Expression of Toll-like receptors in the nervous system...Summary Toll-like receptors (TLRs) are a part of the innate immune system, which is the first line of defense to pathogens

Expression of Toll-like receptors in thenervous system

A survey of the literature and some additional experiments

Andrea Björkman

Degree project in biology, 2007Examensarbete i biologi, 20p, 2007Biology Education Centre, Uppsala University, and Karolinska Institutet, Division ofNeurodegenerative Diseases, Department of Neuroscience, 171 77 Stockholm, SwedenSupervisors: Krister Kristensson and Mikael Nyhage

Abbreviations ALS Amytrophic lateral sclerosis AP Area postrema AP-1 Activator-protein 1 BBB Blood-brain barrier CARD Caspase recruitment domain cDNA Complementary DNA Chp Choroid plexus CVO Circumventricular organ EAE Experimental autoimmune encephalomyelitis HIV Human immunodeficiency virus IFN Interferon IKB Inhibitor of NF-KB IKK-I Inducible IKB kinase IRAK IL-1R-associated kinase IRF IFN regulatory factor JNK c-Jun N-terminal kinase MAPK Mitogen-activated protein kinases MDA Melanoma differentiation-associated gene ME Median eminence MDC Myeloid dendritic cells MPOA Medial preoptic area MS Multiple Sclerosis MyD88 Myeloid differentiation primary response protein 88 NF-KB Nuclear factor kappa-b OVLT Organum vasculosum of the lamina terminalis PAMP Pathogen-associated molecular pattern PDC Plasmacytoid dendritic cells PGN Peptidoglycan Poly(I:C) Polyinosonic polycytidylic acid PRR Pattern recognition receptor RIG-1 RNA helicase retinoic acid-inducible gene-1 RIP-1 receptor interacting protein-1 SFO Subfornical organ SFV Semilike Forest Virus TAK TGF-β activated kinase TANK TRAF family member-associated NF-KB activator TBK TANK-binding kinase TIR Toll IL-1 receptor TIRAP TIR-domain-containing-adaptor-protein TLR Toll-like receptor TNF Tumor necrosis factor TRAM TRIF-related adaptor molecule TRAF Tumor necrosis factor (TNF) receptor-associated factor TRIF TIR-domain-containing-adaptor inducing IFNβ

1

Summary Toll-like receptors (TLRs) are a part of the innate immune system, which is the first line of defense to pathogens. Thirteen TLRs that are all structurally related and together respond to a broad range of pathogens have been discovered in mammals. The binding to the receptor will start an intracellular signaling pathway resulting in the activation of proinflammatory genes. Binding to certain TLRs induces the activation of type 1 interferons. The Toll receptor was first discovered in Drosophila in which it was involved in the development of the dorsoventral polarity. In addition, Drosophila with a dysfunctional Toll gene is more susceptible to fungal infections. Later, homologues to the Toll receptor were found in humans. Toll-like receptors seem to play a very important part in immunity since they recognize a great variety of pathogens. Several pathogens infecting the central nervous system start by entering the peripheral nervous system (PNS) and therefore TLRs could hypothetically be more prevalent as a defense mechanism in the peripheral nervous system than in the central nervous system (CNS). To test the hypothesis I have compared the expression of TLRs in hippocampus (CNS) and trigeminal ganglia (PNS) by purifying RNA, converting it to cDNA, amplifying it and finally visualizing it on a gel. I have also reviewed previous research concerning TLR expression in the nervous system. The literature has shown that most TLRs are expressed in the brain although not in all cell-types. The material on TLR expression in PNS has been limited. From my experiments it seemed like TLRs 7 and 9 were expressed in nerve cells from PNS but not in nerve cells from CNS. The lack of TLRs 7 and 9 in nerve cells in CNS is consistent with previous studies. Although I did not test all TLRs there seemed as at least two of these receptors had a wider expression in PNS.

2

Introduction Background Toll-like receptors (TLRs) are a family of structurally related receptors. Thirteen different receptors have been found in mammals but only ten in humans. They are pattern recognition receptors (PRRs) and all share a leucine-rich repeat recognizing their ligand extracellularly and a Toll IL-1 receptor in their intracellular domain (Figure 1) (Pandey et al. 2006).

Figure 1: General structure of a TLR containing a leucine rich domain extracellularly and a TIR domain intracellularly. Also in the figure is an adaptor molecule containing a TIR domain. Reprinted, with permission, from the Annual Review of Immunology, Volume 24 © 2006 by Annual Reviews www.annualreviews.org The first Toll-receptor was found in Drosophila melanogaster and was involved in the development of the dorsoventral polarity (Lemaitre et al. 1996). Mutations in the gene coding for the Toll-receptor in adult Drosophila was associated with a higher susceptibly to fungal infections (Hoffmann 2003). The Toll-receptor was first discovered by the German scientists Nüesslein-Volhard and Wieschaus. When they first viewed the strangely developed embryos Nüesslein-Volhard cried out “Toll”, which means “amazing” or “cool” in German. (Opal et al. 2002) Later TLR4, which showed sequence similarity with the Drosophila Toll and therefore got the name Toll-like receptor, was found in humans. Not only the TLR showed homology, but also the molecules in its pathway (Medzhitov et al. 1997).The TLRs can recognize a vide range of infectious organisms. Components of bacteria, viruses etc act as ligands and their binding to the receptors can activate different signaling pathways leading to various cellular responses to the infection.

3

TLRs are found in most multicellular organisms and are a part of the innate immune system. The immune system can be divided into the innate and adaptive immune system. The innate system has no memory. One of its components, cytokines, are signaling proteins, like hormones, but involved in immune responses. Other examples are the complement system which is a cascade of small proteins helping in clearing an organism from pathogens, and natural killer cells that can kill for example microbial cells (Préhaud et al. 2005). The adaptive immune system has a memory. After an infection, memory B-cells and T-cells will develop recognizing the specific pathogen so that the next time the host is infected by the same pathogen the immune system can protect it much faster. It is only present in vertebrates (Hoffman 2003). The innate and adaptive system can signal to each other and TLRs are also involved in the regulation of the adaptive immune system (Takeda et al. 2003). There has been much research about the adaptive immune system but in recent years there has been more focus on the innate immune system (Germain 2003). The TLRs were discovered in the 1990’s and since then there has been intense research concerning them. They seem to respond to most pathogens and therefore have a very important part in immunity. Ligands The toll-like receptors can bind a great variety of pathogens like bacteria, protozoa, viruses and fungi (Figure 2). They recognize conserved patterns called pathogen-associated molecular patterns (PAMPs). The TLRs are further divided into subfamilies based on amino acid sequence similarity and genomic structure. As a result, the TLRs within a subfamily recognize the same class of PAMPs (Takeda et al. 2003). TLR1 can recognize triacyl lipopeptides. It is also reported to associate with TLR2 and these together can respond to soluble factors released from the bacterium Neisseria meningitides. TLR2 by itself can be stimulated by many different microbial parts. In particular, peptidoglycan (PGN) from both gram-postive and -negative bacteria, and lipoproteins are recognized by TLR2. TLR6, which is very similar to TLR1, also can associate with TLR2 and together they can recognize microbial lipopeptides. TLRs 1, 2, 6 and 10 all are in the same subfamily and are present in the cytoplasmic membrane. (Takeda et al. 2003) No ligand that binds to TLR10 has been found yet and it is not present in mice (Beutler et al. 2006). Double-stranded RNA, which is often produced by different viruses, stimulates TLR3. Poly I:C is a synthetic form of dsRNA, which is also recognized by TLR3. TLR3 is present in endosomal compartments. (Takeda et al. 2003) TLR4 is mainly stimulated by lipopolysaccharide (LPS), which is a cell-wall component of gram-negative bacteria. Before binding to TLR4, LPS will bind to LPS-binding protein and the complex is then recognized by CD14, a molecule that is preferentially expressed in monocytes/macrophages and neutrophils.TLR4 can recognize other ligands as well. TLRs 3 and 4 are each subdivided into their own subfamily. (Takeda et al. 2003) Flagella are motility organelles of bacteria that help them to move. Flagellin is the main protein component of flagella and is also the ligand for TLR5. TLR11 has been found in mice but is only present as a pseudogene in humans.TLR11, which is a relative to TLR5, recognizes components of

4

uropathogenic bacteria and profilin-like molecule, which is an actin-binding protein, from Toxoplasma gondii, which is a parasitic protozoa (Uematsu and Akira 2006). TLRs 7, 8 and 9, which are all similar, are members of the same subfamily and have an intracellular localization. TLR9 can recognize CpG DNA, both viral and bacterial. In addition it is reported to recognize the malaria pigment hemozoin (Kawai and Akira 2006). The natural ligands of TLRs 7 and 8 are not fully known. TLR7 recognizes synthetic imidazoquinolines-like molecules, which are similar to nucleic acids. Human, but not murine, TLR8 has been reported to respond to imidazoquinolines. In addition human TLRs 7 and 8 can respond to guanozine- or uridine- rich ssRNA from viruses including HIV and influenza (Uematsu and Akira 2006). The ligands for TLR12 and 13 are not known yet (Takeda et al. 2003).

