MOLECULAR AND CELLULAR BIOLOGY, Sept. 2005, p. 7675–7686 Vol. 25, No. 170270-7306/05/$08.00�0 doi:10.1128/MCB.25.17.7675–7686.2005Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Eukaryotic Translational Coupling in UAAUG Stop-Start Codons forthe Bicistronic RNA Translation of the Non-Long Terminal Repeat

Retrotransposon SART1Kenji K. Kojima,† Takumi Matsumoto, and Haruhiko Fujiwara*

Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo,Kashiwa-shi, Chiba 277-8562, Japan

Received 16 December 2004/Returned for modification 19 January 2005/Accepted 14 June 2005

Most eukaryotic cellular mRNAs are monocistronic; however, many retroviruses and long terminal repeat(LTR) retrotransposons encode multiple proteins on a single RNA transcript using ribosomal frameshifting.Non-long terminal repeat (non-LTR) retrotransposons are considered the ancestor of LTR retrotransposonsand retroviruses, but their translational mechanism of bicistronic RNA remains unknown. We used a bacu-lovirus expression system to produce a large amount of the bicistronic RNA of SART1, a non-LTR retrotrans-poson of the silkworm, and were able to detect the second open reading frame protein (ORF2) by Westernblotting. The ORF2 protein was translated as an independent protein, not as an ORF1-ORF2 fusion protein.We revealed by mutagenesis that the UAAUG overlapping stop-start codon and the downstream RNA second-ary structure are necessary for efficient ORF2 translation. Increasing the distance between the ORF1 stopcodon and the ORF2 start codon decreased translation efficiency. These results are different from the eukary-otic translation reinitiation mechanism represented by the yeast GCN4 gene, in which the probability ofreinitiation increases as the distance between the two ORFs increases. The translational mechanism of SART1ORF2 is analogous to translational coupling observed in prokaryotes and viruses. Our results indicate thattranslational coupling is a general mechanism for bicistronic RNA translation.

In many retroviruses and retrotransposons, gag protein andpol protein are encoded in different open reading frames(ORFs) on a single RNA transcript (4, 14). They translatethese two proteins as gag-pol polyproteins. Retroviruses, suchas human immunodeficiency virus type 1 and human T-celllymphotropic virus type 1, have a �1 translational frameshiftsignal, and Ty1, one of the yeast long terminal repeat (LTR)retrotransposons, has a �1 frameshift signal to translate gag-pol polyproteins (4, 14). The signal for retroviral �1 frame-shifting in RNA is composed of two structures, a slipperysequence where the frameshifting takes place and the down-stream stem-loop or pseudoknot structure (16). The generalslippery sequence in retroviruses is the heptamer nucleotidesequence X XXY YYZ. The tRNA initially bound to XXYslips to bind to XXX at the P site, and the tRNA initially boundto YYZ slips to bind to YYY at the A site. The mechanism for�1 frameshifting in Ty1 is entirely different from the retroviral�1 frameshifting. A codon for low available tRNA interruptsthe translation elongation and induces the tRNA slippage (15).

Non-LTR retrotransposons are considered the ancestor ofLTR retrotransposons and retroviruses (25). Although moreancient classes of non-LTR retrotransposons have a singleORF, the recently branched non-LTR retrotransposons usu-ally have two ORFs (24). The first ORF (ORF1) of the latter

type of non-LTR retrotransposons encodes a gag-like proteinand the second ORF (ORF2) a pol-like protein, which aresimilar to LTR retrotransposons and retroviruses. ORF2 en-codes two essential catalytic domains, endonuclease and re-verse transcriptase (Fig. 1, top). In contrast to LTR retrotrans-posons and retroviruses, there have been very few observationsof ORF2 translation in non-LTR retrotransposons. The sepa-rate ORF2 protein (ORF2p) has been detected in L1 elementsof human and rat, but the translational mechanism is stillobscure (7, 12). The translational mechanism of the bicistronicRNAs in non-LTR retrotransposons remains to be deter-mined.

SART1, which has two overlapping ORFs, is an active telo-meric repeat-specific non-LTR retrotransposon in the silk-worm Bombyx mori (37). Most of the SART1 elements amongthe several hundred exist as full-length genomic copies. Inaddition, only a single band corresponding to a full-lengthSART1 unit was observed in several Bombyx tissues by North-ern hybridization (35). Recently, we constructed an in vivotransposition assay system of SART1 in Sf9, the moth Spodopt-era frugiperda cell line, using the expression of Autographacalifornica nuclear polyhedrosis virus (AcNPV) (26, 29, 36).Both the silkworm, B. mori, and the moth, S. frugiperda, belongto the same order, Lepidoptera. This system reproduces nativetransposition features, such as frequent 5� truncation and tar-get specificity for telomeres. Thus, the functional ORF2p ofSART1 is translated in the AcNPV expression system, whichwill be useful for studying the translational control in non-LTRretrotransposons. In addition, we previously reported that theSART1 RNA transcribed from the polyhedrin promotershowed a band which corresponds to the full-length SART1and the downstream polyhedrin 3� region (29). There were no

* Corresponding author. Mailing address: Department of IntegratedBiosciences, Graduate School of Frontier Sciences, University of To-kyo, Bioscience Building, 501, Kashiwa-shi, Chiba 277-8562, Japan.Phone: 81-4-7136-3659. Fax: 81-4-7136-3660. E-mail: haruh@k.u-tokyo.ac.jp.

† Present address: Bioinformatics Center, Institute for ChemicalResearch, Kyoto University, Uji, Kyoto 611-0011, Japan.

7675

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.

clear bands below the full-length transcripts. Because bothnative SART1 and AcNPV-expressed SART1 are transcribedas the full-length transcripts, it is unlikely that a cryptic pro-moter leads to transcription of a monocistronic RNA encodingonly ORF2. SART1 ORF2p seems to be translated from asingle full-length, bicistronic SART1 RNA that is actively tran-scribed.

In SART1, ORF2 overlaps the end of ORF1 in the �1frame, which is similar to retroviruses (Fig. 1). The first AUGcodon in a reading frame of SART1 ORF2 is positioned at3018 to 3020 and the second at 3096 to 3098 (Fig. 1, under-lined). The previous stop codon in a reading frame of SART1ORF2 is positioned at 2949 to 2951 (Fig. 1, UAG [boxed]).Therefore, the overlapping region of ORF1 and ORF2 is 64nucleotides (nt) in length (Fig. 1, bottom). However, interest-ingly, the first AUG codon (3018 to 3020) in ORF2 is sur-rounded by two stop codons, UAA (3016 to 3018) and UGA(3019 to 3022), in an ORF1 reading frame (Fig. 1, both areboxed), which makes the stop-start fusion sequence UAAUGA(the start codon is underlined). It is of great interest to knowwhether such an extraordinary structure is involved in transla-tional mechanisms in non-LTR retrotransposons.

In this study, we detected the HA (hemagglutinin influenzavirus epitope)-tagged ORF2p translated from the bicistronicRNA of SART1. The ORF2p of SART1 was translated as anindependent protein separately from ORF1p, which is totallydifferent from gag-pol polyproteins in LTR retrotransposonsand retroviruses. In addition, we found that the UAAUGAoverlapping stop-start fusion codon at the junction betweenORF1 and ORF2 and the downstream RNA secondary struc-ture in ORF2 play an essential role for the ORF2 translationinitiation of SART1. In addition, we showed that the stopcodon of ORF1 and the start codon of ORF2 should be locatedin the neighborhood for efficient translation of SART1 ORF2

protein. These features are analogous to translational couplingobserved in prokaryotes and some viruses, which suggests thatSART1 ORF2 is also translated by translational coupling.

