Development 108, 693-704 (1990)Printed in Great Britain © T h e Company of Biologists Limited J990

693

Expression of nerve growth factor receptor mRNA during early development

of the chicken embryo: emphasis on cranial ganglia

FINN HALLBOOK1, CHRISTIANE AYER-LELIEVRE2*, TED EBENDAL3 and HAKAN PERSSON1

1 Department of Medical Chemistry 11, Laboratory of Molecular Neurobiology, Karolinska Institute, Box 60400, Stockholm, Sweden2Department of Histology and Neurobiology, Karolinska Institute, Box 60400, Stockholm, Sweden^Department of Developmental Biology, Biomedical Center, Uppsala University, Box 587, Uppsala, Sweden

•Present address: Institut d'Embryologie du CNRS, 49 bis Avenue de la Belle Gabrielle, F-94130, Nogent sur Marne, France

Summary

In situ hybridization with /J-nerve growth factor recep-tor (NGF-R) oligonucleotide probes was used to studyNGF-R mRNA expression in early chicken embryos.Sections through the region of the visceral archesshowed high levels of NGF-R mRNA in mesenchyme ofthe visceral arches, neural tube and myotomes. Label-ling was also seen over E3 primordium of the trigeminalganglion (V) and in the placodal thickening of thepetrosal (IX) and nodose (X) ganglionic primordia. Inthe E5 embryo, all cranial sensory ganglia (V, VII, VIII,IX, X) expressed NGF-R mRNA although at varyinglevels with higher levels in the ganglia of the Vth, IXthand Xth cranial nerves than in ganglia of the Vllth andthe VHIth nerves. Within ganglia of the Vth, IXth andXth cranial nerves, levels of NGF-R mRNA were higherin regions containing placode-derived neurons, than inregions with neural-crest-derived neurons. The placode-

derived nodose ganglion (X) expressed NGF-R mRNA atall stages of development. In the E15 embryo and later indevelopment, two thirds of the large neuron-like cellsexpressed high levels of NGF-R mRNA. Our resultsshow that expression of NGF-R mRNA, in peripheralneurons, is not restricted to cells of neural crest origin.We also show a transient expression of NGF-R mRNAearly in development in a wide range of non-neuronaldifferentiating cells. The high level of NGF-R mRNA inearly differentiating tissues suggest that the NGF-Rplays a wider role during development than previouslyanticipated.

Key words: nerve growth factor receptor, in situhybridization, chicken embryo, neural crest, placode,cranial ganglia.

Introduction

/3-nerve growth factor (NGF) is a target-derived proteinthat is essential for development and maintenance ofsympathetic and a subset of sensory peripheral neurons(see Levi-Montalcini and Angeletti, 1968; Thoenen andBarde, 1980; Levi-Montalcini, 1987). NGF has alsobeen detected in the central nervous system (CNS)(Korsching et al. 1985; Shelton and Reichardt, 1986;Whittemore et al. 1986), where it supports cholinergicneurons in the basal forebrain (see Thoenen et al. 1987;Whittemore and Seiger, 1987; Ebendal, 1989). Theneurotrophic effects of NGF on peripheral and centralneurons are mediated by a membrane-linked cell sur-face receptor (NGF-R) (Banerjee et al. 1973; Herrupand Shooter, 1973; Hefti et al. 1986; Richardson et al.1986; Taniuchi et al. 1986). The NGF-R can exist in twoapparent states, the low- and high-affinity receptors,that have different kinetics of NGF binding (Sutter et al.1979; Landreth and Shooter, 1980; Riopelle etal. 1980;Schechter and Bothwell, 1981). The high-affinity recep-

tor mediates the biological activity of NGF and istherefore present on NGF responsive cells. However,several cell types, including Schwann cells have beenfound that carry only the low-affinity receptor (DiSte-fano and Johnson, 1988; Taniuchi et al. 1988).

Molecular cloning and analysis of complementaryDNA (cDNA) clones for rat and human NGF-R(Johnson et al. 1986; Radeke et al. 1987) have shownthat the receptor is a 396 amino-acid long protein with asingle membrane spanning domain. The human NGF-Rgene consists of six exons spanning 23 kilo basepairs(kb) on human chromosome 17 (Huebner et al. 1986;Rettig et al. 1986; Sehgal et al. 1988). The mRNA fromthis gene encodes the protein that forms part of bothlow- and high-affinity states of the NGF-R (Hempsteadet al. 1989). More recently, both genomic and cDNAclones have been isolated for chicken NGF-R, whichshow considerable sequence homology with rat andhuman NGF-R (Ernfors et al. 1988; Large et al. 1989).

In agreement with the dependence of peripheralsympathetic and sensory neurons on NGF for develop-

694 F. Hallbdok and others

ment and maintenance, these neurons produce NGF-RmRNA (Buck et al. 1987; Ernfors et al. 1988), exhibitspecific binding of 125I-NGF (Rohrer and Barde, 1982;Raivich etal. 1985) and show NGF-R immunoreactivity(Yan and Johnson, 1987) throughout their embryonicand adult life. The cranial ganglia, including the nodoseganglion, have also been shown to bind 125I-NGF(Raivich et al. 1987), and to have NGF-R immunoreac-tivity on their surface (Yan and Johnson, 1987). Fur-thermore, the embryonic day 8 nodose ganglion in thechicken has been shown to express NGF-R mRNA(Ernfors et al. 1988). However, somewhat conflictingdata have been reported concerning the responsivenessof placode-derived cranial sensory neurons to NGFstimulation. Although none of these ganglia respond toNGF in adult life, it appears as if, at least, the nodoseganglion shows a limited responsiveness to NGF earlyduring development (Hedlund and Ebendal, 1980;Davies and Lindsay, 1985; Lindsay and Rohrer, 1985;Lindsay et al. 1985; Pearson et al. 1983).

In this study, we report on the regional and temporalexpression of NGF-R mRNA in embryonic day 3 and 5chick embryo, focusing on the cranial ganglia. In thenodose ganglion, expression of NGF-R mRNA was alsostudied during later stages of development. Our resultsshow that NGF-R mRNA is expressed in a variety ofcells during early embryogenesis including both neural-crest- and placode-derived cells. In non-neuronal tis-sues and in CNS, the levels of NGF-R mRNA de-creased with differentiation, whereas, in some neuronsderived from the neural crest and epibranchial plac-odes, high levels of NGF-R mRNA are maintainedthroughout development.