Figure 2: Ligands and adaptor molecules utilized and the genes activated by different TLRs. Adapted by permission from Macmillan Publishers Ltd: Cell Death and Differentiation (Kawai and Akira), copyright (2006) www.nature.com/cdd Intracellular Toll-like receptor signaling The stimulation of a TLR results in the activation of various genes involved in the immune system. The TLRs mainly use one of two pathways, the MyD88- dependent or -independent pathway. Nevertheless, there is still much research being done concerning the pathways and the subsequent description is an outline of the pathways. The Myeloid differentiation primary response protein 88-Dependent Signaling Pathway All TLRs except TLR3 can use the myeloid differentiation primary response protein 88 (MyD88) -dependent signaling pathway (Figure 3 and 4). After a TLR is stimulated by a ligand, MyD88 will

5

http://www.nature.com/cdd

bind to the Toll IL-1 (TIR) domain of the cytoplasmic part of the TLR. TLRs 1, 2, 4 and 6 will also use TIR-domain-containing-adaptor-protein (TIRAP) as an adaptor molecule. Thereafter IL-1R-associated kinase (IRAK) 4 associates with the complex and phosphorylates IRAK1. Tumour necrosis factor receptor-associated factor (TRAF) 6 will then associate with the phosphorylated IRAK. The two together will phosphorylate TGF-β activated kinase (TAK) 1, which will subsequently phosphorylate two molecules from the MAPK family. Furthermore AP-1 will translocate to the nucleus after activation from mitogen-activated protein kinases (MAPKs). In addition TAK-1 will phosphorylate a complex of inhibitor of NF-KB (IĸB) kinase and induce ubiquitination-induced degradation of IĸB. This will lead to a nuclear translocation of nuclear factor- kappa-b (NF-ĸB). NF-ĸB and activator-protein (AP) -1 will together activate genes encoding pro-inflammatory cytokines and chemokines like tumor necrosis factor (TNF) -α, interleukin (IL) -6, IL-12 and IL-1β among others (Naka et al. 2005). Cytokines are proteins signaling between cells involved in immune responses. TLRs 7, 8 and 9 signaling (Figure 3) differ slightly from the previous pathway since they can also activate type 1 interferon (IFN) genes. IFN regulatory factor (IRF) 7, which is a transcription factor, will then get activated and translocated to the nucleus where it will induce transcription of IFN-α and IFN-β, which are called type 1 IFN and are cytokines with antiviral activity (Uematsu and Akira 2006). It has been suggested that, IRF-5 act together with NF-ĸB as a transcription factor binding to the pro-inflammatory cytokine genes, after activation of TLRs 3, 4, 5 and 7 and possibly other TLRs (Takaoka et al. 2005). The Myeloid differentiation primary response protein 88-Independent Signaling Pathway TLRs 3 and 4 use the MyD88-Independent Signaling Pathway (Figure 4). In this pathway TIR-domain-containing-adaptor inducing IFN-β (TRIF) can activate NF-ĸB either by using TRAF-6 or receptor-interacting protein (RIP) -1. TLR4 also interacts with TRIF-related adaptor molecule (TRAM) when interacting with TRIF. RIP-1 activates the inducible IKB kinase (IKK) complex while TRAF-6 has the same function as in the MyD88-dependent pathway and activates TAK-1 (Kawai et al. 2006). In addition, TRIF is interacting with TANK-binding kinase (TBK) -1 and inducible IKB kinase (IKK-i). They will phosphorylate IRF-3 which will translocate to the nucleus and activate the transcription of type1 IFN genes (Pandey and Agrawal 2006).

6

Figure 3: The MyD88-dependent pathway and the activation of IRF7 by TLR7, 8 and 9 leading to the transcription of type 1 IFN and inflammatory cytokines. For a more detailed description see text on p. 6-7. Reprinted by permission from Macmillan Publishers Ltd: Cell Death and Differentiation (Kawai and Akira), copyright (2006) www.nature.com/cdd

Figure 4: The MyD88-dependent and -independent pathway leading to the transcription of type 1 IFN and inflammatory cytokines. For a more detailed description see text on p. 6-7. Reprinted by permission from Macmillan Publishers Ltd: Cell Death and Differentiation (Kawai and Akira), copyright (2006) www.nature.com/cdd

7



Signaling to the adaptive immune system The TLRs are involved in the signaling to the adaptive immune system through the activation of T-cells. In particular the T helper(TH)1 response seems to bee induced by TLR signaling. T lymphocytes can either express a cluster of differentiation (CD) 4 or CD8 surface molecule. Furthermore, T helper cells (TH), which have the CD4 molecule, induce a TH1 or TH2 response. The TH1 response is characterized by its release of proinflammatory cytokines (Berger 2000). The TH1 response seems to involve the MyD88-dependent pathway. A mouse deficient in MyD88 immunized with ovalbumin mixed in controlled Freund’s adjuvant failed to elicit a Th1 response (Schnare et al. 2001). Several studies show an involvement of TLRs with the maturation of dendritic cells, which are involved in the activation of naïve T-cells (Takeda et al. 2003). For example the maturation of dendritic cells by TLRs 2 and 4, induced by PGN, is shown (Michelsen et al. 2001). Furthermore, B-cells express most TLRs. They are also activated by ligands to TLRs (Pasare and Medzhitov 2004). Cells expressing Toll-like receptors Immune cells TLRs are expressed in many different cell types in the body. In particular they are expressed in several innate immune cells. Immune cells like monocytes and macrophages express most TLRs except TLR3. In addition NK cells, neutrophils and basophils (Pandey and Agrawal 2006) and granulocytes (Zarember and Godowski 2002) have been reported to express TLRs. Both myeloid dendritic cells (MDCs) and plasmacytoid dendritic cells (PDCs) are found in human blood. MDCs express TLRs 1, 2, 4, 5 and 8 while PDCs express TLR7 and 9. Immature dendritic cells express TLRs 1, 2, 4 and 5 and the expression decreases with maturation caused by exposure to microbes. TLR3 is only expressed in mature dendritic cells (Takeda et al. 2003). TLRs 2, 4, 6 and 8 are expressed in mast cells (Takeda et al. 2003). Adaptive immune cells like B-cells and regulatory T-cells express TLRs as well (Pandey and Agrawal 2006). In T-cells TLRs 1-5 has been detected and TLRs 7 and 9 at lower levels (Caron et al. 2005). Other types of cells The intestinal epithelial cells express TLR4 at low levels while TLR5 is only expressed on the basolateral surface (Takeda et al. 2003). TLRs 2 and 4 are expressed in renal epithelial cells (Takeda et al. 2003). Human dermal epithelial cells express TLR4 (Takeda et al. 2003). TLR11 is expressed in kidney and bladder (Uematsu and Akira 2006). Small airway epithelial cells, which are important in protecting the lung from infections, are reported to express TLRs 1-6 constitutively (Ritter et al. 2005). Muscle cells express low constitutive levels of TLRs 1-7 and 9 in humans (Schreiner et al. 2005). According to a study on TLR expression in human tissues (Nishimura and Naito 2005), TLR1 is expressed at high levels in kidney, lung and spleen. TLR2 shows the highest expression in lung and spleen while TLR3 is expressed at the highest level in the placenta. The spleen is where TLR4 is expressed at the highest level. TLR5 shows the highest expression in trachea, placenta, lung, prostate, salivary gland and kidney, although the levels are relatively low. TLR6 is expressed at the highest level in the spleen. TLR7 has the highest

8

expression levels in the lung, placenta, spinal cord and spleen. Lung and spleen are the organs where TLR8 is expressed at the highest level and TLR9 has the highest expression levels in skeletal muscles and spleen. The spleen and thymus show the highest expression levels of TLR10. In mouse, TLR3 is expressed in lung, brain and kidney (Alexopoulou et al. 2001). Heart, brain and muscle are reported to express TLR2 in humans (Rock et al. 1998). RNA helicase retinoic acid-inducible gene-1 Apart from the TLRs there are several other pattern recognition receptors. One of them is RNA helicase retinoic acid-inducible gene-1 (RIG-1). It was recently discovered and recognizes intracellular viruses. RIG-1 is a receptor residing in the cytoplasm binding dsRNA. It is also suggested to bind ssRNA bearing 5’phosphates (Pichlmair et al. 2006). It contains one helicase domain at its C-terminus and two caspase recruitment domain (CARD) motifs at its N-terminus. The helicase domain is able to unwind dsRNA and the CARD motifs seem to be interacting with signaling molecules leading to the activation of IRF-3 and NF-ҝB (Figure 5) (Yoneyama et al. 2004). Although the signaling pathway is not fully known it seems like TBK1 and IKK-i are involved in the signaling. They are two molecules also involved in TLR signaling in the MyD88-independent pathway (Perry et al. 2005). Additionally, two receptors showing homology with RIG-1 have been found, the melanoma differentiation-associated gene 5 (Mda5), which also contains two CARD motifs, and LGP2, which does not. Both receptors have a helicase domain (Kawai and Akira 2006). RIG-1 mRNA has been detected with an Affymetrix array in cultured human nerve cells and further an upregulation of the receptor has been observed after Rabies virus infection (Préhaud et al. 2005).

Figure 5: RIG-1 pathway. For a more detailed description see text. Reprinted by permission from Macmillan Publishers Ltd: Cell Death and Differentiation (Kawai and Akira), copyright (2006) www.nature.com/cdd

9


Reverse Transcriptase Reverse transcriptase is an enzyme that can transcribe RNA into DNA. Retroviruses, like HIV, have the capability to transcribe their RNA to DNA which they can insert into the host genome (Flint et al. 2003). Therefore it is possible to make complementary DNA (cDNA) from RNA by using reverse transcriptase. The cDNA can then be amplified by polymerase chain reaction (PCR). Aim In this project I aim to study the differences in expression of Toll-like receptors in the peripheral nervous system (PNS) and central nervous system (CNS). The presence of more TLRs in PNS than in CNS could be functional since viruses and microbes, infecting the nervous system, usually first infect PNS before entering CNS. Previous unpublished studies on cultured nerve cells have shown that cells from PNS expressed more Toll-like receptors than cells from CNS. I also aimed to make an extensive review of the literature on research on Toll-like receptors in the nervous system.

