24
(National Institute for Agrarian and Veterinary Research) Changes in the NRL for Campylobacter Portugal EURL Campylobacter workshop 28 30 September 2015

EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Embed Size (px)

Citation preview

Page 1: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

(National Institute for Agrarian and Veterinary Research)

Changes in the NRL for Campylobacter Portugal

EURL – Campylobacter workshop 28 – 30 September 2015

Page 2: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

The past

LNIV

Created in 1913 with the objective of studying the animal deseases that where arrising that time.

Page 3: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

The past

Created in 2007 with the objective to aggregate the areas of Veterinary, Agriculture, sea and fishery.

Joint between labs

Veterinary

Sea and Fishery

Agriculture

Page 4: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

2012

Veterinary

Agriculture

(National Institute for Agrarian and Veterinary Research)

State Laboratory for the Ministry of Agriculture and Sea (MAM)

Page 5: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

2012

• Government decision to reduce costs and increase productivity:

• Avoid duplication of methods in small state labs

• Only 1 lab distributed on key locations

• Reduce the number of laboratories in all Ministry

• Technical support and scientific advice (working groups, opinion groups, etc.)

• Faster analytical response

• Centralize National Reference Laboratories

The INIAV's mission is the implementation of science policies and conducting research to support public policies in defense of national interests and the pursuit and deepening of the EU's common policies.

Page 6: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Labs from the MAM

2013 2015

12 laboratories

6 institutions

4 laboratories and

all in INIAV

Maior capacidade técnica

e massa crítica

More technical and

research capacity

Page 7: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

INIAV, I.P. in Portugal

•Experimental Farms •Agriculture •Wine

•Laboratories •Veterinary •Vegetables •Wine

Page 8: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Food Microbiology Lab

Page 9: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Food Microbiology Lab/ NRL

Page 10: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

ACTIVITIES

Food Inspection Plan

(PIGA)

Airport and Seaport frontier analytical

Support

(PIF)

NRL Salmonella in food

NRL E. coli STEC in food

NRL Campylobacter in food

Food Inspection Plan

(PIGA)

Airport and Seaport frontier analytical

Support

(PIF)

Salmonella National Surveillance Plan

(PNCS)

NRL Salmonella in food

NRL E. coli STEC in food

NRL Campylobacter in food

NRL Listeria monocytogenes in food

2015 Until 2014

Food Microbiology Lab

Page 11: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Samples

Food from animal origin for human

comsuption

Feed for animals

PT’s Samples

Food from animal and vegetable origin for

human comsuption

Feed for animals

Primary production

(Boot swabs, faeces, chick box liner)

PT’s Samples

2015 Until 2014

Food Microbiology Lab

Page 12: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

National Reference Laboratory (NRL)

Salmonella sp. Campylobacter sp. E. coli STEC

2015 Until 2014

Salmonella sp. Campylobacter sp. E. coli STEC Listeria monocytogenes

Page 13: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Food Microbiology Lab - Vairão/ NRL

2015

Team members

Ana Maria Lab technician

Hugo Guedes Microbiologist

João Costa Microbiologist

Ana Pinheiro Food engineer

Esperança Rodrigues Lab Technician

Manuela Amaral Biologist

Page 14: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Participation in PT’s:

•From EU-RL:

Salmonella sp.

Listeria monocytogenes (2014) Campylobacter sp. E. coli STEC

•Other’s:

Standard Schceme (PHE) Food Law Scheme (PHE) PT0088: Salmonella in poultry (VETQAS)

National Reference Laboratory (NRL)

Page 15: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Future in 2015/ 2016:

•Implement the NRL in the Lab activities for 2015 •Organize the activities for the NRL •Audits and Support to laboratories that are executing process control samples •Training

National Reference Laboratory

for Listeria monocytogenes

Page 16: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Let’s begin do something……..

Page 17: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Implementation of RT-PCR as method for

Campylobacter speciation

Page 18: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Real Time PCR for Campylobacter speciation

• Why?