Materials and methods

Preparation and cryostat sectioning of chickenembryosFertilized White Leghorn eggs were incubated at 38°C for thedesired time periods and stages were determined according toHamburger and Hamilton (1951). Embryos younger than 12days were frozen on dry ice whereas the upper thorax andneck regions were dissected and frozen from older embryos.10 /<m cryostat sections were collected on poly-L-lysine(60^gml~') pretreated glass slides. The sections were sub-sequently fixed in 4% paraformaldehyde for 30min at 4°C,rinsed 2x1 min in PBS, dehydrated in a graded series ofethanol and in chloroform. The sections were finally air-driedand stored at —20°C before use for in situ hybridization.

In situ hybridizationTwo oligonucleotides complementary to chicken NGF-RmRNA, corresponding to amino acids 47 to 60 (5'-CGTGCAGGGC TTGCACGGTT CTGTGGCACTCACTGTGTCC) and amino-acids 200 to 215 (5'-CGGCTCACGA CGGGCTGCGA GCTGCCCATGACGGTGGTGA CAATGT), were synthesized on a DNAsynthesizer (Applied Biosystem 381A). These oligonucleo-tides are referred to as probe 1 and 2, respectively. As ahybridization control, a 46-mer oligonucleotide complemen-tary to probe 2 was also synthesized. It is referred to as thecontrol probe. The oligonucleotides were labelled at their 3'-

end with a^[35S]dATP using terminaldeoxyribonucleotidyltransferase (Promega, WI) to a specific activity of2xl08ctsmin~' j<g~' and purified on a Nensorb column(Dupont, Wilmington, DE) prior to use. Hybridization wasperformed at 42°C for 15h in a humidified chamber with150 il of hybridization cocktail containing lxl06ctsmin~' ofrespective probe. The hybridization cocktail contained 50 %formamide, 4xSSC (lxSSC is 0.15M sodium chloride,0.015 M sodium citrate pH 7.0), 10% dextrane sulphate (Phar-macia), 0.5mgmr' yeast tRNA, 0.06M dithiothreitol andO.lmgmr1 sonicated salmon sperm DNA. After hybridiz-ation, the slides were rinsed and washed 4x15 min at 55°C inlxSSC, 2x1 min in cold RNase-free water, dehydrated inethanol and left to air-dry. The slides were dipped in KodakNTB-2 photographic emulsion diluted 1:1 in 0.6 M ammoniumacetate and exposed for 15 days at —20°C. The slides werethen developed and fixed, and the sections lightly counterstained with cresyl-violet, mounted and examined in a photo-microscope.

Results

Expression of NGF-R mRNA in E3 chicken embryoSections were prepared from E3 chicken embryos(Hamburger and Hamilton stage 18) in the rhomben-cephalic region through the hyoid arch (second visceralarch). Hybridization with the specific NGF-R probes tosections from the region between the metencephalonand the anterior intestinal porta showed very intenselabelling over the lateral and ventrolateral mesenchymeof the visceral arches (Fig. IB). Less intense labellingwas seen over the ventromedial parts of all arches(Fig. 1A,B>C)- The mesenchyme of the ventromedialparts of the first visceral arch and the hyoid arch wasless intensely labelled than the corresponding region inthe more caudal visceral arches (Fig. 1B,D). Weaklabelling was also seen over the sclerotomic mesen-chyme.

Intense labelling was seen over the neural tube in thestudied region (myelencephalon and anterior spinalcord) without any variation along the rostrocaudal axis.Labelling in the dorsal parts of the neural tube was lessintense than over the ventral parts and no labelling wasseen over the thin roof of the myelencephalon. Label-ling in the ventromedial parts of the neural tube wasweaker than labelling over the lateral mesenchyme(Fig.l). The labelling was equally distributed over thelayers of the neural tube (Figs 1, 2B).

Specific labelling was seen over a limited area of theectodermal epithelium of the most lateral and centralpart of the otic vesicle (Fig. 2A). No labelling wasdetected over the epidermal ectoderm of the head andtrunk except for the epidermal thickenings of theprimordia of the petrosal (IX) (Fig. 3) and nodose (X)ganglia. No labelling was detected over endodermalepithelium of the pharynx, pharyngeal pouches and gut.The same was true for endothelia of blood vessels andE3 heart endomyocardium (Fig. 1B,C).

Expression of NGF-R mRNA in E5 chicken embryoSections were cut from E5 chicken embryo (Hamburgerand Hamilton stage 26), parallel to the third aortic arch

NGF receptor mRNA in chicken embryo 695

Fig. 1. Expression of NGF-R mRNA in branchial arches in the E3 chicken embryo. Sections through (A) the first visceralarch and the rostral telencephalon, (B) the otic vesicles and the second visceral arch and (C) the third and fourth visceralarches of the E3 chicken embryo shown by dark-field microscopy after hybridization to the NGF-R probe 2. (D) A sectionthrough the third visceral arch hybridized to the control probe (dark-field micrograph). (E) Schematic representation ofsection B through the otic vesicles and the second visceral arch. Cross-hatched area delineates the wall of the neural tube.(F) Schematic representation of sections A, B and C. Dorsal aorta (a), heart (h), neural tube (nt), otic vesicle (o), pharynx(ph), telencephalon (t). Bar 250^m.

696 F. Hallbook and others

in the region between the upper oral cavity and thelower parts of the heart. Very intense labelling was seenover the ventrolateral mesenchyme of the hyoid archwhere the arch expands caudally over the third visceralarch (Fig. 4A,B)- Intense labelling was also seen overthe differentiating myotome. Considerably weakerlabelling was seen over the dermatome, lateral to themyotome (Fig. 4C). No labelling was seen over mesen-chyme in E7 embryo or at later stages of development(data not shown). Labelling was seen over retina, eyemuscle anlagen, neural tube, peripheral ganglia, nervesand the otic vesicle in E5 embryo. Labelling over theretina was weak (Fig. 5C,D), mainly localized to theganglion cell layer but a faint signal was also seenthroughout the thickness of the retina (Fig. 5C, D). Nospecific signal could be detected over the pigmentepithelium (Fig. 5D).