10

Results I Literature review: Toll-like receptors in the nervous system Toll-like receptors in different cell-types in CNS The CNS is well-protected from immune cells that can cause harm to the brain. Since the brain, in contrast to the rest of the body, has a limited regenerative capacity after an injury, it is more vulnerable to inflammation. The blood-brain barrier (BBB) prevents many macromolecules from entering into the brain. It consists of endothelial cells that are sealed with tight junctions (Hickey et al. 2001). Furthermore, there is a blood-cerebrospinal fluid barrier that protects the CNS. Additionally, within the CNS anti-inflammatory mediators like transforming growth factor–β (TGF-β) and α-melanocyte stimulating hormone (α-MSH) are produced (Aloisi 2001). The brain has long been thought to have a very limited immune surveillance but today it is known that most immune cells can enter the CNS although the levels of them are much lower than in the rest of the body (Hickey 2001). T-cells are known to be able to cross the BBB (Hickey 2001). There is evidence that B-cells can enter into the brain when the BBB is altered, but it is not known whether they can enter under normal circumstances (Hickey 2001). Both dendritic cells, which stimulate T-cells, and macrophages are detected in the meninges and choroid plexus (Aloisi 2001). Monocytes are circulating white blood cells that carry out phagocytosis and develop into macrophages when entering tissues. Microglia, which is one of the most important types of immune cells of the CNS, probably originate from the monocyte/macrophage lineage and enters the CNS before birth (Hickey 2001). Microglia can secrete cytokines and neurotrophic factors. They are also able to carry out phagocytosis and are important in reparation. Nevertheless, all their functions are not known yet (Aloisi 2001). Microglia Microglia is the cell-type within the CNS with the broadest TLR expression. TLRs 1-9 have been detected in both mouse and human. (Table 1 and 2) Expression levels in mouse The cultured microglia showed different expression levels in the studies performed. TLRs 2 and 6-8 showed the highest levels, TLRs 4-5 middle levels whereas TLRs 1, 3 and 9 showed the lowest levels (Olson and Miller 2004). Another study on microglia in vitro detected the highest transcription level of TLR2, medium levels of TLRs 4 and 7 and the lowest levels of TLRs 1-4, 6, 7 and 9 whileTLR5 were not detected at all. Expression levels in humans The level of expression differed between the studies. According to the study on cultured cells (Bsibsi et al. 2002) TLRs 2 and 3 were expressed at the highest levels, TLRs 1, 4-8 at medium levels while 9 at the lowest level. In another study on cultured cells TLRs 1, 2, 4 and 7 were expressed at higher levels than TLRs 3, 5, 6, 8 and 9. Expression of TLR10 was not detected at all. In additioin, differences in expression level between individuals were found (Jack et al. 2005).

11

12

Astrocytes In mouse astrocytes the TLR expression is as extensive as in microglia and TLRs 1-9 have been detected, whereas in human only TLRs 1-5 and 9 have been found. (Table 3 and 4) Expression levels in mouse In cultured astrocytes, levels of TLR3 mRNA were the highest of all TLRs detected followed by TLRs 1 and 6 mRNA while TLRs 7 and 8 mRNA were at the lowest levels of them all (Carpentier et al. 2005). Another study also in vitro detected the highest level of TLR7 mRNA whit TLRs 2, 3, 8 and 9 mRNA at intermediate levels and TLRs 1, 4, 5 and 6 mRNA at the lowest levels (McKimmie and Fazakerley 2005). Expression levels in human One study (Farina et al. 2004) only detected mRNA from TLR3 in vitro. In addition, another study detectd TLR3 mRNA at the highest level and TLRs 1, 4, 5 and 9 mRNA at lower levels (Jack et al. 2005). Bsibsi et al. (2002) found TLRs 2 and 3 mRNA, the latter at the highest level. On the other hand, Bsibsi et al. (2006) found TLR4 mRNA at the highest level in vitro, thereafter TLR2, followed by TLR3 while TLR1 at the lowest level. They did not analyze the presence of the other TLRs. Neurons In mouse neurons TLRs 1-4 and 6 have been found. In human only TLRs 1-4 have been detected but then the others have not been tested. (Table 5 and 6) Oligodendrocytes Oligodendrocytes express the fewest TLRs. TLRs 1-4 have been detected in mouse. (Table 7)

Table 1: Expression of TLRs in m

ouse and rat microglia

in vitro in vitro

in vivo in vivo

mR

NA

Protein

mR

NA

Protein

Ability to respond to different com

pounds 1

TLR1

Y

es, with quantitative PC

R (O

lson and Miller

2004 and (McK

imm

ie and Fazakerley 2005)

- -

- -

TLR2

Yes , w

ith quantitative PCR

(Olson and M

iller 2004, (M

cKim

mie and Fazakerley 2005 and

Rasley et al. 2002) and w

ith RT-PC

R (Jung et

al. 2005)

Yes, w

ith im

munostaining

(Lehnardt et al. 2006)

Yes, w

ith in situ hybridization (Laflam

me

et al. 2001 and Zekki et al. 2002)

Yes, w

ith IF m

icroscopy (M

ishra et al. 2006)

mR

NA

and protein were upregulated in vitro after infection w

ith S. aureus and PG

N detected w


and Western blot (K

ielian 2005) m

RN

A w

as uprgulatd after stimulation w

ith B. burgdorferi detected in vitro w


(Rasley et al. 2002)

TLR3

Y


R (O

lson and Miller

2004 and (McK

imm


- -

- m

RN

A w

as uprgulated in vitro after stimulation w

ith poly(I:C) detected w

ith R

T-PCR

(Town et al. 2006)

TLR4

Yes, w


(Olson and M

iller 2004 and (M

cKim

mie and Fazakerley 2005) and

with R

T-PCR

in rats (Lehnardt et al. 2003) and in m

ouse with R

T-PCR

(Jung et al. 2005)

- Y

es, with

in situ hybridization (C

hakravarty and H

erkenham

2005)

- Protein w

as detected in vivo after M. corti infection w

ith IF microscopy

(Mishra et al. 2006)

TLR5

Yes, w


(Olson and M

iller 2004)

No

, not with quantitative PC

R (M

cKim

mie

and Fazakerley 2005)

- -

- -

TLR6

Yes, w


(Olson and M

iller 2004 and (M

cKim

mie and Fazakerley 2005)

- -

Yes, w

ith IF m

icroscopy (M

ishra et al. 2006)

-

TLR7

Y


R (O

lson and Miller

2004 and (McK

imm


- -

- Protein w

as detected in vivo after M. corti infection w

ith IF microscopy


TLR8

Y


R (O

lson and Miller

2004 and (McK

imm


- -

- -

TLR9

Yes, w


(Olson and M

iller 2004 and (M

cKim

mie and Fazakerley 2005) and

with R

T-PCR

(Iliev et al. 2003, Zhang et al. 2005 and D

alpke et al 2002))

- -

- C

pG, a ligand to TLR

9, upregulated several cytokines in vitro detected with

ELISA (Takeshita et al. 2001) and R

T-PCR

(Zhang et al. 2005) and in vivo (D

alpke et al. 2002) detected with ELISA

1 For details concerning in vitro and in vivo or mR

NA

and protein see text in table.

13

Table 2: Expression of TLRs in hum

an microglia

1

in vitro in vitro

m

RN

A

Protein TLR

1

Yes, w

ith semi-quantitative PC

R (Jack et al. 2005) and R

T-PCR

(B

sibsi et al. 2002) -

TLR2

Y

es , with sem

i-quantitative PCR

(Jack et al. 2005) and RT-PC

R

(Bsibsi et al. 2002)

-

TLR3

Y

es, with sem

i-quantitative PCR


R


Yes, w

ith imm

unostaining (Bibsi et al. 2002)

and with flow

cytometry (Jack et al. 2005)

TLR4

Y

es, with sem

i-quantitative PCR


R


Yes, w

ith imm

unostaining (Bibsi et al. 2002)

No

, not with flow

cytometry (Jack et al. 2005)

TLR5

Y

es, with sem

i-quantitative PCR


R


-

TLR6

Y

es, with sem

i-quantitative PCR


R


-

TLR7

Y

es, with sem

i-quantitative PCR


R


-

TLR8

Y

es, with sem

i-quantitative PCR


R


-

TLR9

Y

es, with sem

i-quantitative PCR


R


-

TLR10

No

, not with sem

i-quantitative PCR

(Jack et al. 2005) -

1 No data concerning in vivo studies or studies of stim

ulated cells were found in the literature.

14

Table 3: Expression of TLRs in m

ouse and rat astrocytes in vitro

in vitro in vivo

in vivo

mR

NA

Protein

mR

NA

Protein A

bility to respond to different compounds 1

TLR1

Y


R (C

arpentier et al. 2005 and M

cKim

mie and Fazakerley

2005)

- -

- -

TLR2

Yes , w


(Carpentier et

al. 2005 and McK

imm


Yes, w

ith im

munostaining

(Lehnardt et al. 2006) and w

ith Western blot

(Bow

man et al. 2003)

- Y

es, with

IF staining (M

ishra et al. 2006)

Elevated mR

NA

level were detected in vitro w


R

after exposure to its ligand (Bow

man et al. 2003)

Protein was detected in vitro w

ith cell surface staining after exposure of LPS and poly I:C

(Carpentier et al. 2005)

TLR3

Yes, w


(Carpentier et

al. 2005 and McK

imm


Yes, in rat w

ith W

estern blot (Scumpia

et al. 2005)

- -

Dow

nregulation of protein was detected in vitro w

ith Western blot w

hen treated w

ith poly I:C w

hile upregulation of mR

NA

was detected in vitro

with quantitative PC

R (Scum

pia et al. 2005)

TLR4

Yes, w


(Carpentier et

al. 2005 and McK

imm

ie and Fazakerley 2005) N

o, not w

ith in situ hybridization (C

hakravarty and Herkenham

2005) and with

RT-PC

R in rat (Lehnardt et al. 2002)

Yes, w

ith FAC

S (B

owm

an et al. 2003)

- -

Elevated mR

NA

were detected in vitro w


R after

exposure to its ligand (Bow

man et al. 2003)

Protein found in vivo with IF staining after infection w

ith M. corti (M

ishra et al. 2006) Protein w

as detected in vitro with cell surface staining after exposure of

LPS poly I:C and IFN

-γ and TNF-α (C

arpentier et al. 2005)

TLR5

Yes, w


(Carpentier et

al. 2005 and McK

imm


- -

- Elevated m

RN

A w

ere detected in vitro with sem

i-quantitative PCR

after exposure to its ligand (B

owm

an et al. 2003)

TLR6

Yes, w


(Carpentier et

al. 2005 and McK

imm


- -

Yes, w

ith IF staining (M

ishra et al. 2006)

-

TLR7

Yes, w


(McK

imm


o, not w


(Carpentier

et al. 2005)

- -

- Protein w

ere found in vivo with IF sta ining after infection w

ith M. corti


TLR8

Yes, w


(McK

imm


o, not w


(Carpentier

et al. 2005)

- -

- -

TLR9

Yes, w


(McK

imm


- -

- Elevated m

RN

A w

ere detected in vitro with sem

i-quantitative PCR

after exposure to its ligand (B

owm

an et al. 2003) C

pG upregulated several cytokines in vitro detected w

ith ELISA and R

T-PC

R (Takeshita et al. 2001)


NA

and protein see text in table

15


an astrocytes 1

in vitro in vitro

mR

NA

Protein

Ability to respond to different com

pounds 2

TLR1

Yes, w


(Jack et al. 2005 and (Bsibsi et

al. 2006) N

o, not w


(Farina et al. 2004)

- U

pregulation after treatment w

ith pIC w

as detected in vit ro with quantitative PC

R (Jack

et al. 2005)

TLR2

Yes, w

ith RT-PC

R (B

ibsi et al. 2002 and with quantitative

PCR


No


R (Jack et al. 2005 and Farina

et al. 2004)

- U


ith IL-1 or pIC w

as detected in vitro with a m

icroarray (R

ivieccio et al. 2006)U


ith pIC w

as detected in vitro with quantitative PC

R (Jack

et al. 2005)

TLR3

Yes, w


(Jack et al. 2005, Farina et al. 2004 and B

sibsi et al. 2006 ) and with R

T-PCR

(Bibsi et al.

