from exploding.
Slide 126 / 143
Food Vacuoles
Food Vacuoles are mainly found in protists.
The protist ingests food particles. The particles then fuse with a lysosome. The lysosome contains hydrolytic enzymes that break the food down. Paramecium fed dyed food showing vacuoles.
Slide 127 / 143
45 An organelle found in plant cells that stores water as well as other important substances is called the ___________.
A Lysosome
B Contractile Vacuole
C Central Vacuole
D Golgi bodies
Slide 128 / 143
46 Food vacuoles are primarily found in which organisms?
A Plants
B Animals
C Protists
D Bacteria
Slide 129 / 143
Cytoskeleton
Cytoskeleton is a network of fibers within the cytoplasm.
Three types of fibers collectively make up the cytoskeleton:· Microfilaments· Intermediate filaments· Microtubules
These fibers provide structural support and are also involved in various types of cell movement and motility.
Slide 130 / 143
47 Cells can be described as having a cytoskeleton of internal structures that contribute to the shape, organization, and movement of the cell. All of the following are part of the cytoskeleton except
A the nuclear envelope.
B microtubules.
C microfilaments.
D intermediate filaments.
Slide 131 / 143
48 Which of the following is not a known function of the cytoskeleton? A to maintain a critical limit on cell size
B to provide mechanical support to the cell
C to maintain the characteristic shape of the cell
D to hold mitochondria and other organelles in place within the cytosol
Slide 132 / 143
Cell wallThe cell wall is an outer layer in addition to the plasma membrane, found in fungi, algae, and plant cells.
The composition of the cell wall varies among species and even between cells in the same individual. All cell walls have carbohydrate fibers embedded in a stiff matrix of proteins and other carbohydrates.
Plant cell walls are made of the polysaccharide cellulose. Fungal cell walls are made of the polysaccharide chitin.
Slide 133 / 143
Extracellular Matrix
The cells of many multi-cellular animals are surround by a extracellular matrix (ECM). The ECM provides structural support to the cells in addition to providing various other functions such as anchorage, cellular healing, separating tissues from one another and regulating cellular communication.
The ECM is primarily composed of an interlocking mesh of proteins and carbohydrates.
Slide 134 / 143
Cell Surfaces and Junctions
Cell surfaces protect, support, and join cells.
Cells interact with their environments and each other via their surfaces. Cells need to pass water, nutrients, hormones, and many, many more substances to one another. Adjacent cells communicate and pass substances to one another through cell junctions.
Animal and plant cells have different types of cell junctions. This is mainly because plants have cell walls and animal cells do not.
Slide 135 / 143
Plant cells are supported by rigid cell walls made largely of cellulose.
They connect by plasmodesmata which are channels that allow them to share water, food, and chemical messages.
Plant Cell Junctions
Slide 136 / 143
Tight junctions
Adhering junctions
Communicating (Gap) junctions
Animal Cell Junctions
Slide 137 / 143
tight junction
Tight Junctions
Tight junctions can bind cells together into leakproof sheets
Example: the cells of the lining of the stomachor any epitheliallining where leaking of substances is not good.
Slide 138 / 143
Adhering Junctions
Adhering junctions fasten cells together into strong sheets. They are somewhat leakproof.
Example: actin is held together in muscle.
Slide 139 / 143
Communicating (Gap) Junctions
Gap junctions allow substances to flow from cell to cell. They are totally leaky. They are the equivalent of plasmadesmata in plants.
Example: important in embryonic development. Nutrients like sugars, amino acids, ions, and other molecules pass through.
Slide 140 / 143
49 Which type of junction is found in plant cells?
A Gap junctionB PlasmodesmataC Tight junctionD Adhering junction
Slide 141 / 143
50 Which type of junction allows for the exchange of materials between animal cells?
A Gap junctionB PlasmodesmataC Tight junctionD Adhering junction
Slide 142 / 143
Plant vs. Animal Cell Organelles
Click here to review the similarities and difference
between plant and animal cells
Slide 143 / 143
Organelles in Animal and Plant Cells
cell wall
chloroplastscentral vacuole
plasma membrane
mitochondria
Only Animal
Only Plant Both
rough ER
smooth ER
lysosomesgolgi
apparatus
ribosomesnucleus