The level of NGF-R mRNA in E5 medulla oblongatawas higher than that in the E3 rhombencephalic neuraltube (compare Figs 2B and 5B). In the lower meten-cephalon at the level of the trigeminal ganglion, weaklabelling was seen over the ventricular zone consistingof proliferating neuroepithelial cells (Fig. 5B). Theinner mantle layer was intensely labelled, surroundedby the less intensely labelled outer mantle. At this levelof the brainstem, the alar plate was more intenselylabelled than the basal plate corresponding to areas

Fig. 3. Expression of NGF-R mRNA in E3 chickepibranchial placode. (A) Bright-field illumination of asection through the E3 petrosal ganglionic primordium afterhybridization to the NGF-R probe 2. Note that the placodalthickening is the only part of the epidermis that is labelled.(B) Schematic presentation of the section shown in A.Cross-hatched area delineates the epidermis (e), placodalthickening (p) and the developing glossopharyngeal nerve(n). Arrows indicate the border of the ganglionicprimordium. Bar

Fig. 2. NGF-R mRNA in theotic vesicle and primordium ofthe trigeminal ganglion of E3chicken embryo. Transversesection through (A) otic vesicleand (B) primordium of thetrigeminal ganglion hybridizedto the NGF-R probe 2. Thedashed line indicates the innerborder of the ectodermalepithelium of the otic vesicle(dark-field micrographs). Notethat the labelling overepithelium in the otic vesicle isrestricted to the lateral part.Epidermis (e), neural tube(nt), otic vesicle (ov),trigeminal ganglionprimordium (tg). Bar 100/«m.

with developing motornuclei (Heaton and Moody,1980). No NGF-R mRNA was detected in fiber bundlesin the marginal zone of brain stem, but meningessurrounding the brain stem were weakly labelled(Figs 4C, 6B, D). This labelling increased more cau-dally in the studied area.

The same labelling pattern over the neural tube wasseen at the level of the jugular ganglion (Xth proximalganglion) (Fig. 6D) and the trigeminal ganglion (Vth

. - • » '

n J:

3A ' - ^ - • • • >

B

Fig. 4. Detection of NGF-R mRNA in E5 mesectodermand mesoderm. (A) Section through the lower part of thehyoid arch (second visceral arch) hybridized to the NGF-Rprobe 2. (B) Magnification of the area indicated by thearrow in panel A showing labelled mesenchyme andunlabelled epithelium. (C) Transverse section through thespinal cord and myotomes in the upper thoracic region.Third aortic arch (a), hyoid arch (ha), myotome (m),pharynx (ph), spinal cord (sc). Bars in A, C, 250 m and inB, 25 ^m.

cranial nerve) (Fig. 5B). An increased level of NGF-RmRNA was seen in the most ventromedial part of theinner zone (Figs5A,B, 6B,D). Fiber bundles at theouter ventromedial aspect of the brain stem did notshow any labelling (Fig. 5A,B).

Specific labelling was also seen in the E5 developingotic vesicle forming the inner ear labyrinth (Fig. 6B,C).

NGF receptor mRNA in chicken embryo 697

The labelling was restricted to specific areas of the innerepithelium corresponding to the primordium of theampulla and the superior semicircular canal as well as tothe primordium of the lateral semicircular canal. Ingeneral, the most ventrolateral and superior parts of thedeveloping otic vesicle showed labelling with the NGF-R probe. No labelling was seen over the epithelium ofthe otic vesicle close to the acoustico-facial ganglioncomplex (Fig. 6A,B)- Similarly, labelling was notdetected over the endodermal epithelium of pharynx orgut, endothelium of blood vessel or over epidermis. Nolabelling was detected over the primordium of thymuswhich is derived from the epithelium of the third andfourth visceral pouches, or the bilobed thyroid.

NGF-R mRNA expression in cranial sensory gangliaE3 chicken embryos (Hamburger and Hamilton stage17-18) were sectioned transversely at the third visceralarch region. The primordium of the trigeminal (V)ganglion located between the neural tube and theepidermis (Fig. 2B) was clearly labelled. However,labelling over the ganglion was diffuse and individuallylabelled cells could not be identified. Weak labellingwas seen over the primordia of the distal ganglia of theIXth (Fig. 3) and Xth cranial nerves. Labelling was alsoseen over the ectodermal thickenings of the epibran-chial placodes, whereas no labelling was seen overfibers projecting towards the rhombencephalic neuraltube (Fig. 3A).

All E5 cranial sensory ganglia expressed NGF-RmRNA in varying amounts, as shown in Table 1. Thedistal parts of the trigeminal (V) ganglion, correspond-ing to the ophthalmic and maxillo-mandibular lobes,were intensely labelled (Fig. 5A,B). The labelling overthe proximal portion of the ganglion, where the twolobes are fused together, was not as intense as over thedistal parts.

Faint NGF-R mRNA expression was seen in theacoustico-facial (VII, VIII) ganglionic complex(Fig. 6A,B). Weak, but somewhat higher, labelling was

Table 1. Expression of NGF-R mRNA in E5 sensorycranial ganglia

GanglionRelativelabelling1

Trigeminal (V)d. Maxillo-mandibular lobe2

d. Ophthalmic lobe2

p. Trigeminal2

Acoustico-facial (VIII, VII)Acoustic partVestibular part

Geniculate (VII)Superior (p. IX)Petrosal (d. IX)Jugular (p. X)Nodose (d. X)

' + + + Intense labelling, ++ less intense labelling, + weaklabelling, (+) faint labelling.

2 The border between the proximally and distally labelled parts ofthe ganglion was not clear.

d. distal, p. proximal.

698 F. Hallbook and others

nt IX.'i

•Vi

\

>•' ' * tg

5A

•nw-

Fig. 5. Expression of NGF-R mRNA in E5 trigeminal ganglion and in retina. (A) Bright-field and (B) dark-fieldmicrographs of a section through the maxillo-mandibular lobe of the trigeminal ganglion hybridized to the NGF-R probe 2.Magnification of section through retina hybridized with (C) the specific probe 2 and (D) the control probe. Note that thethin retinal pigment layer creates light diffraction when studied with dark-field illumination microscopy. Arrow indicatesfiber bundles. Ganglion cell layer in the retina (g), pigment layer (pi), neural tube (nt), retina (r), trigeminal ganglion (tg).Bars in A, B 250 f/m and in C, D 25 [im.

seen over the geniculate (VII) ganglion and over thecaudal part of the acoustic ganglion, close to the oticvesicle.