MATERIALS AND METHODS

Plasmid construction and recombinant AcNPV generation. Primer sequencesused in this study are listed in Table 1. The SART1 ORF1-ORF2 sequence wasamplified by PCR from SART1WT-pAcGHLTB (36) with primers SART1-S880-NcoI-S3G and SART1-A3670-NotI for S1-3666HA, SART1-A4303-NotIfor S1-4304HA, and SART1-A6110-NotI for S1-6110HA. PCR was conductedfor 30 cycles using Pfu Turbo DNA polymerase (Stratagene). The PCR productswere subcloned between the NcoI and NotI sites of pAcGHLT-B (PharMingen).The HA tag sequence was amplified by PCR from pGADT7 (Clontech) using theprimers pGADT7-S190-NotI and pGADT7-A2004-TAABglII. PCR was con-ducted for 30 cycles using Ex-Taq DNA polymerase (TaKaRa). The PCR prod-ucts were subcloned between the NotI and BglII sites of pAcGHLT-B alreadyinserted with SART1 partial sequences. Point mutations and nucleotide inser-tions/deletions were introduced with pairs of primers using the QuickChangemutagenesis kit (Stratagene). Double mutations were introduced using two-stepsite-directed mutagenesis. The mutation of each plasmid was confirmed by DNAsequencing.

Mutant k, containing a deletion of nt 3055 to 3111, was constructed as follows.The region 880 to 3054 of SART1 was amplified by PCR from SART1-3666HAusing the primers SART1-S880-NcoI-S3G and SART1-A3054-XbaI. PCR wasconducted for 30 cycles using Pfu Turbo DNA polymerase. The PCR productswere subcloned between the NcoI and XbaI sites of pET14b (Novagen). Bases3112 to 3666 of SART1 and the HA tag sequence were amplified by PCR fromSART1-3666HA using the primers SART1-S3112-XbaI and pGADT7-A2004-TAABglII. PCR was conducted for 30 cycles using Pfu Turbo DNA polymerase.The PCR products were subcloned between the XbaI and BglII sites of pET14balready inserted with SART1 partial sequences. The NcoI site upstream of theHA tag sequence was excluded by mutagenesis. The region including SART1 andHA tag was amplified by PCR with the primers SART1-S880-NcoI-S3G andpGADT7-A1968-TAABglII. PCR was conducted for 30 cycles using Pfu TurboDNA polymerase, and the products were subcloned between the NcoI and BglIIsites of pAcGHLT-B plasmids.

Construct I for in vivo retrotransposition assay is the same as SART1WT-pAcGHLTB (36), and construct II is the same as SART1ORF1pWT (26). Con-struct III was constructed as follows. The SART1 ORF2 sequence was amplifiedby PCR from the genomic library clone BS103 using the primers SART1-S3014-

FIG. 1. SART1 structure. The nucleotide and amino acid sequences near the ORF1-ORF2 overlapping region are shown below the ORFstructure. The first and the second AUG codons in ORF2 are underlined. Putative stop codons are boxed.

7676 KOJIMA ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.

NcoI and SAX-3P-NotI. PCR was conducted for 30 cycles using Pfu Turbo DNApolymerase (Stratagene). The PCR products were subcloned between the NcoIand NotI sites of pAcGHLT-B (PharMingen). Construct IV was made as follows.The whole pAcGHLT-B plasmid except the glutathione S-transferase (GST)-Histag sequence was amplified by PCR using the 5�-phosphorylated primers pAcB-A2265 and pAcB-S2941. The PCR products were self-ligated using a DNAligation kit version 2 (TaKaRa) at 16°C for 16 h. The portion of SART1 ORF2and 3� untranslated region (UTR) was amplified by PCR from the genomiclibrary clone BS103 with the primers SART1-S3014-NdeI and SART1-A6704-BglII. The PCR products were subcloned between the NdeI and BamHI sites ofpGADT7. The region including SART1 ORF2-3� UTR and HA tag was ampli-fied by PCR using the primers T7 and SART1-A6704-BglII. The PCR productswere subcloned between the NcoI and BglII sites of the vector lacking the GST-Histag.

Recombinant AcNPVs were generated as described by Takahashi and Fuji-wara (36).

Western blotting. Approximately 106 Sf9 cells were infected in a 24-well platewith recombinant AcNPV at a multiplicity of infection of 10 PFU per cell. At72 h postinfection, cells were scraped, pelleted at 1,000 � g for 5 min, andextracted. Cell extracts were separated on sodium dodecyl sulfate-polyacrylam-ide gels and electroblotted onto Fluoro Trans W polyvinylidene difluoride mem-branes (Nippon Genetics). Blots were blocked with 5% nonfat dry milk (Bio-Rad) in TBS-T (50 mM Tris-HCl, 0.3 M NaCl, 0.05% Tween 20, pH 8.0).Membranes were incubated for 16 h at room temperature with mouse monoclo-nal anti-HA antibody (Roche) diluted 1:10,000 or mouse monoclonal anti-Hisantibody (Amersham) diluted 1:3,000 in TBS-T. Bound antibodies were detectedusing an ECL Plus Western blotting detection system (Amersham) with perox-idase-conjugated anti-mouse immunoglobulin G (Amersham) diluted 1:25,000 inTBS-T. Between steps, membranes were washed according to the manufacturer’sinstructions.

In vivo retrotransposition assay of SART1. The in vivo retrotranspositionassay was performed essentially as described previously (36). Approximately 106

Sf9 cells were infected in a 12-well plate with SART1-containing AcNPV at a

multiplicity of infection of 10 PFU per cell. In the trans-complementation ex-periments, Sf9 cells were infected with two recombinant AcNPVs at a multiplicityof infection of 5 PFU. At 72 h after infection, cells were scraped and pelleted at1,000 � g for 5 min, and the total genomic DNAs were purified with PURE-GENE cell and tissue DNA isolation kits (Gentra). PCR amplification wascarried out with LA-Taq DNA polymerase (TaKaRa) and the primer setSART1-S6311 and CCTAA�T (Table 1) in the presence of 10 ng of Sf9 DNA.The reaction mixture was denatured at 96°C for 2 min, followed by 35 cycles of98°C for 20 s, 62°C for 30 s, and 72°C for 30 s. The PCR products wereelectrophoresed on 2% agarose gels in Tris-borate-EDTA buffer and visualizedby ethidium bromide staining.

RESULTS

Overlapping stop-start codons are distributed widely innon-LTR retrotransposons. The first AUG codon at 3018 to3020 in SART1 ORF2 overlaps with two consecutive stopcodons, UAA and UGA, in an ORF1 reading frame (Fig. 1,bottom). Many non-LTR retrotransposons have similar over-lapping stop-start codons (Table 2), which are classified intothree types. More than 10 non-LTR retrotransposon familiesin the R1, the LOA, the Jockey, and the L1 clades have theSART1-type UAAUG (UAA plus AUG) stop-start codon.The second type of overlapping stop-start codon, AUGA(AUG plus UGA), is also found in the widespread non-LTRretrotransposons, in the R1, the Tad, the Jockey, and the L1clades. The third type, UGAUG (UGA plus AUG), is foundonly in JuanAg3 of the Jockey clade, among the so-far-char-acterized non-LTR retrotransposons. All three types of over-

TABLE 1. List of primers

Name Sequence (5� to 3�)