2002)

Yes, w

ith imm

unostaining (B

ibsi et al. 2002) A

nd with flow

cytometry

(Jack et al. 2005)

After treatm

ent with either TN

F-α, IL -1β, INF-γ, IL-12, IL-4, IL-6, poly I:C

or LPS an upregulation of TLR

3 was observed in vitro w

ith cDN

A A

rray Profiling (Bsibsi et al.

2006). U


ith I L-1 or pIC w

as detected in vitro with a m

croarray (R

ivieccio et al. 2006)U


ith pIC w


R

(Jack et al. 2005) TLR

4 Y


R (Jack et al. 2005 and B

sibsi et al. 2006 ) N

o, not w


(Farina et al. 2004)

Yes, w

ith imm

unostaining (B

ibsi et al. 2002)

Upregulation after treatm

ent with pIC

was detected in vitro w


(Jack et al. 2005)

TLR5

Yes, w


(Jack et al. 2005)

No

, not RT-PC

R (B

ibsi et al. 2002) and quantitative PCR

(B

sibsi et al. 2006 and Farina et al. 2004)

- U


ith pIC w


R (Jack

et al. 2005)

TLR6

N

o, not w


(Farina et al. 2004, Bsibsi et

al. 2006 and Jack et al. 2005) and RT-PC

R (B

ibsi et al. 2002)

- -

TLR7

No


R (Farina et al. 2004 and B

sibsi et al. 2006 and Jack et al. 2005 ) and R

T-PCR

(Bibsi et al.

2002)

- -

TLR8

No



sibsi et al. 2006 and Jack et al. 2005) and R

T-PCR

(Bibsi et al.

2002)

- -

TLR9

Yes, w


(Jack et al. 2005)

No



sibsi et al. 2006 and Jack et al. 2005 ) and R

T-PCR

(Bibsi et al.

2002)

- U


ith pIC w


R (Jack

et al. 2005)

TLR10

No


R (Jack et al. 2005)

- -

1 No data concerning in vivo studies w

ere found in the literature. 2 For details concerning in vitro and in vivo or mR

NA


16

Table 5: Expression of TLRs in rat and m

ouse neurons in vitro

in vitro in vivo

in vivo

mR

NA

Protein

mR

NA

Protein

Ability to respond to

different compounds 1

TLR1

Y


R (M

cKim

mie


- -

- -

TLR2

Yes , w


(McK

imm


No

, not with

imm

unostaining (Lehnardt et al. 2006)

- Y

es, with IF staining


-

TLR3

Y


R (M

cKim

mie


- -

- -

TLR4

Yes , w


(McK

imm


No

, not with R

T-PCR

in rats (Lehnardt et al. 2003)

No

, not with

Western blot (M

a et al. 2006)

No

, not with in situ

hybridization (Chakravarty

and Herkenham

2005)

- -

TLR5

N

o, not w


(M

cKim

mie and Fazakerley 2005)

- -

- -

TLR6

Y


R (M

cKim

mie


- -

Yes, w

ith IF staining (M

ishra et al. 2006)

-

TLR7

No


R

(McK

imm


o, not w

ith W

estern blot (Ma et

al. 2006)

- -

Protein was found in vivo after M

. corti infection w

ith IF staining (Mishra et al.

2006)

TLR8

No


R

(McK

imm

ie and Fazakerley 2005) Y

es, with W

estern blot (M

a et al. 2006)

- -

Protein was found in vivo after M

. corti infection w

ith IF staining (Mishra et al.

2006)

TLR9

No


R

(McK

imm

ie and Fazakerley 2005) and not w

ith RT-PC

R (Iliev et al. 2003)

- -

- -


NA

and protein see text in table. .

17


an neurons 1

in vitro in vitro

m

RN

A

Protein A

bility to respond to different compounds 2

TLR1

Yes , w

ith an Affym

etrix U133 A

rray (Préhaud et al. 2005) and w

ith quantitative PC

R (Lafon et al. 2006 and M

cKim

mie and

Fazakerley 2005)

- -

TLR2

Yes , w

ith an Affym

etrix U133 A


ith quantitative PC


cKim

mie and

Fazakerley 2005)

- -

TLR3

Yes, w

ith an Affym

etrix U133 A


ith quantitative PC


cKim

mie and

Fazakerley 2005)

Yes, w

ith im

munocytochem

istry (Lafon et al. 2006)

Protein was found after Rabies virus infection w

ith imm

unohistochemistry in vivo (Jackson et al. 2006) and in

vitro (Préhaud et al. 2005) and in patients with A

lzheimer’s disease and A

LS in vivo (Jackson et al. 2006) m

RN

A found w

ith RT-PC

R after herpes sim

plex encephalitis infection in vitro (Préhaud et al. 2005) Exposure to IFN

-β upregulated TLR3 m

RN

A in cultured cells detected w


(Lafon et al. 2006)

TLR4

Yes, w

ith an Affym

etrix U133 A


ith quantitative PC


cKim

mie and

Fazakerley 2005)

- -

1 No data concerning in vivo studies or studies of expression of TLR

s 5-9 were found in the literature.


NA


18

19

Tabl

e 7:

Exp

ress

ion

of T

LRs i

n hu

man

mou

se a

nd ra

t olig

oden

droc

ytes

1

in v

itro

in v

itro

m

RN

A

Prot

ein

TLR

1

Yes

, with

RT-

PCR

(Bsi

bsi e

t al.

2002

) in

hum

an

-

TLR

2

Yes

, with

RT-

PCR

(Bsi

bsi e

t al.

2002

) in

hum

an

Yes

, with

imm

unos

tain

ing

in m

ouse

(Leh

nard

t et a

l. 20

06)

TLR

3

Yes

, with

RT-

PCR

(Bsi

bsi e

t al.

2002

) in

hum

an

Yes

, with

imm

unos

tain

ing

(Bsi

bsi e

t al.

2002

) in

hum

an

TLR

4

Yes

, with

RT-

PCR

(Bsi

bsi e

t al.

2002

) in

hum

a N

o, n

ot in

rat

with

RT-

PCR

(Leh

nard

t et a

l. 20

02)

Yes

, with

imm

unos

tain

ing

(Bsi

bsi e

t al.

2002

) in

hum

an

TLR

5

No ,

not

with

RT-

PCR

(Bsi

bsi e

t al.

2002

) in

hum

an

-

TLR

6

No,

not

with

RT-

PCR

(Bsi

bsi e

t al.

2002

) in

hum

an

-

TLR

7

No,

not

with

RT-

PCR

(Bsi

bsi e

t al.

2002

) in

hum

an

-

TLR

8

No,

not

with

RT-

PCR

(Bsi

bsi e

t al.

2002

) in

hum

an

-

TLR

9 N

o , n

ot w

ith R

T-PC

R (B

sibs

i et a

l. 20

02) i

n hu

man

-

1 No

data

con

cern

ing

in v

ivo

stud

ies o

r stu

dies

of s

timul

ated

cel

ls w

ere

foun

d in

the

liter

atur

e

Toll-like receptors in different areas of CNS Using quantitative RT-PCR on a whole mouse brain, mRNA from TLRs 1-9 and 13 were found. Compared to the spleen the CNS showed lower levels of all TLR mRNA except for TLR3 for which the mRNA levels were equal in both organs. Levels of TLR transcripts were also measured after infection with Semilike Forest Virus (SFV) and an upregulation of TLRs 1-3, 7-9 and 13 was observed. Also different mice strains showed a great variety in mRNA levels of different TLRs. (McKimmie et al. 2005) A study (Mishra et al. 2006) on mouse brain showed the presence of transcripts of TLRs 1-9, with GEArray analysis, and an upregulation of all TLRs except TLR5 after infection with M. corti. However, not all TLRs showed expression on a protein-level with in situ IF microscopy. TLRs 1, 3, 4 and 9 were not found as proteins. TLR2 showed the highest protein expression of all TLRs in normal mouse brain. After infection with M. corti all TLRs except TLR5 were found as proteins in the CNS. Astrocytes expressing TLR2 were found at the highest levels in periventricular and leptomeningeal areas while neurons and microglia expressing TLR2 were mostly found in the parenchyma. TLR6 expression showed a similar pattern. The circumventricular organ (CVOs), which includes the organum vasculosum of the lamina terminalis (OVLT), the subfornical organ (SFO), the median eminence (ME) and the area postrema (AP), do not have a blood brain barrier. Instead large molecules can enter. Additionally, the choroids plexus (chp) and the leptomeninges are highly vascularized (Nguyen et al. 2002). Since these areas are in contact with the blood stream they are more exposed to infectious organisms, toxins etc and therefore should have a larger need for immune surveillance and consequently these areas have been more extensively studied. TLR2 In mice, TLR2 mRNA has been detected in various areas using in situ hybridization. A hybridization signal was found in the chp, around the lateral ventricle and the SFO. Moreover, it was found at the the fimbria, stria terminalis, the optic tract and at the inferior cerebellar peduncle (Laflamme et al. 2001 and Zekki et al. 2002). In addition TLR2 transcripts have beeen detected in the anterior paraventricular nucleus of the thalamus, the supraoptic nucleus, the ependymal tanycytic lining cells of the ventral third ventricle, the paraventricular nucleus of the hypothalamus and in some cells in the lateral hypothalamic area. Injection of LPS increased the level of TLR2 in structures accessible by the bloodstream and additionally in parenchymal structures (Laflamme et al. 2001). TLR4 In rats, TLR4 mRNA was found, using in situ hybridization, in areas accessible by the bloodstream including the leptomeninges and the CVO like OVLT, SFO, ME and AP. In addition it was found in some parts of the parenchyma like the supramamillary nucleus, cochlear nucleus, the posterior hypothalamic nucleus and the ventrolateral medulla. Furthermore, parenchymal structures like the MPOA, arcuate nucleus, the dorsomedial hypothalamic nucleus, the paraventricular nucleus of the