Weak labelling was also seen over the superior (IX)ganglion and the jugular (X) ganglion (Fig. 6D). In-tense labelling was seen over the distal ganglia of theIXth and Xth cranial nerves. The nodose (X) ganglionwas more intensly labeled than the petrosal (IX)ganglion.

The mandibular nerve was weakly labelled by theNGF-R probe (Fig. 6B). Labelling was seen along thenerve out to the fine processes near the epidermis overthe hyoid arch. In contrast to the mandibular nerve, thevagus and the glossopharyngeal nerves were notlabelled by the NGF-R probe.

Developmental expression of NGF-R mRNA in thenodose (X) ganglionSections through the nodose ganglion from E5, E7, E9,E12, E15, E17, E19 and P3 were analyzed. In the E5nodose ganglion, intense, but diffuse, labelling wasseen (Fig. 7A) and individually labelled cells could notbe identified. An intense and evenly distributed label-ling was seen over the E7 ganglion. In the E9 nodoseganglion, larger cells could be distinguished and in theE12 ganglion (Fig. 7B) labelling was concentrated overthe larger cells, corresponding to differentiating neur-ons. In the E17 ganglion, labelling with varying intensit-ies was seen over the large neuron-like cells(Fig. 7C,D). Non-labelled large cells were first ob-served at E15 and comprised approximately one third ofall large cells. The proportion of non-labelled cells wassimilar in E17 as in P3 ganglia. Specific labelling was not

detected over small non-neuronal cells in the nodoseganglion from stage E15 and at later times of develop-ment (Fig. 7D,F,G).

Specificity of the in situ hybridization analysisAll results described above were obtained by hybrid-izing every second consecutive section to the specificNGF-R probe 2. The remaining sections were hybrid-ized to either the specific NGF-R probe 1 or to thecontrol probe. The labelling pattern obtained withprobe 1 was identical to the pattern seen with probe 2.No hybridization was seen on any of the sections usingthe control probe (see examples in Figs ID, 5D, 7E).

Discussion

The present in situ hybridization analysis in the chickenembryo detected NGF-R mRNA in classical NGFtarget cells as well as in many tissues not known to beresponsive to NGF. Two different non-overlappingprobes were used to detect NGF-R mRNA expressingcells and one probe was used to assess the specificity oflabelling. The specific NGF-R probe 2 hybridizes to theregion encoding the membrane spanning domain inchicken NGF-R mRNA. This domain is highly con-served in rat, human and chicken, with a 95% hom-ology between human and chick amino-acid sequencesand 81 % homology in DNA sequences (Ernfors et al.1988; Large et al. 1989). The specific NGF-R probe 1 isfrom the region encoding the first extracellular cystein-rich domain, which is less conserved during evolution.Both probes are therefore specific for the NGF-R, butwe can not exclude the possibility of cross-hybridization

NGF receptor mRNA in chicken embryo 699

OV

6A

Fig. 6. Expression of NGF-R mRNA in E5 cranial ganglia and the otic vesicle. Section through the acoustico-facial ganglioncomplex and rostral part of the developing otic vesicle shown by (A) bright-field illumination and (B) dark-field illuminationafter hybridization to the NGF-R probe 2. (C) Magnification of a section through the otic vesicle epithelium. (D) Sectionthrough the jugular ganglion. The dashed line indicates the outer border of the ganglion. Acoustico-facial ganglion complex(a-f), geniculate ganglion (g), jugular ganglion (j)> otic vesicle (ov), the mandibular nerve (n), neural tube (nt). Bars in A,B, D 250 (m and in C, 25 /.im.

700 F. Hallbook and others

*' «li. * ' T * *•»"-*-> , *•*'

Fig. 7. Developmental expression of NGF-R mRNA in the nodose ganglion. Bright-field illuminations of sections from themid part of the nodose ganglia from chicken embryos after hybridization to the NGF-R probe 2. Nodose ganglion from (A)E5, (B) E12 and (C) E17 chicken embryo. (D) Higher magnification of the boxed area in panel C, showing labelled E17nodose neurons. (E) Control probe used on section through E17 nodose ganglion. (F) P3 nodose ganglion at lowmagnification. (G) Higher magnification of P3 nodose ganglion cells. Filled arrow: intensely labelled neuron-like cell.Hollow arrow: non-labelled neuron-like cell. Bars in F, 150 jm, in A, B, C 50/an and in D, E, G 25/on.

NGF receptor mRNA in chicken embryo 701

to a putative very closely related, not yet identified,receptor gene.

The two NGF-R specific oligonucleotide probesshowed identical labelling patterns on adjacent sec-tions, strongly supporting a correct NGF-R mRNAspecificity. The specificity of the NGF-R probe 2 hasalso been tested by Northern blot hybridization where itonly recognized a 4.5 kb chicken NGF-R mRNA (Ern-fors el al. 1988). The control probe did not show anyspecific or unspecific labelling.

NGF-R mRNA has previously been detected byNorthern blot analysis in several tissues of the chickenembryo (Ernfors et al. 1988; Escandon and Chao, 1989;Large et al. 1989). The widespread occurrence of NGF-R mRNA in the early chicken embryo prompted us tostudy the cellular distribution of NGF-R mRNA, focus-ing on regions including developing neural crest, plac-odes and their derivatives.