For constructionSART1-S880-NcoI-S3G ......................................................................AAAAAACCATGGGCAGTTATAAAGAAGAATTACCCCAGSART1-A3670-NotI...............................................................................TCCGCGGCCGCGGCCACACGGAAACSART1-A4303-NotI...............................................................................TTTTTTTTTTGCGGCCGCACCAATCTGAGCTCCGGTTGTCGGTGSART1-A6110-NotI...............................................................................AAAAAAAAGCGGCCGCCGTCATGACCAGGTCCGCATAGTpGADT7-S1905-NotI ............................................................................AAAAAAAAGCGGCCGCGACTCACTATAGGGCGAGpGADT7-A2004-TAABgIII .................................................................GAAGATCTTCTTAACCCGGGTGGAATTCACTSART1-S3112-XbaI...............................................................................GCTCTAGAGCCCATCTGGCGGTCGTCGSART1-A3054-XbaI..............................................................................GCTCTAGAGCGGTTGCCCTGTAGTATATGATAAGGGCpGADT7-A1968-TAABglII..................................................................GAAGATCTTCTTAAGCGTAATCTGGTACGTCGTATGGGTSART1-S3014-NcoI ...............................................................................AAAAAACCATGGGCAGCAGCCCTTATCATATACTACSAX-3P-NotI..........................................................................................AAGGAAAAAAGCGGCCGCTTTTTTTTTTTTTTTTTTGGSART1-S3014-NdeI...............................................................................GGGAATTCCATATGACCAGCAGCCCTTATCATATACSART1-A6704-BglII..............................................................................AAAGAAGATCTTTTTTTTTTTTTTTTTTTTTTGGTATCGATGGGGT7.............................................................................................................TAATACGACTCACTATAGGGCpAcB-A2265 ...........................................................................................AAGAAGTCGAGTGGGTTGCACAAGGpAcB-S2941 ............................................................................................AGCCCAGGACTCGATGGCATATATG

For mutagenesisa

SART1-T3017add-F ..............................................................................CAATGGACGACGAATTAATGACCAGCAGCCCTTATCSART1-T3019C-F..................................................................................CAATGGACGACGAATAACGACCAGCAGCCCTTATCSART1-TG3019GC-F ...........................................................................CCAATGGACGACGAATAAGCACCAGCAGCCCTTATCSART1-T3016C-F..................................................................................CAATGGACGACGAACAATGACCAGCAGCCCTTATCSART1-A3021G-F.................................................................................CAATGGACGACGAACAATGGCCAGCAGCCCTTATCSART1-AT3018CC-F............................................................................CAATGGACGACGAATACCGACCAGCAGCCCTTATCSART1-C2805G-F .................................................................................CAGTGGTGAGTGCTAGCGCTGCGGCCAGACCSART1-C2968T-F..................................................................................CGCCGAAGAGAAATGGCGGAGTCAGCCSART1-A2965T-F .................................................................................CGCCGCCGAAGAGTAATGGCGGAGTCAGCSART1-GC3025CG-F ...........................................................................GGACGACGAATAATGACCACGAGCCCTTATCATATACTACAGGGSART1-GC3083CG-F ...........................................................................CCAGAGCTCAGGACCTCGTGATCCAGAGCATGGCGpGAD-A1936T-F...................................................................................GCGAGCGCCGCCTTGGAGTACCCATAC

For retrotransposition assaySART1-S6311.........................................................................................TGCCTACCTCACGAAGAAGTTGCGGTCACCTAA � T ..........................................................................................CCTAACCTAACCTAACCTAACCTAACCTTTTTT

a Only direct primers are shown. Complementary primers were used with direct primers for site-directed mutagenesis.

VOL. 25, 2005 TRANSLATIONAL COUPLING IN UAAUG IN A RETROTRANSPOSON 7677

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.

lapping stop-start codons join downstream ORFs to upstreamORFs in the �1 frame. These non-LTR retrotransposons aredistributed among all eukaryotic kingdoms. In addition, theoverlapping stop-start codons are distributed in most clades ofbicistronic non-LTR retrotransposons. The distribution ofoverlapping stop-start codons is not necessarily correlated withthe phylogeny of non-LTR elements. For example, RT1 andRTAg4 in Anopheles gambiae have the AUGA overlappingstop-start codon, but their close relatives, RT2 and RTAg3 inthe same insect, do not have the AUGA codon. Among 25non-LTR retrotransposons in the R1 clade, in which theORF1-ORF2 junction sequences have been so far character-ized, five elements (SART1, HOPEBm1, HOPEBm2, R6Ag1,and R1Dm) have UAAUG and three (RT1, RTAg4, andHidaAg1) have AUGA. Another 17 retrotransposons(TRAS1, TRAS3, R1Bm, SARTPx1, Waldo-A, Waldo-B, Wal-doAg1, WaldoAg2, R6Ag2, R6Ag3, RT2, RTAg3, MinoAg1,R7Ag1, R7Ag2, KagaAg1, and NotoAg1) have no overlappingstop-start codons. These facts indicate that overlapping stop-start codons were independently acquired in many non-LTRretrotransposon lineages.

SART1 ORF2 is translated separately from ORF1, not byframeshifting. The primary question is whether SART1ORF2p is translated by ribosomal frameshifting or is trans-lated from the first AUG codon in ORF2. We expressedSART1 in an AcNPV expression system. A GST-His6 tag wasfused at the N terminus of ORF1p, and an HA tag was fusedat the C terminus of ORF2p (Fig. 2A). The sequence of theoverlapping region of ORF1 and ORF2 in respective con-structs is the same as in the native SART1. We made threeconstructs differing at the C-terminal truncation of ORF2p.S1-3666HA has ORF2 truncated just after the endonucleasedomain (Fig. 2A, 1). S1-4304HA has ORF2 truncated justbefore the reverse transcriptase domain (Fig. 2A, 2). S1-6110HA has almost full-length ORF2 (Fig. 2A, 3). In addition,

we made a construct in which ORF1 and truncated ORF2 werefused (Fig. 2A, 4). RNA including both ORF1 and ORF2 waspresumed to be transcribed from the AcNPV polyhedrin pro-moter, based on the observation of our previous report (29).Because the SART1 5� UTR was replaced by the GST-His tagsequence in the AcNPV-expressed SART1, the length ofSART1 RNA expressed by AcNPV was 127 nt shorter than thenative SART1.

GST-His-tagged ORF1p was expressed in three constructsat the expected size (106 kDa), and the GST-His-taggedORF1-ORF2 fusion protein (133 kDa) was expressed in S1-F3666HA (Fig. 2B). We observed only a single strong band ineach lane. Faint bands in lanes 2 and 4 were probably degradedproducts. The HA-tagged ORF2p bands were observed in bothS1-3666HA and S1-4304HA but not in S1-6110HA (Fig. 2C).Even when we increased the exposure time, we could notdetect ORF2p bands in S1-6110HA (data not shown). It ispossible that no band for the full-length ORF2p (S1-6110HA)(Fig. 2C, lane 3) was due to transcriptional disruption reportedin the human L1 (9). The molecular masses of ORF2p ofS1-3666HA (Fig. 2C, lane 1) and S1-4304HA (Fig. 2C, lane 2)were close to the estimated sizes, 27 kDa and 56 kDa, respec-tively, assuming that the first AUG in ORF2 was used for theinitiation of translation. If ORF1-ORF2 fusion proteins wereexpressed, the estimated molecular masses were 133 kDa forS1-3666HA (Fig. 2C, lane 1) and 162 kDa for S1-4304HA (Fig.2C, lane 2). However, we could not find any bands above 100kDa (Fig. 2C, lanes 1 and 2). We detected ORF1-ORF2 fusionproteins at the expected size (133 kDa) in S1-F3666HA (Fig.2C, lane 4). If ORF1-ORF2 fusion proteins were translatedand processed in S1-3666HA and the band in lane 1 repre-sented proteins after proteolysis, the ORF1-ORF2 fusion pro-teins in S1-F3666HA would also be processed (Fig. 2C, lanes 1and 4). Therefore, ribosomal frameshifting and proteolysis areunlikely mechanisms for the production of ORF2p.