20

hypothalamus, the ventromedial hypothalamus surrounding the aqueduct and central canal and the dorsovagal complex also showed a TLR4 mRNA hybridization signal (Laflamme and Rivest 2001). According to another study (Chakravarty and Herkenham 2005) in mouse, using in situ hybridization, TLR4 mRNA was found at the highest level in the chp and meninges. Furthermore TLR4 transcripts were found spread around the parenchyma. The TLR4 mRNA appeared in isolated cells and around fenestrated capillaries in CVOs like SFO, ME and AP. Additionally TLR4 expression was detected in the ventricular ependyma. The Allen Brain atlas (http://www.brain-map.org) is a database showing all genes expressed in the mouse brain. They have used in situ hybridization to detect the transcripts. In addition to TLRs 1-9 it shows the expression of TLRs 11-13. In particular TLR12 seems to be widely expressed in the brain. PNS The research concerning TLR expression in the peripheral nervous system is not as extensive as the research about the central nervous system. However, some experiments have been performed. TLR4 and the receptor CD14 have been detected at a protein-level with immunohistochemistry in human and rat trigeminal sensory neurons (Wasachi and Hargreaves 2006). Both TLR4 mRNA and protein have been found in the rat nodose ganglion with RT-PCR and Western blot (Hosoi et al. 2005). Constitutive expression of TLR2 protein is detected on human cultured Schwann cells with flow cytometry and in vivo using immunofluorescence staining. The same investigators detected expression of TLR2 in nerve cells using immunofluorescence (Oliviera et al. 2003). TLRs and neurodegeneration Many of the studies concerning TLR expression concerned the role of TLRs in neurodegeneration. Some of their results are summarized as follows: Mixed cell cultures from rat forebrain treated with LPS show loss of microglia, oligodendrocytes and axons. In addition, for neuronal loss to occur microglia is required. Furthermore, mice with a defect TLR4 gene do not show any cell loss, implying that the cell damage is mediated by activation of TLR4 signaling pathways (Lehnardt et al. 2003). TLR2 were found to be involved in neurodegeneration induced by group B Streptococcus. Also in this study microglia seemed to be required. Moreover, the neural loss was indicated to be due to apoptosis as examined by tunel assay (Lehnardt et al. 2006). Cell death in hippocampal areas and the dentate gyrus were observed after treatment with the TLR9 agonist CpG DNA. In addition, microglia seem to be needed for the neural loss in vitro. The neurodegeneration starts in neurites before spreading. TNF-α and iNOS have been found to be involved in neural damage (Iliev et al. 2003). The presence of TLR3 protein was detected with immunohistochemical staining in Purkinje cells in patients with ALS and Alzheimer’s disease (Jackson et al. 2006). White matter from healthy humans and Multiple Sclerosis (MS) patients compared in vivo using immunohistochemistry showed higher TLRs 3 and 4 protein expression levels in MS patients (Bsibsi et al. 2002).

21

Experimental autoimmune encephalomyelitis Experimental autoimmune encephalomyelitis (EAE) is a mouse model of the human disease MS, which is characterized by demyelination. EAE was shown to be induced by several ligands to TLRs like pertussis toxin, mediated by TLR4 (Kerfoot et al. 2004) and mycobacteria and LPS (Hansen et al. 2005)., The hybridization signal of TLR2 was stronger in certain areas like the chp, the leptomeninges under the optic tract, the periamygdaloid cortex and areas lining the cochlear nucleus in mice with EAE as compared with healthy mice. The presence of the LPS receptor CD14 was also observed (Zekki et al. 2002). Higher levels of TLRs 1, 2, 4 and 6-9 were found CNS in mouse with EAE. Mice deficient in TLR9 developed a weaker and more delayed disease than wt mice while mice deficient in MyD88 did not develop the disease at all. Deficiency in TLR2 on the other hand had no effect on EAE development (Prinz et al. 2006). Neuroprotection TLRs are also reported to be involved in neuroprotection. Cultured human astrocytes treated with poly I:C, activating TLR3, induces many neuroprotective molecules (Bsibsi et al. 2006). In addition, treatment with poly I:C suppresses EAE in mice possibly mediated through IFN-β (Touil et al. 2006). Furthermore, mice with Alzheimers’s disease showed a greater level of amyloid β-protein (Aβ) when also having a TLR4 defective gene after stimulation with LPS (Tahara et al. 2006). TLR8 and development Ma et al. (2006) showed that TLR8 could be involved in brain development. As analyzed with Western blot in mouse, TLR8 first appeared at embryonic day 12 and increased until postnatal day 21, when it suddenly decreased. This time period coincides with that of the completion of neurogenesis and axonogenesis. In addition immunohistochemical studies show that the regional localization of TLR8 changes through development. Furthermore, stimulation with the synthetic ligand R-848 to TLR8 inhibits the outgrowth of neurites from cultured neurons.

22

II Experimental investigation In addition to the literature overview, which contained relatively little observations in vivo and from PNS, I also performed some experiments in vivo from both CNS and PNS. Expression of TLRs and signaling molecules in trigeminal ganglia and hippocampus I tested the expression of the genes TLRs 3, 4, 7, 9, IRF3, 5, 7, MyD88, TRAF-6 and RIG-1 with RT-PCR on tissues from trigeminal ganglia (PNS) and hippocampus (CNS). β-actin, which is expressed in all cells, was also tested to bee able to compare RNA levels in the different samples (Figure 6). The tissues I examined contained various cell-types. The tissue from hippocampus contained nerve cells and microglia, astrocytes and oligodendrocytes. Whereas the tissue from trigeminal ganglia contained nerve cells and Schwann cells. The glial cells are more abundant than the nerve cells in both PNS and CNS. I detected all the genes in both hippocampus and trigeminal ganglia (Figure 7 and 8). β-actin L 1 2 3 4 C

Figure 6: Expression of β-actin (263 bp) in trigeminal ganglia and hippocampus. PCR was run for 30 cycles. Lane L contains ladder (100 bp), lane 1 contains trigeminus ganglia sample 1, lane 2 contains trigeminus ganglia sample 2, lane 3 contains hippocampus sample 1, lane 4 contains hippocampus sample 2 and lain C contains control that contained water instead of template TLR3 TLR4 TLR7 TLR9 L 1 2 3 4 C L 1 2 3 4 C 1 2 3 4 C 1 2 3 4 C

a b Figure 7: Expression of TLRs 3 (205 bp), 4 (325 bp), 7 (338 bp) and 9 (339 bp) in trigeminal ganglia and hippocampus. PCR was run for 40 cycles in a and 35 cycles in b. Lane L contains ladder (100 bp), lane 1 contains trigeminus ganglia sample 1, lane 2 contains trigeminus ganglia sample 2, lane 3 contains hippocampus sample 1, lane 4 contains hippocampus sample 2 and lain C contains control that contained water instead of template.

23

MyD88 RIG-1 TRAF-6 IRF3 IRF5 IRF7 L 1 2 3 4 C 1 2 3 4 C L 1 2 3 4 C 1 2 3 4 C 1 2 3 4 C 1 2 3 4 C

a b Figure 8: Expression of MyD88 (315bp), RIG-1 (212bp), TRAF-6 (241bp), IRF3 (293bp), IRF5 (222bp) and IRF7 (336bp)in trigeminal ganglia and hippocampus. PCR was run for 40 cycles in a and 35 cycles in b. Lane L contains ladder (100 bp), lane 1 contains trigeminus ganglia sample 1, lane 2 contains trigeminus ganglia sample 2, lane 3 contains hippocampus sample 1, lane 4 contains hippocampus sample 2 and lain C contains control that contained water instead of template. Expression of TLRs in nerve cells and glia cells in trigeminal ganglia and hippocampus To analyze more specifically the cell-type expressing the TLRs and RIG-1, I dissected areas from hippocampus and trigeminal ganglia with laser containing nerve cells or glial cells respectively (Figure 11 and 12). Thereafter I performed a RT-PCR. I made the dissection twice. In the experiment after the first dissection I detected RIG-1 in all samples, TLR4 in glial cells from hippocampus and in both nerve cells and glial cells from trigeminus ganglia (Figure 9).I could not find TLRs 7 and 9 in any of the samples (Figure 10). In the experiment after the second dissection I detected TLR4 solely in nerve cells and glial cells from PNS and TLRs 7 and 9 exclusively in nerve cells from PNS (Figure 11). β-actin TLR4 RIG-1 L 1 2 3 4 C L 1 2 3 4 C L 1 2 3 4 C

a b c Figure 9: Expression of β-actin (263 bp), TLR4 (325 bp) and RIG-1(212 bp) in hippocampus and trigeminal ganglia after first dissection of areas containing nerve cells or glial cells. PCR was run for 33 cycles in a, 38 cycles b-c. Lane L contains ladder (100 bp), lane 1 contains nerve cells from hippocampus, lane 2 contains glial cells from hippocampus, lane 3 contains nerve cells from trigeminus ganglia, lane 4 contains glial cells from trigeminus ganglia and lane C contains control that contained water instead of template.