Our results show NGF-R mRNA in both E3 and E5mesenchymal and neuro-ectodermal cell types under-going differentiation. A previous study has shownbinding of I25I-NGF (Raivich et al. 1985) to mesenchy-mal cell types of myotomes and muscle anlagen and thespecific NGF-R probes also revealed labelling overthese cells both in the E3 and E5 embryo. In addition,we detected high levels of NGF-R mRNA in thepharyngeal region, in ventrolateral mesenchyme of thevisceral arches, whereas no labelling was found morecaudally over the somatopleura and splanchnopleura.The mesenchymal cells of the visceral arches are mainlyof neural crest origin (LeLievre and Le Douarin, 1975;Noden, 1975; Le Douarin, 1980; Ayer-LeLievre and LeDouarin, 1982) and the cells expressing high levels ofNGF-R mRNA in this region are therefore mainlyundifferentiated mesectodermal cells that have stoppedmigrating but are proliferating. It has been shown thatneural crest cells bind I25I-NGF when cultured in vitro,implying that expression of NGF-R coincides with thetime when these cells acquire their phenotypic charac-teristics (End et al. 1983; Bernd, 1985; Greiner et al.1986). It is not known if the onset of NGF-R mRNAexpression is a result of the first steps of differentiationor if it is a necessary event for the differentiation tooccur. However, since NGF-R mRNA was detected inpostmigration undifferentiated neural crest cells, itappears that the onset of NGF-R mRNA expressionoccurs before these cells acquire their phenotypiccharacteristics. Our results also show that the level ofNGF-R mRNA in mesenchymal cells of the visceralarches is dramatically decreased after embryonic day 5when differentiation of myoblasts and prechondrocytesfrom visceral arch mesenchyme starts, suggesting thatthe NGF-R plays a role in the early development of thistissue. This property may either be mediated by bindingof NGF to the receptor or, alternatively, the receptormay promote cellular interactions during differen-tiation by a ligand-independent mechanism.

A transient expression of NGF-R mRNA was alsoobserved in the developing rhombencephalon and cer-vical spinal cord with no or very low levels of NGF-RmRNA later in development. In the embryonic rat

spinal cord, NGF-R mRNA has been detected inmotoneurons but expression of NGF-R mRNA in adultrat motoneurons is reduced below the detection limit ofin situ hybridization (Ernfors et al. 1989). In the adultrat, NGF has been shown to bind to a few cells in lowerbrainstem and medulla oblongata (Richardson et al.1986). However, the role of NGF-R in these neurons isunknown.

The large developmental changes in the levels ofNGF-R mRNA in the chicken embryo, as well as in rat(Buck et al. 1987; Yan and Johnson, 1987; Ernfors et al.1988, 1989), indicate that expression of the NGF-Rgene is developmentally regulated. DNA sequencesupstream of the transcriptional start site in the humanNGF-R gene lack a TATA element found in thepromoter region of most eukaryotic genes (Breathnachand Chambon, 1981). Instead, the NGF-R promoterregion show several features characteristic of constitut-ively expressed genes (Sehgal et al. 1988). Chronicinfusion of NGF into the adult rat forebrain results in anincreased number of NGF-R mRNA expressing cells inthe basal forebrain suggesting that NGF can upregulateexpression of its own receptor (Higgins et al. 1989).Furthermore, recent data have shown that expressionof NGF-R mRNA in rat Sertoli cells is downregulatedby testosterone implying that steroid hormones mayalso regulate NGF-R mRNA expression in other tissues(Persson et al. 1990). Interestingly, the two enzymes5-a'-reductase and aromatase, which metabolize testos-terone to the more potent metabolites dihydrotestoster-one and estradiol, respectively, are both widely distrib-uted in fetal tissues (MacLusky and Naftolin, 1981;McEwen, 1983). One possible target for fetal testoster-one could be the NGF-R gene, which may be down-regulated in response to the steroid, thereby influencingdevelopment of both neuronal and non-neuronal tis-sues.

Our results show NGF-R mRNA expression in plac-odes of developing cranial sensory ganglia and in theplacode-derived otic vesicle. In contrast to the epibran-chial placodes, NGF-R mRNA expression in the oticvesicle is not located in the epithelium close to theprimordium of the ganglion. In E3 embryo (stage IS)NGF-R mRNA is expressed in the lateral part of thevesicle (Figs IB, 2A) and cells giving rise to theacoustico-facial ganglionic complex bud from the ven-tromedial aspect of the otic vesicle (D'Amico-Marteland Noden, 1983). It is therefore unlikely that theplacode-derived cells in the otic vesicle expressingNGF-R mRNA form part of the primordium of theacoustico-facial ganglion. In the case of the developingdistal ganglia of the IXth and Xth cranial nerves theplacode-derived cells form part of the ganglia. Theobservation that NGF-R is expressed in the epitheliumof the otic vesicle agrees with Raivich et al. (1987) andRepresa and Bernd (1989). The localization is differentfrom that is described by Raivich who find 125I-NGFbinding on the dorsal and superior part of the E4 chickembryo otic vesicle, and Bernd who finds binding in theventromedial aspect of the otic vesicle from 72 h oldquail embryos. The different localization of the NGF-R

702 F. Hallbddk and others

expressing cells can be due to differences in stage andspecies. In spite of somewhat divergent results, it isclear that NGF-R is expressed in restricted parts of theepithelium of the otic vesicle and the NGF-R on thesecells probably influences development of the inner earepithelium (Represa and Bernd, 1989) rather thanbeing involved in development of the acoustico-facialganglionic 'complex.

All cranial sensory ganglia from early stages ofdevelopment expressed NGF-R mRNA although invarying amounts. In contrast to NGF-R mRNA ex-pression in the mesenchyme and neural tube, the levelsof NGF-R mRNA remain high in cranial ganglia also atlater stages of development. In the E5 chick embryo, allsensory cranial ganglia show a weak response to NGF,whereas at later times during development mostlyneural-crest-derived neurons respond to NGF by fiberoutgrowth (Davies and Lindsay, 1985). Not all neural-crest-derived neurons respond to NGF even thoughthey express NGF-R as shown by neurons from thetrigeminal mesencephalic nucleus grown in culture(Davies et al. 1987). This is the situation in the trigem-inal ganglion (V), in which case NGF sensitivity ap-pears to be restricted to the proximal part of theganglion where neural-crest-derived neurons arelocated (Ebendal and Hedlund, 1974, 1975; Davies andLumsden, 1983). However, in the trigeminal ganglionhigher levels of NGF-R mRNA expression were seen inthe distal parts of the ganglion where placode-derivedneurons are located. A similar situation was seen inganglia of the glossopharyngeal (IX) and vagus (X)nerves, where neurons of the petrosal (IX) and nodose(X) ganglia are placode-derived while neurons of thesuperior (IX) and jugular (X) ganglia are derived fromthe neural crest. Several reports have shown thatdeveloping neurons in the nodose ganglion do notrespond to NGF (Davies and Lindsay, 1985; Davies etal. 1986; Lindsay and Rohrer, 1985), except for a brieftime-period early in development (Hedlund and Eben-dal, 1980; Ebendal and Persson, 1988). Injection ofNGF in the fertilized chicken egg did not increase thenumber of surviving nodose neurons in the developingembryos (Dimberg et al. 1987) and immunodepletion ofNGF during intrauterine development in guinea pig hadno effect on the number of developing nodose neurons(Pearson et al. 1983). This strongly suggests that neur-ons from the nodose ganglion are less dependent onNGF than sympathetic and sensory neurons. However,the higher levels of NGF-R mRNA found in theplacodal neurons of the nodose and petrosal ganglia,compared to the jugular and superior ganglia, suggestthat the NGF-R is functionally relevant for theseneurons. This is further supported by the fact thatduring maturation of the nodose ganglion, a segre-gation in the neuronal population takes place whereapproximately two-thirds of the neurons contain highlevels of NGF-R mRNA whereas the remaining neur-ons in the ganglia do not contain any detectable NGF-RmRNA.