– Faster answers – Avoid mailing isolates to other INIAV locations – Only method used was classical PCR – Discriminatory power – Equipment available – Less time comsuming as classical PCR

• Multiplex

– Run for C. jejuni, C. coli and C. lari

– Run for C. upsaliensis

– Reactions all using the same thermoprofile

Page 19: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Primers and Probes

Species Target/GeneBank ID Primer/ probe DNA sequence 5’→3’ Reference

C. jejuni hipOa/ NC_002163.1

Forward TGCACCAGTGACTATGAATAACGA

Vondrakova et

al. (2014) Reverse TCCAAAATCCTCACTTGCCATT

Probe FAM-TTGCAACCTCACTAGCAAAATCCACAGCT-BHQ1

C. coli glyAb/ AF 136494.1

Forward CATATTGTAAAACCAAAGCTTATCGTG

Vondrakova et

al. (2014) Reverse AGTCCAGCAATGTGTGCAATG

Probe HEX-TAAGCTCCAACTTCATCCGCAATCTCTCTAAATTT-BHQ2

C. lari bipA-cje0832

Forward CATTTCAGCTTTTCTTTTGCCTAGT

Xavier et al.

(2010) Reverse AAAACCGAACCATTTGAACACTTAG

Probe Cy5-ACCACACCAGTAAAATCATCAGGCACATCA-BHQ3

C. upsaliensis bipA-cje0832

Forward CTTAGATGTAGGAGATAGTGTCGTTTGTC

Xavier et al.

(2010) Reverse CGGCAAAAACAATGCTTAAAGTT

Probe FAM-TCCTCTCCCACTTGACCCACTTCACATT-BHQ1

Page 20: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Procedure (easy extraction)

PCR Mix

45µl

5µl

1 colony 200µl

Page 21: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

C. jejuni

C. lari

C. coli Easy extraction: 250µl + 1 colony Thermomixer: 15’/ 95° C – 1300rpm

Ta = 58° C

Time: 1:43h

Run conditions:

Procedure (easy extraction)

Page 22: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Results from implementation Sample Origin Result using ISO Result with classical PCR Resulta with RT-PCR

Training A Isolate from clinical sample Campylobacter coli Campylobacter coli

Training B Isolate from clinical sample Campylobacter coli Campylobacter coli

P-HP-08- 1920 Isolate from Chicken Campylobacter jejuni Campylobacter jejuni

P-HP-08- 1940 Isolate from Chicken Campylobacter coli Campylobacter coli Campylobacter coli

P-HP-08- 1959 Isolate from Chicken Campylobacter jejuni Campylobacter coli Campylobacter jejuni

P-HP-08- 1961 Isolate from Chicken Campylobacter coli Campylobacter coli Campylobacter coli

P-HP-08- 2223 Isolate from Chicken Campylobacter coli Campylobacter coli Campylobacter coli

P-HP-08- 2362 Isolate from Chicken Campylobacter jejuni Campylobacter jejuni Campylobacter jejuni

P-HP-08- 2362 Isolate from Chicken Campylobacter coli Campylobacter jejuni Campylobacter jejuni/

Campylobacter coli

P-HP-08- 2592 Isolate from Chicken Campylobacter jejuni Campylobacter jejuni Campylobacter jejuni

P-HP-08- 2661 Isolate from Chicken Campylobacter jejuni Campylobacter coli Campylobacter jejuni

P-HP-08- 2698 Isolate from Chicken Campylobacter coli Campylobacter coli Campylobacter coli

P-HP-08- 2700 Isolate from Chicken Campylobacter jejuni Campylobacter jejuni Campylobacter jejuni

P-HP-08- 2749 Isolate from Chicken Campylobacter coli Campylobacter coli Campylobacter coli

P-HP-08- 2749 Isolate from Chicken Campylobacter jejuni Campylobacter jejuni

P-HP-08- 3259 Isolate from Chicken Campylobacter lari Campylobacter coli Campylobacter coli

C. Jejuni ATCC 33291 Campylobacter jejuni

C. coli Isolate from Chicken Campylobacter coli

C. lari Isolate from Chicken Campylobacter lari

Page 23: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

Data analysis

Classical PCR

Multiplex in house PCR, with 6 primer pairs

(Wang et al., 2002) targeting 23S, hip, glyA,

sapB2

“in House” RT-PCR for Campylobacter speciation

Multiplex in house PCR, with 6 primer pairs Vondrakova et

al. (2014) and Xavier et al. (2010)

targeting hipOa, glyAb, bipA

Agreement = 19

Deviation = 0

Page 24: EURL Campylobacter workshop 28 30 September 2015 - … · EURL – Campylobacter workshop 28 – 30 September 2015 . The past ... PT’s Samples Until 2014 2015 ... –Run for C

(National Institute for Agrarian and Veterinary Research)

THANKS FOR YOUR

ATENTION