24

TLR7 TLR9 1 2 3 4 C 1 2 3 4 C L

Figure 10: Expression of TLRs 7 (338 bp) and 9 (339 bp) in hippocampus and trigeminal ganglia after first dissection of areas containing nerve cells or glial cells. PCR was run for 43 cycles. Lane L contains ladder (100 bp), lane 1 contains nerve cells from hippocampus, lane 2 contains glial cells from hippocampus, lane 3 contains nerve cells from trigeminus ganglia, lane 4 contains glial cells from trigeminus ganglia and lane C contains control that contained water instead of template.

β-actin TLR4 T LR7 TLR9

L 1 2 3 4 C 1 2 3 4 C 1 2 3 4 C 1 2 3 4 C

Figure 11: Expression in hippocampus and trigeminal ganglia of β-actin (263 bp), TLRs 4 (325 bp), 7 (338 bp) and 9 (339 bp) after second dissection of areas containing nerve cells or glial cells. PCR was run for 43 cycles. Lane L contain ladder (100 bp), lane 1 contain nerve cells from hippocampus, lane 2 contain glial cells from hippocampus, lane 3 contain nerve cells from trigeminus ganglia, lane 4 contain glial cells from trigeminus ganglia and C contain control that contained water instead of template.

25

Table 9: Overview of my experiments concerning expression of TLRs 4, 7, 9 and RIG-1 in nerve cells and glial cells in CNS and PNS respectively.1

mRNA ________________________________________________________________________

CNS CNS CNS CNS PNS PNS PNS PNS

Nerve cells

Glial cells

Nerve cells

Glial cells

Nerve cells

Glial cells

Nerve cells

Glial cells

First dissection

First dissection

Second dissection

Second dissection

First dissection

First dissection

Second dissection

Second dissection

β-actin

++ + (+) - ++ + + +

RIG-1

+ + Not tested

Not tested

+ + Not tested

Not tested

TLR4

- + + - - (+) + + + +

TLR7

- - - - - - + -

TLR9 - - - - - - + - 1 Levels of expression are roughly estimated from fragment sizes and normalized to β-actin. Levels are shown with (+), +, ++.

26

Discussion TLR expression in the nervous system Thirteen TLRs are found in mammals of which TLR10 is not present in mice and TLR11 is not present in humans. Many recent studies concerning TLRs in the CNS show that most of them are expressed in the brain. TLRs 1-9 are all expressed in human brain (Table 2, 4, 6 and 7) and in addition to TLRs1-9, TLR13 is detected in mouse brain (McKimmie et al. 2005). TLR10 has not been found so far in the human brain. The presence of TLRs 11 and 12 have not been studied in the nervous system since they in addition to TLR13 are the most recently discovered TLRs. Nevertheless, the Allen Brain Atlas (http://www.brain-map.org), which is a database with all genes expressed in the mouse brain, show the expression of TLRs 11 and 12. Microglia is the cell-type with the broadest TLR expression (Table 1 and 2), which is not surprising since microglia have many immune functions (Aloisi et al. 2001). The TLR expression in astrocytes is as broad as the expression in microglia in mice (Table 3) whereas in humans the expression is narrower (Table 4). The TLR expression in human neurons is not fully studied. Only TLRs 1-4 are detected in human neurons (Table 6), but the presence of the others has not been analyzed. Mouse neurons have been studied more extensively and in addition to TLRs 1-4 also TLR6 is found. Also TLR7 protein could be detected after infection with the parasite Mesocestoides corti (Table 5). Oligodendrocytes contain the fewest expressed TLRs of all CNS cell types (Table 7). Most experiments have been performed in vitro, so the actual TLR expression in vivo remains to be clarified. There are some contradictory studies on the TLR expression in particular cell-types (Table 1-5). There could be many reasons for this. Different methods differ in sensitivity. Also the same method can vary in detection depending on the antibody used or the primer in a PCR. Furthermore, cultured cells could show different expression even though they are of the same cell-type, depending on where in the brain they have their origin and their age as well as the culture conditions employing various factors in the media and surface coatings. There is also a study (Ma et al. 2006) showing that TLR8 expression changes during development. In addition, the level of expression differs between the studies. This could also be a result of different strains of mice being tested, since differences in TLR expression between mice strains has been previously observed (McKimmie et al. 2005). The level of expression also seems to differ between individuals at least in humans (Jack et al. 2005). TLR expression in the brain has been particularly abundant in different areas in the CVO, the chp and the leptomeninges. These areas are more exposed to factors in the circulating blood than the rest of the brain, since they lack a BBB. Experiments In nervous tissue containing mixed cell-types I could find transcripts encoding all examined mRNAs. These were TLRs 3, 4, 7 and 9, MyD88, TRAF-6, IRFs 3, 5 and 7 and RIG-1.This is in accordance with published studies in the CNS, since both microglia and astrocytes express TLRs 1-9 in mice in vitro (Table1 and 3). My studies show that these in vitro observations are valid in

27

vivo. MyD88 is an adaptor molecule used by all TLRs except TLR3, while IRF3 is involved in TLR3 signaling and IRF7 in TLR7 and TLR9 signaling. TRAF-6 is involved in all TLR signaling pathways. IRF5 seems to be involved in TLR signaling by at least TLRs 3, 4, 5 and 7 (Takaoka et al. 2005). RIG-1 is another pattern recognition receptor residing in the cytoplasm (Yoneyama et al. 2004). To further analyze which cell-types express the various TLRs, I also tested transcripts of TLRs in tissue containing either neurons or glial cells. By comparing fragment sizes from the PCR and normalize them to β-actin it seems like the TLR4 expression level is higher in glial cells than nerve cells in both CNS and PNS (Table 9). Although I did not detect TLR4 in nerve cells from hippocampus, it could still have been expressed but not detected due to low expression levels in nerve cells. Likewise the expression level in nerve cells from PNS was low (Table 9). Expression of TLR4 in both nerve cells and glial cells was found in previous studies (Table 1-7). After the second dissection the neurons in PNS expressed more TLRs than the neurons in CNS. The expression of TLRs 7 and 9 could not be found in the neurons in CNS (Figure 10) but in the neurons in PNS (Figure 11). The lack of TLRs 7 and 9 in CNS nerve cells is consistent with previous studies in vitro. TLR7 protein has been detected in mouse neurons in the CNS after exposure to M. corti (Table 5). TLR7 recognizes ssRNA from viruses like influenza (Uematsu and Akira 2006). The two experiments I performed on tissue containing either neurons or glial cells did not give the same results. In the second experiment I did not purify enough RNA from the samples from CNS and therefore I did not detect any of the TLRs there. Furthermore in the second experiment I detected TLRs in PNS that I did not detect in the first experiment. It is difficult to judge the amount of RNA from PNS from the two different experiments (Figure 9 and 11). The photographs have different levels of exposure and the compounds used for staining are different. If there was more RNA from PNS in the second experiment it could be the reason for the detection of TLRs 7 and 9. Otherwise there could have been some mistake during the experimental procedure or individual differences between the mice in the two experiments. Although I found all TLRs in the mixed cell-type samples I could not find all of them in the samples with either neurons or glial cells. In the experiments with mixed cell-types I had a much higher RNA concentration than in the two experiments with either neuron or glial cell areas. In addition nerve cells contain more RNA than glial cells. Even though I cut out areas of similar sizes of neurons and glial cells the RNA content was higher in the neuron areas. In particular TLRs present in glial cells could have failed detection for this reason. Another pattern recognition receptor recognizing dsRNA (Yoneyama et al. 2004) and ssRNA bearing 5’phosphates (Pichlmair et al. 2006) is RIG-1. In contrast to TLRs 3 and 7 which recognize viruses and are localized in endosomes, RIG-1 is localized in the cytoplasm. Therefore it could act as a complement to TLRs 3 and 7. I found RIG-1 in both nerve cell areas and glial cell areas in trigeminal ganglia and hippocampus. The presence of RIG-1 in nerve cells from CNS is in accordance with a previous study in humans (Préhaud et al. 2005).

28

Expression of TLRs in CNS versus PNS The hypothesis for my project was that there should be more TLRs in nerve cells in the PNS than in the CNS. This could not be judged from the literature overview since there are not enough studies concerning TLR expression the PNS. However, when analyzing my experiments it is likely that there are TLRs expressed in nerve cells from PNS which are not present in nerve cells from CNS. At least there is a difference between the systems. Future perspectives Since the TLRs were discovered quite recently there is still much not fully known concerning them, like their signaling, recognition of pathogens, expression patterns and their role in diseases. To verify my results I would make further studies on TLRs 7 and 9 expressions in nerve cells in ganglia using quantitative PCR and immunohistochemistry. It would be interesting to do more studies on TLR expression in the PNS to obtain more information on their role in infection. In addition the presence of TLRs 11, 12 and 13 have not been tested extensively yet.

29

Materials and Methods Mice Male C57/B6 mice were used in this study. All experiments were conducted according to institutional guidelines and ethics committee approval. RNA purification and Reverse Transciptase - PCR Tissue samples containing mixed cell-types The mice were anesthetized with CO2 and sacrificed and tissue from hippocampus and trigeminal ganglia were taken out and directly put on dry ice. Total RNA was purified using RNeasyTM Mini Kit (Qiagen, GmbH, Hilden, Germany). The manufacturer’s protocol was followed. Rotor-stator homogenization was chosen as a homogenization method. The centrifugation step 5 was omitted And in step 8 the sample was allowed to incubate for 5 min before centrifugation. A final volume of 40 μl was obtained. All RNA samples were diluted with RNAse free water to contain 50.4 ng/μl of RNA. TLR3 and IRF7 PCR were run on undiluted templates with the trigeminus ganglia sample 1 containing 179.04 ng/μl, sample 2 containing 50.4 ng/μl, hippocampus sample 1 containing 348 ng/μl and sample 2 containing 306.24 ng/μl. DNA was digested using deoxyribonuclease 1, amplification grade (Invitrogen, Groningen, The Netherlands) and the manufactures protocol was followed. RNA was converted to cDNA using SuperScript II Reverse Transcriptase (Invitrogen, Groningen, The Netherlands) and the manufacturers protocol was followed. The mixture was not heated in step 2, instead all compounds were mixed at the same time. In addition, only 0.5 μl of SuperScript II RT was added and RNaseOUT was not used. Prior to the PCR, the samples were diluted five times in RNAse free water. A PCR-mix was made following the protocol provided with the Titanium Taq Polymerase PCR kit (Clontech Laboratories Inc., Mountain View, California, USA) to a final volume of 25 μl. (Table 10) Table 10: Primers .Gene Primer sequence (5’-3’) Length (bp) TLR3 Forward-ATATGCGCTTCAATCCGTTC 205 Reverse-CAGGAGCATACTGGTGCTGA TLR4 F – GCAGAAAATGCCAGGATGAT 325