A possible explanation for the high levels of NGF-RmRNA in a subpopulation of nodose neurons could be

that the NGF-R mediates a trophic response in thesecells by interacting with a ligand different from, but yetstructurally related to, NGF. The nodose ganglionresponds to brain-derived neurotrophic factor (BDNF)(Davies and Lindsay, 1985; Davies et al. 1986) and,interestingly, the BDNF protein sequence, deducedfrom a recently isolated cDNA clone (Leibrock et al.1989), shows high sequence homology to the NGFprotein. Moreover, binding of BDNF to its receptorshow many characteristics in common with binding ofNGF to its receptor, including two receptor affinityclasses (Kd0ow) 1.3X10~9M, Kd(high) 1 .7X10" H M)(Rodriguez-Tebar and Barde, 1988). Considering theseintiguing data one can speculate that BDNF may alsobind to the NGF-R present in a 'BDNF high-affinitystate' and thereby mediating a response for developingnodose ganglia. Another plausible possibility is that,although NGF is not essential for survival of neurons inthe nodose ganglion, an interaction of the factor with itsreceptor may for instance stimulate neurotransmittermetabolism or receptor synthesis in these neurons.

The developmentally regulated expression of NGF-RmRNA in a wide range of different tissues in the earlychicken embryo suggests that the NGF-R plays a role inthe development of a variety of different tissues both ofneuronal and non-neuronal origins. The mechanisms bywhich the NGF-R functions in such a wide range ofdifferent tissues remain to be elucidated.

We thank Dr Nestor Carri for advice and Dr MartinSchalling for synthesis of oligonucleotides. We also want tothank Drs Nils Lindefors, Stefan Bren6 and Patrik Ernfors fortechnical advice concerning the in situ hybridization. Techni-cal assistance was given by Mrs Annika Kylberg, Mrs StineSoderstrfim and Mrs Mona Gullmert. Support was obtainedfrom the Swedish Natural Science Research Council, TheSwedish board for Technical Development, the Bank ofSweden Tercentenary Foundation, Erna and Victor Hassel-blads Foundation and Bengt Lundquists foundation.

References

AYER-LELIEVRE, C. S. AND LE DOUARIN, N. M. (J982). The earlydevelopment of cranial sensory ganglia and the potentialities oftheir component cells studied in Quail-Chick chimeras. DeviBiol. 94, 291-310.

BANERJEE, S. P., SNYDER, S. H., CUATRECASAS, P. AND GREENE, L.A. (1973). Binding of nerve growth factor in superior cervicalganglia. Proc. nam. Acad. Sci. U.S.A 79, 2519-2523.

BERND, P. (1985). Appearance of nerve growth factor receptors oncultured neural crest cells. Devi Biol. 112, 145-156.

BERND, P. AND REPRESA, J. (1989). Characterization andlocalization of nerve growth favtor receptors in the embryonicotic vesicle and cochleovestibular ganglion. Devi Biol. 134,11-20.

BREATHNACH, R. AND CHAMBON, P. (1981). Organization andexpression of the eucaryotic split genes coding for proteins. Rev.Biochem. 50, 349-383.

BUCK, C. R., MARTINEZ, H. J., BLACK, I. B. AND CHAO, M. V.

(1987). Developmentally regulated expression of the nervegrowth factor receptor gene in the periphery and brain. Proc.nam. Sci. U.S.A. 84, 3060-3063.

D'AMICO-MARTEL, A. AND NODEN, D. M. (1983). Contributions ofplacodal and neural crest cells to avian cranial peripheral ganglia.Am. J. Anal. 166, 445-468.

DAVIES, A. AND LUMSDEN, A. (1983). Influence of nerve growth

NGF receptor mRNA in chicken embryo 703

factor on developing dorso-medial and ventrolateral neurons ofchick and mouse trigeminal ganglia. Int. J. devl Neurosci. 1,171-177.

DAVIES, A. M. AND LINDSAY, R. M. (1985). The cranial sensoryganglia in culture: differences in the response of placode-derivedand neural-crest-derived neurons to nerve growth factor. DeviBiol. I l l , 62-72.

DAVIES, A. M , LUMSDEN, A. G. S. AND ROHRER, H. (1987).

Neural crest-derived orpioceptive neurons express nerve growthfactor receptors but are not supported by nerve growrh factor inculture. Neuroscience 20, 37-46.

DAVIES, A. M., THOENEN, H. AND BARDE, Y.-A. (1986). The

response of chick sensory neurons to brain-derived neurotrophicfactor. J. Neurosci. 6, 1897-1904.

DIMBERG, Y., HEDLUND, K.-O. AND EBENDAL, T. (1987). Effects of

nerve growth factor on sensory neurons in the chick embryo: astereological study. Int. J. Devi Neuroscience 5, 207-213.

DISTEFANO, P. S. & JOHNSON, E. M., JR (1988). Nerve growthfactor receptors on cultured rat schwann cells. J. Neurosci. 8,231-241.

EBENDAL, T. (1989). NGF in CNS: Experimental data and clinicalimplications. Prog, in Growth Factor Res. 1, 143-159.