TABLE 2. Overlapping stop-start codons in non-LTR retrotransposons

Element ORF1/ORF2 functiona Host Clade Accession no.

SART1 GGACGACGAAUAAUGACCAGCAGCC Bombyx R1 D85594HOPEBm1 CGUAGCCCCGUAAUGGGUUGCGUCC Bombyx R1 D55702HOPEBm2 GGUUCAGUCUUAAUGGAUCACACCU Bombyx R1 AB090825R6Ag1 GAUUAGAUCUUAAUGGUUAGGUUGU Anopheles R1 AB090817R1Dm AGCUAGACACUAAUGUUUAGCUUCA Drosophila R1 X51968LOAAg1 CUUGGAUGAUUAAUGCCUCCGAUGA Anopheles LOA AAAB01008916Doc AAAAUCCCCAUAAUGGCUUCCCUAC Drosophila Jockey X17551NLR1CTe CCACAAACAAUAAUGGAUUGUAAUC Anopheles L1 L79944TRE3-A UAUCAUCUCAUAAUGGUAGUAAUCA Dictyostelium L1 AF134169TRE3-C UAUUAGAAAAUAAUGGAACAAUUA Dictyostelium L1 AF134171Tx1L UAAGACUCAGUAAUGGCCUUGAGUA Xenopus L1 M2691ATLN4 UAAAAAUCAUUAAUGUCGGAAUUCU Arabidopsis L1 AC002392L1Ci-C AGAACGUUCUUAAUGCCUCUUAGUU Ciona L1 AB097147RT1 CGGCCACCCAAUGACGCAGCUAAAA Anopheles R1 M93690RTAg4 CGGCCUUGCAAUGACCCCACAACUG Anopheles R1 AB090813HidaAg1 CUAAUUCUCAAUGAUGAUUACGCUG Anopheles R1 AB090822Mgr583 GUCGAUUAAUAUGACGAAAUACUCG Magnaporthe Tad AF018033Jockey GUAUUCCUAAAUGACUCAACCAACC Drosophila Jockey M38437TRE3-B CUAGUAAGGUAUGAGCUCAAAAAUC Dictyostelium L1 AF134170ATLN39 GGGAUCCAAUAUGAGGAUCAUCUCA Arabidopsis L1 AC006300Zepp CCTCGCAGCCAUGACTCGCTCCCGA Chlorella L1 AB008896JuanAg3 UUGUUUCCCGUGAUGGAUUGCCCAG Anopheles Jockey AAAB01008924

a Start codons are bold, and stop codons are underlined.

7678 KOJIMA ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.

The first AUG in ORF2 is used as a start codon. To inves-tigate whether the first AUG in ORF2 is the actual start codonof ORF2, we introduced a substitution of the first AUG inORF2 to ACG (Fig. 3, b) or AGC (Fig. 3, c) in S1-3666HA(Fig. 2A, 1). ACG has a weak activity for translation initiationin eukaryotic cells (30), and thus the order of translation ini-tiation potency is AUG � ACG � AGC. When ACG is usedfor translation initiation, ACG is recognized by tRNA boundto methionine, as with AUG (30). The ORF1p was detected asan expected 106-kDa band in all three constructs (Fig. 4A, a toc). The substitution from AUG to ACG reduced, but did notcompletely diminish, the ORF2 translation, whereas the sub-stitution from AUG to AGC appeared to eliminate it (Fig. 4B,a to c). To exclude the possibility of unexpected mutations inplasmid construction and recombinant AcNPV generation, wesequenced the mutant AcNPV genome. There were no unex-pected mutations in ORF2 (data not shown). The reduction of

ORF2 translation in mutants indicated that the first AUG inORF2 is used as a start codon. The translation efficiency ofORF2 accorded with the potency of translation initiation ofeach codon. Judging from the ORF2p/ORF1p ratio quantifiedby densitometry, the translation efficiency of ORF2 in mutantb was approximately 4% of the wild type (a) (the results aresummarized in Fig. 3). Unexpectedly, in mutant b, ORF2p wastranslated from the mutated start codon ACG (3018), not fromthe second in-frame AUG (3096) codon 78 nt downstreamfrom the native start codon (Fig. 3, b). If the translation startedat the second AUG codon, the expected size of ORF2p wouldbe 24 kDa, 3 kDa smaller. There was no band below 27 kDa(Fig. 4B, b).

The overlapping stop-start codon is essential for ORF2translation. The next question is whether the overlapping stop-start codon is important for ORF2 translation. We made threeother mutants. In mutant d, the substitution from UAA atposition 3016 to 3018 to CAA formed another overlappingstop-start codon, AUGA (AUG plus UGA) at 3018 to 3021(Fig. 3, d). The same overlapping stop-start codon, AUGA, isobserved in some non-LTR retrotransposons (Table 2). Inmutant e, the second stop codon, UGA at 3019 to 3021, waschanged to UGG in addition to the first stop codon mutation,and the start codon of ORF2 was not mutated (Fig. 3, e). Inthis mutant, the stop codon of ORF1 is positioned at 3085 to3087, 69 nt downstream from the native stop codon and 67 ntdownstream from the native start codon of ORF2. If the 69-nt-downstream stop codon in mutant e is used, ORF1p isexpected to be 108 kDa, which is 2.64 kDa larger than ORF1pin constructs a to d. In mutant f, two consecutive stop codonsand the start codon were all destroyed (Fig. 3, f). In thismutant, the stop codon of ORF1 is also 69 nt downstream fromthe native stop codon, as in mutant e. The molecular weight ofORF1p in f is also expected to be 108 kDa. As the native startcodon is mutated, AUG at 3096 to 3099 becomes the firstAUG codon in ORF2 in mutant f, 8 nt downstream from thestop codon of ORF1.

The ORF1p bands in d to f could be detected (Fig. 4A, a tof). The strong ORF2p band was observed in d, but no bandswere detected in e and f (Fig. 4B, d to f), even though the startcodon of ORF2 was intact in e (Fig. 3, e). The molecularweight of ORF2p in d is equal to that in a, which supports thatORF2p in d is also translated from the first AUG codon at3018 in ORF2. Judging from the ORF2p/ORF1p ratio quan-tified by densitometry, the translation efficiency of ORF2 in dwas approximately 13% of wild type. This result indicates thatanother stop-start codon, AUGA, was used in d in place ofUAAUG.

Greater distance between the stop codon and the start codondiminishes ORF2 translation. The stop codon of ORF1 andthe start codon of ORF2 are at their closest when they formoverlapping stop-start codons. We considered that ORF2 wasnot translated in mutant e because the stop codon of ORF1was 67 nt from the start codon of ORF2 (Fig. 3, e). Therefore,we further analyzed the effect of the distance between the stopcodon of ORF1 and the start codon of ORF2. In mutant g, thestop codon of ORF1 is positioned at 2803 to 2805, 215 ntupstream from the start codon of ORF2, and there are nodifferences around the start codon of ORF2 (Fig. 3, g). Inmutant h, the first AUG in ORF2 was mutated, and a new

FIG. 2. ORF2 translation assay by Western blotting. (A) Structuresof AcNPV-expressed constructs. ZF, zinc finger; EN, endonuclease;RT, reverse transcriptase; GST, glutathione S-transferase; HA, hem-agglutinin influenza virus epitope tag. (B) AcNPV-expressed ORF1pvisualized by Western blotting with anti-His antibody. Numbers oflanes indicate constructs shown in panel A. (C) AcNPV-expressedORF2p visualized by Western blotting with anti-HA antibody.