R – AGAGGTGGTGTAAGCCATGC

TLR7 F – TCTGCGAGTCTCGGTTTTCT 338 R – TTGTCTGTGCAGTCCACGAT TLR9 F – ACCCTGGTGTGGAACATCAT 339

R – GTTGGACAGGTGGACGAAG

30

MyD88 F – CCCACAAACAAAGGAACTGG 315 R – AGGCTGAGTGCAAACTTGGT TRAF-6 F – TTAGCTGCTGGGGTGTCTCT 241

R – ATCGTAGCCCTGGATCTCCT

RIG-1 F – GATTCTGGACCCCACCTACA 212 R - TGGCTTCACAAAGTCCACAG

IRF3 F – CTGGCTAGAGCATGGAAACC 293 R – AGCAGCTAACCGCAACACTT

IRF5 F – CAGGTGAACAGCTGCCAGTA 222 R – GCTTTTGTTAAGGGCACAGC

IRF7 F – AGCTCCCAGATCAGAAGCAG 336 R – TCACCAGGATCAGGGTCTTC

β-actin F – AAAAACTGGAACGGTGAAGG 263 . R – CAGAAGCAATGCTGTCACCT . Only 0.25 μl of Titanium Taq Polymerase was used. Cycler conditions were 94°C for 2 min and 35 or 40 cycles of 94°C for 30 s and 68°C for 1 min and then 72°C for 7 min and 4°C for ∞. TLRs 4, 7, 9, MyD88 and RIG-1 were run for 35 cycles whereas TLR3, TRAF-6, IRF3, IRF5 and IRF7 were run for 40 cycles. Tissue samples containing either neurons or glial cells The mice were anesthetized with CO2 and sacrificed and brain and trigeminal ganglia were taken out and directly put on dry ice. They were cut in 12 μm sections which were put on membrane slides (PEN-Membrane 2.0 μm, 50 pcs, Leica Microdissect GmbH). The tissues were stained with Toluidine Blue. Later areas from hippocampus and trigeminal ganglia containing either neurons or glial cells were cut out using Laser Microdissection (Figure 11 and 12).

Figure 11: Picture on hippocampus. The white lines are areas taken out, the lower containing nerve cells while the higher containing glial cells.

31

a b Figure 12: Picture on ganglion before (a) and after (b) nerve cells have been cut out. The black square in b shows where the glial cells could be cut out. Immediately after the areas had been cut out 75 μl RLT buffer (Qiagen, GmbH, Hilden, Germany) was added and the tubes were vortexed to homogenize the conttents. Then the RNeasyTM Micro protocol for total RNA isolation from microdissected cryosections was followed. Final volumes of 8 μl in the first experiment and 14 μl in the second experiment were obtained. The amount of RNA could not be determined since the concentrations were too low to detect with a spectrophotometer. Instead all purified RNA was converted to cDNA, which was run in a PCR. Both procedures were performed in the same way as previously described for the mixed cell-types. Only the number of cycles in the PCR differed. The whole procedure was done twice. In the first experiment β-actin was run for 33 cycles and TLR4 and RIG-1 for 38 cycles. In the second experiment β-actin and TLRs 4, 7 and 9 were run for 43 cycles. Agarose gel electrophoresis 2% agarose (Sigma) gels were made with TAE-buffer (40mM Tris, 20mM acetic acid and 1mM EDTA at pH = 8.3 (Biorad)). 5 μl 100 bp ladder (Invitrogen) was used. 10x Blue Juice (Invitrogen) and sample were mixed before being added to the vales. TAE-buffer was covering the gels which were run at 110 V. Afterwards gels in Figure 6-9 were stained with 10 μl CyberGold (Invitrogen) in 100 ml TAE-buffer for 20 minutes and the gel in Figure 10 was stained with 10 μl GelRedTM nucleic acid stain (Biotium Inc) in 100 ml TAE-buffer for 20 minutes and visualized under UV-light. Acknowledgements I would like to thank my supervisor Krister Kristensson for letting me do this project in his lab and his valuable help and comments on my work. I am also grateful to Mikael Nyhage for showing me everything in the lab and answering my questions. Special thanks to Margareta Widing for teaching how to use the cryostat. Finally, I would like to thank everyone else in the lab for their help.

32

References Alexopoulou L., Czopik Holt A., Medzhitov R. and Flavell R. 2001. Recognition of double-stranded RNA and activation of NF-ĸB by Toll-like receptor 3. Nature. 413:732-8. Allen Brain Atlas. http://www.brain-map.org Date visited 2006-12-20 Aloisi F. 2001. Immune Function of Microglia. Glia. 36:165-179 Berger A. 2000. Th1 and Th2 responses: what are they? British medical journal. 321: 424 Beutler B., Jiang Z., Georgel P., Crozat K., Croker B., Rutschmann S., Du X. and Hoebe K. 2006. Genetic analysis of host resistance: Toll-like receptors and immunity at large. Annual Review of Immunology. 24: 353-389 Bowman C., Rasley A., Tranguch S. and Marriott I. 2003. Cultured Astrocytes Express Toll-Like Receptors for Bacterial Products. Glia. 43:281-291 Bsibsi M., Persoon-Deen C., Verwer R., Meeuwsen S., Ravid R. and van Noort J. 2006. Toll-like Receptor 3 on Adult Human Astrocytes Triggers Production of Neuroprotective Mediators. Glia. 53: 688-695 Bsibsi M., Ravid R., Gveric D. And van Noort J. 2002. Broad Expression of Toll-like Receptors in the Human Central Nervous System. Journal of Neuropathology and Experimental Neurology. 61:1013-1021 Caron G., Duluc D., Frémaux I., Jeannin P., David C., Gascan H. and Delneste Y. 2005. Direct stimulation of human T cells via TLR5 and TLR7/8: flagellin and R-848 up-regulate profileration and IFN-γ production by memory CD4+ T cells. The Journal of Immunology. 175: 1551-1557 Carpentier P., Begolka W., Olson J., Elhofy A., Karpus W. And Miller S. 2005. Differential Activation of Astrocytes by Innate and Adaptive Immune Stimuli.Glia. 49:360-374 Chakravarty S.and Herkenham M. 2005. Toll-Like Receptor 4 on Nonhematopoietic Cells Sustains CNS Inflammation during Endotoxemia, Independent of Systemic Cytokines. The Journal of Neuroscience. 25:1788-1796 Dalpke A., Schäfer M., Frey M., Zimmermann S., Tebbe J., Weihe E. And Heeg K. 2002. Immunostimulatory CpG-DNA Activates Murine Microglia. The Journal of Immunology. 168: 4854-4863 Farina C., Krumbholz M., Giese T., Hartmann G., Aloisi F. and Mein E. 2004. Preferential expression and function of Toll-like receptor 3 in human astrocytes. Journal of Neuroimmunology. 159:12-19 Flint S.J., Enquist L.W., Racaniello V.R. and Skalka A.M. 2004. Principles of Virology: Molecular biology, Pathogenesis and control of Animal Viruses. 2nd edition. ASM Press, Washington D.C. Germain R. 2004. An innately interesting decade of research in immunology. Nature Medecine. 10:1307-1320 Hansen B., Hussain R., Lovett-Racke A., Thomas J. and Racke M. 2005. Multiple toll-like receptor agonists act as potent adjuvants in the induction of autoimmunity. Journal of Neuroimmunology. 172:94-103 Hickey W. 2001. Basic Principles of Immunological Surveillance of the Normal Central Nervous System. Glia. 36: 118-124 Hoffmann J.2003. The immune response of Drosophila. Nature.426:33-38 Hosoi T., Okuma Y., Matsuda T. and Nomura Y. 2004. Novel pathway for LPS-induced afferent vagus nerve activation: Possible role of nodose ganglion. Autonomic Neuroscience. 120:104-107