EBENDAL, T. AND HEDLUND, K. O. (1974). Histology of the chickembryo trigeminal ganglion and initial effects of its cultivationwith and without nerve growth factor. Zoon 2, 25-35.

EBENDAL, T. AND HEDLUND, K. O. (1975). Effects of nerve growthfactor on the embryo trigeminal ganglion in culture. Zoon 3,33-47.

EBENDAL, T. AND PERSSON, H. (1988). Developmental appearenceand regulation of nerve growth factor. In Cellular and MolecularAspects of Neural Development and Regeneration (ed. A. Gorio,J. R. Perez-Polo, J. de Vellis and B. Haber), pp. 233-244.Heidelberg: Springer-Verlag.

END, D., PEVZNER, L., LLOYD, L. AND GUROFF, G. (1983).

Identification of nerve growth factor receptors on primarycultures of chick neural crest cells. Devi Brain Res. 7, 131-136.

ERNFORS, P., HALLBOOK, F., EBENDAL, T., SHOOTER, E., RADEKE,

M. J., MISKO, T. P. AND PERSSON, H. (1988). Developmental andregional expression of /J-Nerve Growth Factor receptor mRNAin the chick and rat. Neuron 1, 983-9%.

ERNFORS, P., HENSCHEN, A., OLSON, L. AND PERSSON, H. (1989).

Expression of nerve growth factor receptor mRNA isdevelopmentally regulated and increased after axotomy in ratspinal cord motoneurons. Neuron 2, 1605-1613.

ESCANDON, E. AND CHAO, M. V. (1989). Developmental expressionof the chicken nerve growth factor receptor gene during brainmorphogenesis. Devi Brain Res. 47, 187-196.

GREINER, C. A. M., LLOYD, A. T. AND GUROFP, G. (1986).

Ontogeny of the nerve growth factor in primary cultures ofneural crest cells. Devi Brain Res. 26, 145-150.

HAMBURGER, V. AND HAMILTON, H. L. (1951). A series of normalstages in the development of the chick embryo. J. Morph. 88,49-92.

HEATON, M. B. AND MOODY, S. A. (1980). Early development andmigration of the trigeminal motor nucleus in the chick embryo. J.comp. Neurol. 189, 61-99.

HEDLUND, K. AND EBENDAL, T. (1980). The chick embryo nodoseganglion: effects of nerve growth factor in culture. J. Neurocytol.9, 665-682.

HEFTI, F., HARTIKKA, J., SALVATIERRA, A., WEINER, W. J. AND

MASH, D. C. (1986). Localization of nerve growth factorreceptors in cholinergic neurons of the human basal forebrain.Neurosci. Lett. 69, 37-41.

HEMPSTEAD, B. L., SCHLEIFER, L. S. AND CHAO, M. V. (1989).

Expression of functional nerve growth factor receptors after genetransfer. Science 243, 373-375.

HERRUP, K. AND SHOOTER, E. M. (1973). Properties of the /J-nervegrowth factor receptor of avian dorsal root ganglia. Proc. natn.Acad. Sci. U.S.A. 70, 3884-3888.

HIGCINS, G. A., SOOKYYONG, K., KAREM, S. C. AND GAGE, F. H.

(1989). NGF induction of NGF receptor gene expression andcholinergic neuronal hypertrophy within the basal forebrain ofthe adult rat. Neuron 3, 247-256.

HUEBNER, K., ISOBE, M., CHAO, M., BOTHWELL, M., ROSS, A. H.,

FINAN, J., HOXIE, J. A., SEHGAL, A., BUCK, C. R., LANAHAN,

A., NOWELL, P. C , KOPROWSKI, H. AND CROCE, C. M. (1986).

The nerve growth factor receptor gene is at human chromosomeregion 17q12-17q22, distal to the chromosome 17 breakpoint inacute leukemias. Proc. natn. Acad. Sci. U.S.A. 83, 1403-1407.

JOHNSON, D., LANAHAN, A., BUCK, C. R., SEHGAL, A., MORGAN,

C , MERCER, E., BOTHWELL, M. AND CHAO, M. (1986).

Expression and structure of the human NGF receptor. Cell 47,545-554.

KORSCH1NG, S . , AUBURGER, G . , HEUMANN, R . , SCOTT, J. ANDTHOENEN, H. (1985). Levels of nerve growth factor and itsmRNA in the central nervous system of the rat correlate withcholinergic innervation. EM BO J. 4, 1389-1393.

LANDRETH, G. E. AND SHOOTER, E. M. (1980). Nerve growth factorreceptors on PC12 cells: ligand-induced conversion from low- tohigh-affinity states. Proc. natn. Acad. Sci. U.S.A. 77, 4751-4755.

LARGE, T. H., WESKAMP, G., HELDER, J. C , RADEKE, M. J.,

MISKO, T. P., SHOOTER, E. M. AND REICHARDT, L. F. (1989).

Structure and developmental expression of the nerve growthfactor receptor in the chicken nervous system. Neuron 2,1123-1134.

LE DOUARIN, N. M. (1980). Migration and differentiation of neuralcrest cells. In Current Topics in Developmental Biology (ed. A.A. Moscona and A. Monroy), pp. 31-85. New York: AcademicPress.

LEIBROCK, J., LOTTASPEICH, F., HOHN, A., HOFER, M., HENGERER,

B., MASIAKOWSKI, P., THOENEN, H. AND BARDE, Y.-A. (1989).

Molecular cloning and expression of brain-derived neurotrophicfactor. Nature, Lond. 341, 149-152.

LELIEVRE, C. S. AND LE DOUARIN, N. M. (1975). Mesenchymalderivatives of the neural crest. / . Embryol. exp. Morph. 34,125-154.

LEVI-MONTALCINI, R. (1987). The nerve growth factor 35 yearslater. Science 237, 1154-1162.

LEVI-MONTALCINI, R. AND ANGELETTI, P. U. (1968). Nerve growthfactor. Physiol. Rev. 48, 534-569.

LINDSAY, R. M. AND ROHRER, H. (1985). Placodal sensory neuronsin culture: Nodose ganglion neurons are unresponsive to NGF,lack NGF receptors but are supported by a liver-derivedneurotrophic factor. Devi Biol. 112, 30-48.