VOL. 25, 2005 TRANSLATIONAL COUPLING IN UAAUG IN A RETROTRANSPOSON 7679

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.

in-frame AUG was created at 2967 to 2969, 49 nt upstreamfrom the stop codon of ORF1 (Fig. 3, h). The sequence nearthe stop codon of ORF1 in h is the same as that in c.

Although the ORF1p bands were observed in mutants g andh at the expected sizes of 98 kDa and 106 kDa, respectively(Fig. 4A, g and h), we could not detect ORF2p (Fig. 4B, g andh). Because the sequence around the first AUG in ORF2 of gis identical to the wild type (Fig. 3, g), the premature transla-tion termination of ORF1 considerably reduced ORF2 trans-

lation. In addition, the artificial upstream AUG in h could notsubstitute for the native start codon.

Overlapping stop-start codon is necessary but not sufficientfor ORF2 translation. Next, we examined whether the over-lapping stop-start codon is sufficient for ORF2 translation,introducing an artificial stop-start codon, UAAUG, 51 nt up-stream from the native UAAUG. In both mutant i and mutantj, UAA at 2965 to 2967 is the stop codon of ORF1 and AUGat 2967 to 2969 is the first AUG in ORF2 (Fig. 3, i and j).

FIG. 3. Summary of ORF2 translation assay. Red filled circles indicate actual start codons, a red open circle indicates a non-AUG start site,and black open circles indicate in-frame AUG codons which were not used for translation initiation. The distances of AUG codons from the actualstop codon are shown below the ORF structures. Mutations are summarized at the middle, and the detailed sequences are at the bottom.Mutagenized nucleotides are in lowercase. Putative start codons are underlined, and actual start codons are red. Putative stop codons are boxed,and actual stop codons are in purple boxes. Results of the ORF2 translation assay are summarized at the right. ORF2p expression is indicated asthe efficiency relative to the wild type (a). Minuses indicate no expression. MW, molecular mass.

7680 KOJIMA ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.

There are no mutations near the native start codon at 3018 to3020 in i. However, in mutant i, UAA at 3016 to 3018 is not thestop codon of ORF1, and AUG at 3018 to 3020, the startcodon of ORF2 in wild-type SART1, is not the first AUGcodon in ORF2. In mutant j, the native start codon, AUG at3018 to 3020, is changed to AGC, which is the same mutationas in c and h. If artificial UAAUG were sufficient for thetranslation of ORF2, the 29-kDa ORF2p would be expressed.

We detected the slightly smaller ORF1p bands in both mu-tants (Fig. 4A, i and j), but we could not detect clear ORF2pbands in either construct (Fig. 4B, i and j). Thus, the overlap-ping stop-start codon is essential but is not enough for thetranslation of ORF2. These results showed that an artificialoverlapping stop-start codon cannot replace the native over-lapping stop-start codon. There is another factor necessary forthe translation of ORF2.

Downstream RNA secondary structures also affect ORF2translation. In retroviruses, the frameshift signal is composedof a slippery sequence and a downstream stem-loop RNAsecondary structure (16). Although there are no stable stem-loop structures in the ORF1-ORF2 overlapping region (2952

to 3015) of SART1, the RNA secondary structure predictionprogram at GeneBee-NET server (6) predicts a very stablestem-loop structure at position 3055 to 3111, downstream ofthe overlapping stop-start codon UAAUG (Fig. 5A, left). Wepredicted another possibility for a pseudoknot structure man-ually (Fig. 5A, right). Sequences 3055 to 3079 and 3088 to 3111are predicted to form a stem, and this stem formation is nec-essary for both the stem-loop and the pseudoknot. If CUGCUG at 3081 to 3086 in the loop annealed to CAGCAG at3023 to 3028, the stem-loop structure would change into thepseudoknot structure.

We also predicted RNA stem-loop structures just down-stream of UAAUG in HOPEBm1 and HOPEBm2 (Fig. 5B),which are close relatives of SART1 (17) and have the SART1-type overlapping stop-start codons (Table 2 and Fig. 5B). Thespacing between UAAUG and the stem-loops in HOPEBm1and HOPEBm2 is 34 nt, equal to SART1. The nucleotidesforming stems are highly conserved among these three retro-transposons. However, HOPEBm1 and HOPEBm2 cannotform the pseudoknot structures that could be predicted inSART1 (Fig. 5B).

We made four constructs to investigate whether stem-loopor pseudoknot structures are important for ORF2 translation.In mutant k, the downstream stem-loop structure (3055 to3111) was entirely deleted from S1-3666HA (Fig. 5A, k). Inthis construct, the downstream region from UAAUG can formneither the stem-loop nor the pseudoknot. The expected sizeof ORF2p in k was 24 kDa. In mutants l and m, the presumedpseudoknot would be weakened but the stem-loop structurewould not (Fig. 5A, l and m). The presumed pseudoknot andthe stem-loop structure would be as stable in mutant n as in thewild type because two sets of mutated nucleotides can formbase pairs (Fig. 5A, n).

We observed ORF1p bands of expected sizes in all con-structs (Fig. 5C). The ORF2p band appeared to be completelyeliminated in k and reduced in l, m, and n (Fig. 5D). Judgingfrom the ORF2p/ORF1p ratio quantified by densitometry, thetranslation efficiency of ORF2 was low in l and m (approximately6 to 10% of the wild type) but was recovered in n (approximately20%), even though the efficiency was still lower than in the wildtype (Fig. 5C and D). These results suggested that the stemformation is essential for the translation of ORF2 and that an-nealing between CUGCUG at 3081 to 3086 in the loop andCAGCAG at 3023 to 3028 is involved in the translation efficiency.It is also possible that the primary sequence is important for theORF2 translation instead of the pseudoknot formation.

ORF2p acts as an independent functional unit. As describedabove, SART1 ORF2 is translated separately from ORF1,which suggests that ORF1p and ORF2p can be supplied forretrotransposition independently. To investigate this possibil-ity, we performed the in vivo retrotransposition assay reportedpreviously (26, 29, 36). We used four constructs (Fig. 6A).Construct I contains a full-length SART1. Construct II in-cludes only ORF1. Constructs III and IV have only ORF2 and3� UTR with either a GST-His tag (III) or an HA tag (IV) atthe N terminus of ORF2. If ORF1p and ORF2p can be sup-plied independently, coinfection of AcNPV encoding onlyORF1 (II) and AcNPV encoding ORF2 and 3� UTR (III orIV) should lead to retrotransposition.

Expression of ORF1p and/or ORF2p was confirmed by

FIG. 4. Results of ORF2 translation assay. (A) AcNPV-expressedORF1p visualized by Western blotting with anti-His antibody. Lettersof lanes indicate constructs shown in Fig. 3. The molecular weight ofORF1p of each construct is shown below. (B) AcNPV-expressedORF2p visualized by Western blotting with anti-HA antibody. Thearrow indicates the ORF2p bands.

VOL. 25, 2005 TRANSLATIONAL COUPLING IN UAAUG IN A RETROTRANSPOSON 7681

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.

Western blotting with anti-His antibody (ORF1p in constructsI and II and ORF2p in construct III) or anti-HA antibody(ORF2p in construct IV) (Fig. 6B). Interestingly, when wecoinfected constructs II and III with the same multiplicity ofinfection (5 PFU per cell each), the ORF2p signal was muchweaker than the ORF1p signal (Fig. 6B, II � III). It indicatesthat ORF2 is less efficiently translated than ORF1 by nature.