33

http://www.brain-map.org/

Iliev A., Stringaris A., Nau R. and Neumann H. 2003. Neuronal injury mediated via stimulation of microglial toll-like receptor-9 (TLR9). The FASEB Journal. 18:412-414 Jack C., Arbour N., Manusow J., Montgrain V., Blain M., McCrea E., Shapiro A. and Antel J. 2005. TLR Signaling Tailors Innate Immune Responses in Human Microglia and Astrocytes. The Journal of Immunology. 175:4320-4330 Jackson A., Rossiter J. and Lafon M. 2006. Expression of Toll-like receptor 3 in the human cerebellar cortex in rabies, herpes simplex encephalitis, and other neurological diseases. Journal of NeuroVirology. 12:229-234 Jung D., Lee H., Jung B., Ock J., Lee M., Lee W. and Suk K. 2005. TLR4, but not TLR2, signals autoregulatory apoptosis of cultured microglia: a critical role of IFN-β as a decision maker. The Journal of Immunology. 174: 6467-6476 Kawai T. and Akira S. 2006. TLR signaling. Cell death and differentiation. 13: 816-825 Kawai T., Sato S., Ishii K., Coban C., Hemmi H., Yamamoto M., Terai K., Matsuda M., Inoue J., Uematsu S., Takeuchi O. and Akira S. 2004. Interferon-α induction through Toll-like receptors involves a direct interaction of IRF-7 with MyD88 and TRAF6. Nature Immunology. 5: 1061-1068 Kerfoot S., Long E., Hickey M., Andonegui G., Lapointe B., Zanardo R., Bonder C., James W., Robbins S. and Kubes P. 2004. TLR4 contributes to disease-inducing mechanisms resulting in central nervous system autoimmune disease. The Journal of Immunology. 173:7070-7077 Kielian T., Esen N. and Bearden E. 2005.Toll-like Receptor 2 Is Pivotal for Recognition of S. aureus Peptidoglycan But Not Intact Bacteria by Microglia. Glia.49:567-576 Konat G., Kielian T. and Marriott I. 2006. The role of Toll-like receptors in CNS response to microbial challenge. Journal of Neurochemistry. 99: 1-12 Laflamme N., Soucy G. and Rivest S. 2001. Circulating cell wall components derived from gram-negative, not gram-positive, bacteria cause a profound induction of the gene-encoding Toll-like receptor 2 in the CNS. Journal of Neurochemistry. 79:648-657 Laflamme N. and Rivest S. 2001. Toll-like receptor 4: the missing link of the cerebral innate immune response triggered by circulating gram-negative bacterial cell wall components. FASEB Journal. 15:155-163 Lafon M., Megret F., Lafage M. and Prehaud C. 2006. The Innate Immune Facet of Brain. Journal of Molecular Neuroscience. 29: 185-194 Lemaitre B., Nicolas E., Michaut L., Reichhart J. and Hoffmann J.1996.The Dorsoventral Regulatory Gene Cassette spätzle/Toll/cactus Controls the Potent Antifungal Response in Drosophila Adults. Cell.86:973-983 Lehnardt S., Henneke P., Lien E., Kasper D., Volpe J., Bechmann I., Nitsch R., Weber J., Golenbock D. And Vartanian T. 2006. A Mechanism for Neurodegeneration Induced by Group B Streptococci through Activation of the TLR2/myD88 Pathway in Microglia. The Journal of Immunolgy. 177:583-592 Lehnardt S., Lachance C., Patrizi S., Lefebvre S., Follett P., Jensen F., Rosenberg P., Volpe J. and Vartanian T. 2002. The Toll-Like Receptor TLR4 Is Necessary for Lipopolysaccharide-Induced Oligodendrocyte Injury in the CNS. The Journal of Neuroscience. 22:2478-2486 Lehnardt S., Massillon L., Follett P., Jensen F., Ratan R., Rosenberg P., Volpe J. And Vartanian T. 2003. Activation of innate immunity in the CNS triggers neurodegeneration through a Toll-like receptor 4-dependent pathway. PNAS. 100: 8514-8515

34

Ma Y., Li J., Chiu I., Wang Y., Sloane J., Lu J., Kosaros B., Sidman R., Volpe J. and Vartanian T. 2006. Toll-like receptor 8 functions as a negative regulator of neurite outgrowth and inducer of neuronal apoptosis. Journal of cell biology. 175:209-215 McKimmie C. and Fazakerley J. 2005. In response to pathogens, glial cells dynamically and differentially regulate Toll-like receptor gene expression. Journal of Neuroimmunology. 169: 116-125 McKimmie C., Johnson N., Fooks A. and Fazakerley J. 2005 Viruses selectively upregulate Toll-like receptors in the central nervous system. Biochemical and Biophysical Research Communications 336: 925-933 Medzhitov R., Preston-Hurlburt P. and Janeway C. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature. 338:394-397 Michelsen K., Aicher A., Mohaupt M., Hartung T., Dimmeler S., Kirschning C. and Schumann R. 2001. The role of Toll-like receptors (TLRs) in bacteria-induced maturation of murine dendritic cells (DCs). The Journal of Biological Chemistry. 276: 25680-25686 Mishra B., Mishra P. and Teale J. 2006. Expression and distribution of Toll-like receptors in the brain during murine neurocysticercosis. Journal of Neuroimmunology.181:46-56 Naka T., Fujimoto M., Tsutsui H. and Yoshimura A. 2005. Negative Regulation of Cytokine and TLR Signalings by SOCS and Others. Advances in Immunology. 87:61-103 Nguyen M., Julien J. and Rivest. 2002. Innate immunity: the missing link in neuroprotection and neurodegeneration. Nature Review Neuroscience. 3:216-227 Nishimura M., Naito S. 2005. Tissue-Specific mRNA Expression Profiles of Human Toll-Like Receptors and Related Genes. Biological and Pharmaceutical Bulletin. 28:886-892 Oliviera R., Ochoa M., Sieling P., Rea T., Rambukkana A., Sarno E. And Modlin R. 2003. Expression of Toll-Like Receptor 2 on Human Schwann Cells: a Mechanism of Nerve Damage in Leprosy. Infection and Immnity. 71: 1427-1433 Olson J. and Miller S. 2004. Microglia Initiate Central Nervous System Innate and Adaptive Immune Responses through Multiple TLRs. The Journal of Immunology. 173:3916-3924 Opal S. and Huber C. 2002. Bench-to-bedside review: Toll-like receptors and their role in septic shock. Critical Care. 6:125-36 Pandey S. and Agrawal D. 2006. Immunobiology of Toll-like receptors: Emerging trends. Immunology and Cell Biology. 84:333-341 Pasare C. and Medzhitov R. 2004. Toll-like receptors: linking innate and adaptive immunity. Microbes and Infection. 6: 1382-1387 Perry A., Chen G., Zheng D., Tang H. and Cheng G. 2005. The host type 1 interferon response to viral and bacterial infections. Cell Research. 15:407-422 Pichlmair A., Schulz C., Tan C., Näslund T., Liljeström P., Weber F. and Sousa C. 2006. RIG-1-mediated antiviral responses to single-stranded RNA bearing 5’-phosphates. Science. 314: 997-1001 Préhaud C., Mégret F., Lafage M. and Lafon M. 2005. Virus Infection Switches TLR-3-Positive Human Neurons To Become Strong Producers of Beta Interferon. Journal of Virology. 79:12893-12904

35

Prinz M., Garbe F., Schmidt H., Mildner A., Gutcher I., Wolter K., Piesche M., Scroers R., Weiss E., Kirschning C., Rochford C., Brück W. And Becher B. 2006. Innate immnity mediated by TLR9 modulates pathogenecity in an animal model of multiple sclerosis. The Journal of Clinical Investigation. 116: 456-464 Rasley A., Anguita J. and Marriott I. 2002. Borrelia burgdorferi induces inflammatory mediator production by murine microglia. The Journal of Neuroimmunology. 130:22-31 Ritter M., Mennerich D., Weith A. and Seither P. 2005. Characterization of Toll-like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll-like receptors, adaptor proteins and inflammatory response. Journal of Inflammation. 2:16 Rivieccio M., Suh H., Zhao Y., Zhao M., Chin K., Lee S. and Brosnan C. 2006. TLR3 Ligation activates antiviral in human fetal astrocytes: a role for viperin/cig5. the Journal of Immunology. 177: 4735-4741 Rock F., Hardmiman., Timans J., Katlein R. and Bazan J. 1998. A family of human receptors structurally related to Drosophila Toll. PNAS. 95: 588-593 Schnare M., Barton G., Holt A., Takeda K., Akira S. And Medzhitov R. 2001. Toll-like receptors control activation of adaptive immune responses. Nature Immunology. 2:947-950 Schreiner B., Voss J., Wischhusen J., Dombrowski Y., Steinle A., Lochmuller H., Dalakas M., Melms A. And Wiendl H. 2005. Expression of toll-like receptors by human muscle cells in vitro and in vivo: TLR3 is highly expressed in inflammatory and HIV mopathies, mediates IL-8 release, and upregulation of NKG2D-ligands. The FASEB Journal. 20(1): 118-20 Scumpia P., Kelly K., Reeves W. and Stevens B. 2005. Double-stranded RNA signals antiviral and inflammatory programs and dysfunctional glutamate transport in TLR3-expressing astrocytes. Glia. 52: 153-162 Tahara K., Kim H., Jin J., Maxwell A., Ling L. and Fakuchi K. 2006. Role of toll-like receptor signalling in Aβ uptake and clearance. Brain 129:3006-3019

Takaoka A., Yanai H., Kondo S., Duncan G., Negishi H., Mizutani T., Kano S., Honda K., Ohba Y., Mak T. and Taniguchi T. 2005. Integral role of IRF-5 in the gene induction programme activated by Toll-like receptors. Nature. 434: 243-249

Takeda K., Tsuneyasu K. and Akira S. 2003. Toll-like receptors. Annual Reviews Immunology.21:335-76 Takeshita S., Takeshita F., Haddad D., Janabi N and Klinman D. 2001. Activation of microglia and astrocytes by CpG oligodeoxynucleotides. Glial Cells. 12: 3029-3032 Touil T., Fitzgerald D., Zhang G., Rostami A. and Gran B. 2006. TLR3 stimulation suppresses experimental autoimmune encephalomyelitis by inducing endogenous IFN-β. The Journal of Immunology. 177:7505-7509 Town T., Jeng D., Alexopoulou L., Tan J. and Flavell R. 2006. Microglia recognize double-stranded RNA via TLR3. The Journal of Immuonology. 176: 3804-3812 Uematsu S. and Akira S. 2006. Toll-like receptors and innate immunity. Journal of Molecular Medicine 84:712-725 Wadachi R. and Hargreaves K. 2006. Trigeminal Nociceptors Express TLR-4 and CD14: a Mechanism for Pain due to Infection. Journal of Dental Research. 85:49-53 Yoneyama M., Kikuchi M., Natsukawa T., Shinobu N., Imaizumi T., Miyagishi M., Taira K., Akira S. and Fujita T. 2004. The RNA helicase RIG-1 has an essential function in double-stranded RNA-induced innate antiviral responses. Nature Immunology. 5:730-737

36

Zarember K. and Godowski P. 2002. Tissue Expression of Human Toll-Like Receptors and Differential Regulation of Toll-Like Receptor mRNAs in Leukocytes in Response to Microbes, Their Products and Cytokines. The Journal of Immunology. 168:554-56 Zekki H., Feinstein D. and Rivest S. 2002. The clinincal course of experimental autoimmne encephalomyelitis is associated with a profound and sustained transcriptional activation of the genes encoding toll-like receptor 2 and CD14 in the mouse CNS. Brain Pathology. 12: 308-319 Zhang Z., Guo K. and Schluesener H. 2004. The immunostimulatory activity of CpG oligonucleotides on microglial N9 cells is affected by a polyguanosine motif. The Journal of Neuroimmunology. 161: 68-77

37

Documents

Expression of Toll-like receptors in the nervous system...Summary Toll-like receptors (TLRs) are a part of the innate immune system, which is the first line of defense to pathogens