LINDSAY, R. M., THOENEN, H. AND BARDE, Y.-A. (1985). Placode

and neural-crest-denved sensory neurons are responsive at earlydevelopmental stages to brain-derived neurotrophic factor. DeviBiol. 112, 319-328.

MACLUSKY, N. J. AND NAFTOLJN, F. (1981). Sexual differentiationof the central nervous system. Science 211, 1294-1302.

MCEWEN, B. S. (1983). Gonadal steroid influences on braindevelopment and sexual differentiation. In Reprod. Physiol. IV(ed. R. Greep), pp. 99-145. University Park, MD: UniversityPark Press.

NODEN, D. M. (1975). An analysis of the migratory behavior ofavian cephalic neural crest cells. Devi Biol. 42, 106-130.

PEARSON, J., JOHNSON, E. M., JR AND BRANDEIS, L. (1983). Effects

of antibodies to nerve growth factor on intrauterine developmentof derivatives of cranial neural crest and placode in the GuineaPig. Devi Biol. 96, 32-36.

PERSSON, H., AYER-LELIEVRE, C , SODER, O., VILLAR, M. J.,

METSIS, M., RITZEN, M. AND HOKFELT, T. (1990). Expression of

/J-Nerve growth factor receptor mRNA in rat sertoli cellsdownregulated by testosterone. Science (in press).

RADEKE, M. J., MISKO, T. P., Hsu, C , HERZENBERG, L. A. AND

SHOOTER, E. M. (1987). Gene transfer and molecular cloning ofthe rat nerve growth factor receptor. Nature, Lond. 325,593-597.

RAIVICH, G., ZIMMERMAN, A. AND SUTTER, A. (1987). Nerve growthfactor (NGF) receptor expression in the cranial development. J.Comp. Neurobiol. 256, 229-245.

RAIVICH, G., ZIMMERMANN, A. AND SUTTER, A. (1985). The spatial

and temporal pattern of /SNGF receptor expression in thedeveloping chick embryo. EMBO J. 4, 637-644.

REPRESA, J. AND BERND, P. (1989). Nerve growth factor and serumdifferentially regulate development of the embryonic otic vesicleand cochleovestibular ganglion in vitro. Devi Biol. 134, 21-29.

RETTIG, W. J., THOMSON, T. M., SPENGLER, B. A., BIEDLER, J. L.

704 F. Hallbddk and others

AND LLOYD, J. O. (1986). Assignment of human nerve growthfactor receptor gene to chromosome 17 and regulation ofreceptor expression in somatic cell hybrids. Som. Cell Mol. Gen.12, 441-447.

RICHARDSON, P. M., VERGE ISSA, V. M. K. AND RJOPELLE, R. J.

(1986). Distribution of neuronal receptors for nerve growthfactor in the rat. J. Neurosci. Res. 6, 2312-2321.

RIOPELLE, R. J., KLERAMAN, M. AND SUTTER, A. (1980). Nerve

growth factor receptors: analysis of the interaction of NGF withmembranes of chick embryo dorsal root ganglia. Brain Res. 199,63-77.

RODRIGUEZ-TEBAR, A. AND BARDE, Y. A. (1988). Bindingcharacteristics of brain-derived neurotrophic factor to itsreceptors on neurons from the chick embryo. J. Neurosci. 8,3337-3342.

ROHRER, H. AND BARDE, Y.-A. (1982). Presence and disappearanceof nerve growth factor receptors on sensory neurons in culture.Devi Biol. 89, 309-315.

SCHECHTER, A. L. AND BOTHWELL, M. A. (1981). Nerve growthfactor receptors on PC12 cells: evidence for two receptor classeswith differing cytoskeletal association. Cell 24, 867-874.

SEHGAL, A., PATIL, N. AND CHAO, M. (1988). A constitutive

promoter directs expression of the nerve growth factor receptorgene. Mol. Cell Biol. 8, 3160-3167.

SHELTON, D. L. AND REICHARDT, L. F. (1986). Studies on theexpression of /3 nerve growth factor (NGF) in the central nervoussystem: level and regional distribution of NGF mRNA suggeststhat NGF function as a trophic factor for several distinctpopulations of neurons. Proc. natn. Acad. Sci. U.S.A. 83,2714-18.

SUITER, A., RIOPELLE, R. J., HARRIS-WARRICK, R. M. AND

SHOOTER, E. M. (1979). Nerve growth factor receptors:characterization of two distinct classes of binding sites on chickembryo sensory ganglia cells. J. biol. Chem. 254, 5972-82.

TANIUCHI, M., CLARK, H. B., SCHWEITZER, J. B. AND JOHNSON, E.

M., JR (1988). Expression of nerve growth factor receptors bySchwann cells of axotomized peripheral nerves: ultrastructurallocation, suppression by axonal contact, and binding properties.J. Neurosci. 8, 664-681.

TANIUCHI, M., SCHWEITZER, J. B. AND JOHNSON, E. M., JR (1986).

Nerve growth factor receptor molecules in rat brain. Proc. natn.Acad. Sci. U.S.A. 83, 1950-1954.

THOENEN, H., BANDTLOW, C. AND HEUMANN, R. (1987). The

physiological function of nerve growth factor in the centralnervous system: comparison with the periphery. Rev. Physiol.Biochem. Pharmacol. 109, 145-178.

THOENEN, H. AND BARDE, Y. A. (1980). Physiology of nervegrowth factor. Physiol. Rev 60, 1284-1335.

WHITTEMORE, S. R., EBENDAL, T., LARKFORS, L., OLSON, L.,

SEIGER, A., STROMBERG, I. AND PERSSON, H. (1986).

Developmental and regional expression of nerve growth factormessenger RNA and protein in the rat central nervous system.Proc. natn. Acad. Sci. U.S.A. 83, 817-821.

WHITTEMORE, S. R. AND SEIGER, A. (1987). The expression,localization and functional significance of beta-nerve growthfactor in the central nervous system. Brain Res. 434, 439-464.

YAN, Q. AND JOHNSON, E. J. (1987). A quantitative study of thedevelopmental expression of nerve growth factor (NGF) receptorin rats. Devi Biol. 121, 139-48.

(Accepted 23 January 1990)