In our in vivo retrotransposition assay system, retrotranspo-sition can be detected by PCR with a SART1 internal primer(SART1-S6311) and a telomeric repeat-specific primer(CCTAA�T) (26, 29, 36). We detected the PCR products,which represented the retrotransposition of SART1 into thetelomeric repeats in Sf9 cells, when construct I was infected(Fig. 6C, I). Infection of either construct II alone or construct

III alone could not lead to retrotransposition (Fig. 6C, II andIII), but coinfection resulted in retrotransposition (Fig. 6C, II� III). We exchanged the N-terminal tag from a GST-His tagto an HA tag in order to confirm the ability of trans-complemen-tation of ORF1p and ORF2p (Fig. 6C, II, II � IV, and IV). Theseresults showed that ORF1p and ORF2p can be supplied forretrotransposition independently and indicated that ORF2ptranslated from the first AUG in ORF2 is functional.

DISCUSSION

SART1 uses internal translation initiation, not ribosomalframeshifting. In this study, we revealed that SART1 ORF2pis translated from the start codon AUG at the middle of

FIG. 5. ORF2 translation assay for the downstream RNA secondary structure. (A) Predicted secondary structure downstream from theoverlapping stop-start codon of SART1. Mutagenized sequences are shown below. (B) Conserved stem-loop structures of three related retro-transposons. Two bold lines in the SART1 structure indicate sequences assumed to be annealed in the pseudoknot model. (C) AcNPV-expressedORF1p visualized by Western blotting with anti-His antibody. Letters of the lanes indicate constructs shown in panel A and Fig. 3. (D) AcNPV-expressed ORF2p visualized by Western blotting with anti-HA antibody.

7682 KOJIMA ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.

SART1 RNA. Ilves et al. detected the rat L1 ORF2p trans-lated in vitro by autoradiography, but they could not clarifyhow the separate ORF2p is translated (12). Recently, Ergun etal. detected the in vivo human L1 ORF2p by immunohisto-chemistry with anti-ORF2p antibody, but they did not ap-proach the ORF2 translational mechanism (7). One of thedifficulties in detecting ORF2p is due to the low expression ofORF2p even in the context of high-copy plasmids and overex-pression. Actually, ORF2p expression (construct III) wasweaker than ORF1p expression (II), even in the monocistronicRNA constructs (Fig. 6, II � III). We used a baculovirusexpression system to produce a large amount of SART1 bicis-

tronic RNA and could detect ORF2p by Western blotting (Fig.2C). Even using this baculovirus expression system, we couldnot detect the full-length ORF2p (S1-6110HA) (Fig. 2C, 3).Using the truncated ORF2 constructs with HA tag, we clarifiedthe internal translation initiation for SART1 ORF2p. ManyLTR retrotransposons and retroviruses apply ribosomal frame-shifting to translate their gag-pol polyproteins. In contrast,some non-LTR retrotransposons, including SART1, adoptquite a different mechanism for the translation of their bicis-tronic RNA from LTR retrotransposons and retroviruses.

Translational mechanism of SART1 ORF2: translationalcoupling. Several eukaryotic mechanisms for internal transla-

FIG. 6. In vivo retrotransposition assay. (A) Diagram of constructs. (B) AcNPV-expressed ORF1p (I and II) or ORF2p (III) visualized byWestern blotting with anti-His antibody (top) and AcNPV-expressed ORF2p (IV) visualized by Western blotting with anti-HA antibody (bottom).Letters of lanes indicate constructs shown in panel A. (C) PCR amplification of the 3� junctions of the retrotransposed SART1. PCR was conductedwith a SART1 internal primer and a telomeric repeat primer. The expected size of PCR products is approximately 400 bp (indicated by thearrowhead).

VOL. 25, 2005 TRANSLATIONAL COUPLING IN UAAUG IN A RETROTRANSPOSON 7683

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.

tion initiation have been reported (20). The scanning modelpredicts that the ribosome enters at the 5� terminus of mRNAand migrates on mRNA from 5� to 3�. One mechanism forinternal translation initiation is leaky scanning, in which theribosome bypasses AUG codons in a weak context for trans-lation initiation (20). As there are 24 AUG codons before theORF2 translation initiation site, leaky scanning can be ex-cluded for the translational mechanism of SART1 ORF2. An-other possible mechanism is nonlinear movement of the ribo-some from the 5� end of RNA to the first AUG in ORF2according to ribosome shunting (8). If SART1 used ribosomeshunting, the shunting ribosome would translate ORF2 and theremaining ribosome would translate ORF1, and the ORF2translation would not be affected by the position of ORF1translation termination. Thus, the above result that the pre-mature translation termination of ORF1 diminished ORF2ptranslation (Fig. 3 and 4, g and i) excludes the possibility ofribosome shunting.

Internal ribosome entry represents another way to initiatetranslation far downstream of the 5� end of RNA (32). Internalribosome entry needs a specific RNA secondary structure,named an internal ribosome entry site (IRES). Insect picorna-like viruses have IRESs in their intercistronic region to trans-late their bicistronic RNA (38), although most viral and cellu-lar IRESs are positioned in the 5� untranslated regions (20,32). The independence of the expression of a downstreamORF from translation of a preceding ORF represents a keyfeature of internal ribosome entry. Therefore, the disappear-ance of ORF2p by premature translation termination of ORF1(Fig. 3 and 4, g and i) rejects the possibility of internal ribo-some entry for the mechanism of SART1 ORF2 translation.

Another possibility of internal translation initiation is trans-lation reinitiation after the translation of an upstream ORF.Several examples of translation reinitiation in eukaryotes havebeen reported (18, 23), but the mechanisms of reinitiationseem distinct from SART1 internal translation initiation bytwo points. First, reinitiation is efficient when the upstreamORF is less than 30 codons long (18). In the well-knownreinitiation system for the yeast GCN4, each of four upstreamORFs consists of only three or four codons (10). In contrast,SART1 ORF2p is translated after the translation of ORF1p,which is 712 amino acids in length. Second, reinitiation is mostefficient when the upstream ORF terminates some distancebefore the start codon of the downstream ORF (18, 23). Reini-tiation of the yeast GCN4 is inefficient when the stop codon ofthe upstream ORF is 56 nt upstream from AUG of the down-stream ORF but efficient when the stop codon is 176 nt or 201nt upstream from AUG in a natural (nonstarvation) condition(10). The distance between the upstream ORF and down-stream ORF is necessary for ribosomes to bind the eIF2–GTP–Met-tRNAi

Met ternary complex (10). In the translation ofSART1 ORF2, the first AUG of ORF2 at 3018 to 3020 servedas a site for translation initiation only when it was 2 nt down-stream (Fig. 3 and 4, a) or 1 nt upstream (d) from the stopcodon of ORF1 but did not do so when it was 67 nt upstream(e), 215 nt downstream (g), or 53 nt downstream (i). Thechange of translation efficiency following the change of dis-tance between two ORFs in SART1 ORF2 translation is op-posite to that in reinitiation.

The overlapping stop-start codon UAAUG plays a key role

for the ORF2 translation of SART1. Such an overlappingstop-start codon is also observed in bacterial genes. TheUGAUG stop-start codon is observed at the cistronic junctionbetween trpB and trpA in Escherichia coli (3), and UAAUG issituated between the coat gene and the lysis gene in GA RNAphage (13). Expression of these genes is translationally cou-pled through their overlapping stop-start codons. AUGA alsohas a capacity for effective translational coupling (33). In thecase of translational coupling, the following ORF is translatedexclusively by the ribosome that translates the preceding ORF.In addition, increasing the distance between the stop codon ofthe preceding ORF and the start codon of the following ORFdecreases the translation of the following ORF (33). The effectof the distance between two ORFs of SART1 is similar to thatin translational coupling.

Although translational coupling is observed mainly in pro-karyotes, the existence of eukaryotic translational coupling hasbeen proved by some experiments and the observation oftranslational mechanisms of several RNA viruses (2, 11, 28,31). Peabody and Berg showed the existence of translationalcoupling machinery in mammalian cells using artificial bicis-tronic RNA (31). Influenza B virus RNA segment 7 contains aUAAUG overlapping stop-start codon, which plays a centralrole in the translation of the downstream ORF (11). Termina-tion-dependent translation reinitiation with short intercistronicsequences was reported for two viruses, human respiratorysyncytial virus (HRSV) (2) and rabbit hemorrhagic diseasevirus (RHDV) (28). Although these viruses do not containoverlapping stop-start codons, the translational mechanism ofdownstream ORF could be similar to that of SART1 andinfluenza virus because some of their related viruses have over-lapping stop-start codons. Feline calicivirus and Manchestervirus, which are related to RHDV, and pneumonia virus ofmice, which is related to HRSV, contain AUGA overlappingstop-start codons (2, 28). Norwalk virus has UAAUG (28). InRHDV, the substitution from AUG to ACG or AUC resultedin about one-fourth of the wild-type expression level of thedownstream ORF; in contrast, the substitution to UGU re-duced it to nearly zero (28). In our experiments, the substitu-tion from AUG to ACG reduced the SART1 ORF2 transla-tion, whereas the substitution from AUG to AGC appeared toeliminate it (Fig. 4B, a to c). The effects of substitutions atAUG are similar between SART1 and RHDV.

Associated with the mechanism of translational coupling,the downstream RNA secondary structure reinforces ORF2translation in SART1. The most likely role of the RNA sec-ondary structure of SART1 is blocking the movement of ribo-somes to allow sufficient time for recognizing a start codon.The spacing between the start codon and the stem-loop is 34 ntand between the start codon and the presumed pseudoknot is2 nt (Fig. 5A). It was reported that a downstream RNA sec-ondary structure facilitates translation initiation most effi-ciently when it is separated from the AUG codon by 14 nt (19).This indicates that the downstream RNA secondary structureof SART1 could not directly lead ribosomes to recognize theORF2 start codon. Adhin and van Duin proposed that theloosened ribosome may slip forward or backward to locate areinitiation site in prokaryotes (1). This ribosomal scanning-like movement has a range of action of more than 40 nt. Kozakreported that the backward movement of eukaryotic ribosomes

7684 KOJIMA ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.

after the translation of short ORFs is limited (21), but it wasthe case of translation termination reinitiation, not the case oftranslational coupling. There remains the possibility that thedownstream RNA secondary structure of SART1 obstructs theribosome forward movement and leads the backward move-ment in order to recognize the ORF2 start codon.

Do other non-LTR retrotransposons use translational cou-pling? HOPEBm1 and HOPEBm2 are the close relatives ofSART1 and have overlapping stop-start codons (UAAUG)and downstream RNA secondary structures (Table 2 and Fig.5B). Translational coupling is likely to have been acquired inthe common ancestor of SART1, HOPEBm1, and HOPEBm2.Some non-LTR retrotransposons that are phylogenetically dis-tant from SART1 also have overlapping stop-start codons (Ta-ble 2). These retrotransposons could also use translationalcoupling for their ORF2 translation. However, not all non-LTR retrotransposons have overlapping stop-start codons. Forexample, SARTPx1, another close relative of SART1, hasORF2 overlapping ORF1 in the �1 frame but does not havean overlapping stop-start codon (17). Some non-LTR retro-transposons, like human L1 or I factor of Drosophila, have twoseparate ORFs. In these elements, internal translation initia-tion was indicated because there was no detection of ORF1-ORF2 fusion proteins (5, 12, 27). Many non-LTR retrotrans-posons do not have overlapping stop-start codons, but most ofthem encode methionines at the beginning of endonucleasedomains (data not shown). We consider that the ORF2 proteinof many non-LTR retrotransposons could be translated fromthe first AUG in ORF2. However, we could not exclude thepossibility of ribosomal frameshifting for the ORF2 translationof some non-LTR retrotransposons. TRAS1 and TRAS3,which belong to a family of the silkworm telomeric repeat-specific retrotransposons other than SART1, have ORF2 over-lapping ORF1 in the �1 frame, and their first AUG in ORF2is positioned inside the conserved endonuclease domains (22).We further characterized the ORF1-ORF2 junction sequencesof other TRAS family retrotransposons, TRAS4, TRAS5, andTRAS6. However, no TRAS family retrotransposons have me-thionines at the beginning of endonuclease domains (unpub-lished data). The TRAS family is likely to apply ribosomalframeshifting for their ORF2 translation, although furtheranalysis is necessary to ascertain this possibility.

Translational coupling for eukaryotic cellular genes.SART1 is encoded on the host genome. This is different fromother examples of eukaryotic translational coupling, all ofwhich are RNA viruses. SART1 RNA is considered to betranscribed by cellular transcriptional machinery and trans-lated by cellular translational machinery like host genes. Eu-karyotic translational coupling is likely to be also used bycellular bicistronic genes. Mouse embryonic RNA splicing vari-ant of glutamic acid decarboxylase (GAD) is a strong candi-date for cellular bicistronic RNA translated by translationalcoupling. The bicistronic RNA of GAD contains a UGAUGoverlapping stop-start codon, and its downstream ORF istranslated in vivo (34). UGAUG in GAD is analogous toUAAUG in SART1. This bicistronic RNA is producedthrough the developmentally regulated alternative splicing of asingle exon. It is likely that other cellular genes have bicistronicmRNA forms that are translated by translational coupling.

ACKNOWLEDGMENTS

This work was supported by grants from the Ministry of Education,Science and Culture of Japan and by a Grant-in-Aid from the Re-search for the Future Program of Japan and Research Fellowships forYoung Scientists of the Japan Society for the Promotion of Science(JSPS).

REFERENCES

1. Adhin, M. R., and J. van Duin. 1990. Scanning model for translationalreinitiation in eubacteria. J. Mol. Biol. 213:811–818.

2. Ahmadian, G., J. S. Randhawa, and A. J. Easton. 2000. Expression of theORF-2 protein of the human respiratory syncytial virus M2 gene is initiatedby a ribosomal termination-dependent reinitiation mechanism. EMBO J.19:2681–2689.

3. Aksoy, S., C. L. Squires, and C. Squires. 1984. Translational coupling of thetrpB and trpA genes in the Escherichia coli tryptophan operon. J. Bacteriol.157:363–367.

4. Belcourt, M. F., and P. J. Farabaugh. 1990. Ribosomal frameshifting in theyeast retrotransposon Ty: tRNAs induce slippage on a 7 nucleotide minimalsite. Cell 62:339–352.

5. Bouhidel, K., C. Terzian, and H. Pinon. 1994. The full-length transcript ofthe I factor, a LINE element of Drosophila melanogaster, is a potentialbicistronic RNA messenger. Nucleic Acids Res. 22:2370–2374.

6. Brodskii, L. I., V. V. Ivanov, I. L. Kalaidzidis, A. M. Leontovich, V. K.Nikolaev, S. I. Feranchuk, and V. A. Drachev. 1995. GeneBee-NET: anInternet-based server for analyzing biopolymers structure. Biokhimiia 60:1221–1230. (In Russian.)

7. Ergun, S., C. Buschmann, J. Heukeshoven, K. Dammann, F. Schnieders, H.Lauke, F. Chalajour, N. Kilic, W. H. Stratling, and G. G. Schumann. 2004.Cell type-specific expression of LINE-1 open reading frames 1 and 2 in fetaland adult human tissues. J. Biol. Chem. 279:27753–27763.

8. Futterer, J., Z. Kiss-Laszlo, and T. Hohn. 1993. Nonlinear ribosome migra-tion on cauliflower mosaic virus 35S RNA. Cell 73:789–802.

9. Han, J. S., S. T. Szak, and J. D. Boeke. 2004. Transcriptional disruption bythe L1 retrotransposon and implications for mammalian transcriptomes.Nature 429:268–274.

10. Hinnebusch, A. G. 1997. Translational regulation of yeast GCN4. A windowon factors that control initiator-tRNA binding to the ribosome. J. Biol.Chem. 272:21661–21664.

11. Horvath, C. M., M. A. Williams, and R. A. Lamb. 1990. Eukaryotic coupledtranslation of tandem cistrons: identification of the influenza B virus BM2polypeptide. EMBO J. 9:2639–2647.

12. Ilves, H., O. Kahre, and M. Speek. 1992. Translation of the rat LINEbicistronic RNAs in vitro involves ribosomal reinitiation instead of frame-shifting. Mol. Cell. Biol. 12:4242–4248.

13. Inokuchi, Y., A. Hirashima, Y. Sekine, L. Janosi, and A. Kaji. 2000. Role ofribosome recycling factor (RRF) in translational coupling. EMBO J. 19:3788–3798.

14. Jacks, T., M. D. Power, F. R. Masiarz, P. A. Luciw, P. J. Barr, and H. E.Varmus. 1988. Characterization of ribosomal frameshifting in HIV-1 gag-polexpression. Nature 331:280–283.

15. Kawakami, K., S. Pande, B. Faiola, D. P. Moore, J. D. Boeke, P. J.Farabaugh, J. N. Strathern, Y. Nakamura, and D. J. Garfinkel. 1993. A raretRNA-Arg(CCU) that regulates Ty1 element ribosomal frameshifting is es-sential for Ty1 retrotransposition in Saccharomyces cerevisiae. Genetics 135:309–320.

16. Kim, Y. G., S. Maas, and A. Rich. 2001. Comparative mutational analysis ofcis-acting RNA signals for translational frameshifting in HIV-1 andHTLV-2. Nucleic Acids Res. 29:1125–1131.

17. Kojima, K. K., and H. Fujiwara. 2003. Evolution of target specificity in R1clade non-LTR retrotransposons. Mol. Biol. Evol. 20:351–361.

18. Kozak, M. 1987. Effects of intercistronic length on the efficiency of reinitia-tion by eucaryotic ribosomes. Mol. Cell. Biol. 7:3438–3445.

19. Kozak, M. 1990. Downstream secondary structure facilitates recognition ofinitiator codons by eukaryotic ribosomes. Proc. Natl. Acad. Sci. USA 87:8301–8305.

20. Kozak, M. 1999. Initiation of translation in prokaryotes and eukaryotes.Gene 234:187–208.

21. Kozak, M. 2001. Constraints on reinitiation of translation in mammals.Nucleic Acids Res. 29:5226–5232.

22. Kubo, Y., S. Okazaki, T. Anzai, and H. Fujiwara. 2001. Structural andphylogenetic analysis of TRAS, telomeric repeat-specific non-LTR retro-transposon families in Lepidopteran insects. Mol. Biol. Evol. 18:848–857.

23. Luukkonen, B. G., W. Tan, and S. Schwartz. 1995. Efficiency of reinitiationof translation on human immunodeficiency virus type 1 mRNAs is deter-mined by the length of the upstream open reading frame and by intercis-tronic distance. J. Virol. 69:4086–4094.

24. Malik, H. S., W. D. Burke, and T. H. Eickbush. 1999. The age and evolutionof non-LTR retrotransposable elements. Mol. Biol. Evol. 16:793–805.

25. Malik, H. S., and T. H. Eickbush. 2001. Phylogenetic analysis of ribonuclease

VOL. 25, 2005 TRANSLATIONAL COUPLING IN UAAUG IN A RETROTRANSPOSON 7685

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.

H domains suggests a late, chimeric origin of LTR retrotransposable ele-ments and retroviruses. Genome Res. 11:1187–1197.

26. Matsumoto, T., H. Takahashi, and H. Fujiwara. 2003. Targeted nuclearimport of open reading frame 1 protein is required for in vivo retrotranspo-sition of a telomere-specific non-long terminal repeat retrotransposon,SART1. Mol. Cell. Biol. 24:105–122.

27. McMillan, J. P., and M. F. Singer. 1993. Translation of the human LINE-1element, L1Hs. Proc. Natl. Acad. Sci. USA 90:11533–11537.

28. Meyers, G. 2003. Translation of the minor capsid protein of a calicivirus isinitiated by a novel termination-dependent reinitiation mechanism. J. Biol.Chem. 278:34051–34060.

29. Osanai, M., H. Takahashi, K. K. Kojima, M. Hamada, and H. Fujiwara.2004. Essential motifs in the 3� untranslated region required for retrotrans-position and the precise start of reverse transcription in non-long-terminal-repeat retrotransposon SART1. Mol. Cell. Biol. 24:7902–7913.

30. Peabody, D. S. 1989. Translation initiation at non-AUG triplets in mamma-lian cells. J. Biol. Chem. 264:5031–5035.

31. Peabody, D. S., and P. Berg. 1986. Termination-reinitiation occurs in thetranslation of mammalian cell mRNAs. Mol. Cell. Biol. 6:2695–2703.

32. Pestova, T. V., V. G. Kolupaeva, I. B. Lomakin, E. V. Pilipenko, I. N. Shatsky,

V. I. Agol, and C. U. Hellen. 2001. Molecular mechanisms of translationinitiation in eukaryotes. Proc. Natl. Acad. Sci. USA 98:7029–7036.

33. Sprengel, R., B. Reiss, and H. Schaller. 1985. Translationally coupled initi-ation of protein synthesis in Bacillus subtilis. Nucleic Acids Res. 13:893–909.

34. Szabo, G., Z. Katarova, and R. Greenspan. 1994. Distinct protein forms areproduced from alternatively spliced bicistronic glutamic acid decarboxylasemRNAs during development. Mol. Cell. Biol. 14:7535–7545.

35. Takahashi, H., and H. Fujiwara. 1999. Transcription analysis of the telo-meric repeat-specific retrotransposons TRAS1 and SART1 of the silkwormBombyx mori. Nucleic Acids Res. 27:2015–2021.

36. Takahashi, H., and H. Fujiwara. 2002. Transplantation of target site speci-ficity by swapping the endonuclease domains of two LINEs. EMBO J. 21:408–417.

37. Takahashi, H., S. Okazaki, and H. Fujiwara. 1997. A new family of site-specific retrotransposons, SART1, is inserted into telomeric repeats of thesilkworm, Bombyx mori. Nucleic Acids Res. 25:1578–1584.

38. Wilson, J. E., M. J. Powell, S. E. Hoover, and P. Sarnow. 2000. Naturallyoccurring dicistronic cricket paralysis virus RNA is regulated by two internalribosome entry sites. Mol. Cell. Biol. 20:4990–4999.

7686 KOJIMA ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 20

Nov

embe

r 20

21 b

y 11

4.38

.59.

242.