Expression of X-linked genes in deceased neonates and surviving cloned female piglets

MOLECULAR REPRODUCTION AND DEVELOPMENT 75:265–273 (2008)

Expression of X-Linked Genes in DeceasedNeonates and Surviving Cloned Female PigletsLE JIANG,1 LIANGXUE LAI,2 MELISSA SAMUEL,2 RANDALL S. PRATHER,2

XIANGZHONG YANG,1 AND X. CINDY TIAN1*1Department of Animal Science and Center for Regenerative Biology, University of Connecticut, Storrs, Connecticut2Division of Animal Science, University of Missouri-Columbia, Columbia, Missouri

ABSTRACT Animal cloning through somaticcell nuclear transfer (NT) is very inefficient, probablydue to insufficient reprogramming of the donor nuclei,which in turn would cause the dysregulation ofgene expression. X-Chromosome inactivation (XCI) isa multi-step epigenetic process utilized by mammals toachieve dosage compensation in females. Our aim wasto determine if any dysregulation of X-linked genes,which would be indicative of unfaithful reprogrammingof donor nuclei, was present in cloned pigs. Realtime reverse transcription polymerase chain reaction(RT-PCR) was performed to quantify the transcriptlevels of five X-linked genes, X inactivation-specifictranscript (XIST), TSIX (the reverse spelling ofXIST), hypoxanthine guanine phosphoribosyltrans-ferase 1 (HPRT1), glucose-6-phosphate dehydro-genase (G6PD), V-raf murine sarcoma 3,611 viraloncogene homolog 1 (ARAF1), and one autosomalgene, alpha-1 type IV collagen (COL4A1) in majororgans of neonatal deceased and surviving femalecloned pigs as well as their age-matched control pigsfrom conventional breeding. Aberrant expression levelof these genes was prevalent in the neonatal deceasedclones, while it was only moderate in cloned pigs thatsurvived after birth. These results suggest a correlationbetween the viability of the clones and the normality oftheir gene expression and provide a possible explana-tion for the death of a large portion of cloned animalsaround birth. Mol. Reprod. Dev. 75: 265–273,2008. � 2007 Wiley-Liss, Inc.

Key Words: gene expression; porcine; X chromo-some; nuclear transfer

INTRODUCTION

Since the creation of Dolly, the first mammal clonedfrom a differentiated adult somatic cell, production oflive offspring through nuclear transfer (NT) of somaticcells has been successful in a variety of species, rangingfrom small laboratory mice to large domestic animals(Wilmut et al., 1997;Cibelli et al., 1998;Kato et al., 1998;Wakayama and Yanagimachi, 1999; Betthauser et al.,2000; Kubota et al., 2000; Onishi et al., 2000; Polejaevaet al., 2000; Wakayama et al., 2000; Shin et al., 2002;Galli et al., 2003). Somatic cell NT revealed the

extraordinary ability of the oocyte to reprogram thedifferentiated somatic genome to a totipotent state(Hochedlinger and Jaenisch, 2002; Eggan et al., 2004).However, little is known about this reprogrammingprocess, and the overall success rate of animal cloningusing somatic cells remains very low across differentanimal species, likely due to insufficient epigeneticreprogramming. Faulty or incomplete epigenetic re-programming has been observed in different stages ofdevelopment (Kang et al., 2001a; Cezar et al., 2003;Mann et al., 2003). Even in cloned animals that surviveto term, different aspects of epigenetic abnormalities areevident, although the majority of these animals appearto be healthy and normal (Xue et al., 2002; Archer et al.,2003; Zhang et al., 2004).

Pigs have been regarded as promising donors forxenotransplantation and attempts have been made togenetically modify the porcine genome through somaticcell NT in order to make the porcine organs immuno-logicallymore compatible to human (Dai et al., 2002; Laiet al., 2002; Ramsoondar et al., 2003; Kolber-Simondset al., 2004). The production of pigs throughNThas beenparticularly difficult, probably due to the inefficienciesof in vitro oocyte maturation and embryo culture, andthe necessity for at least four good-quality embryosto establish a pregnancy. Consequently, few clonedoffspring are available for comparison of gene expres-sion to control pigs from conventional reproduction. Todate, there has been only one report examiningepigenetic reprogramming in full-term cloned pigs;Archer et al. (2003) found abnormal CpG methylationin a repetitive region in adult clones. Despite theavailability of various studies on clonedmice and bovinecalves, epigenetic reprogramming patterns found in onespecies may not be the same in others. For instance,the abnormal DNA demethylation patterns observed in

� 2007 WILEY-LISS, INC.

Grant sponsor: NIH; Grant number: R01 RR013438; Grant sponsor:USDA.

*Correspondence to: X. Cindy Tian, 1392 Storrs Road, Storrs, CT06269-4243. E-mail: [email protected]

Received 2 November 2006; Accepted 19 March 2007Published online 1 May 2007 in Wiley InterScience(www.interscience.wiley.com).DOI 10.1002/mrd.20758

cloned bovine andmouse embryoswere absent in clonedporcine embryos (Kang et al., 2001a,b).

The mammalian X chromosome contains more than1,000 genes and many are house-keeping genes (http://ghr.nlm.nih.gov/chromosome¼X). X-chromosome inac-tivation (XCI) is a biological process utilized by mam-mals to ensure equal expression of X-linked genesbetween males and females (Lyon, 1961). The inactiveX chromosomes in the donor cell requires reactivation/reprogramming during NT and provides a verygood marker for reprogramming studies. Interestingly,aberrant patterns of X chromosome inactivation werediscovered in bovine clones (Xue et al., 2002), while incloned mice both relatively normal (Eggan et al., 2000)and abnormal XCI patterns (Senda et al., 2004; Nolenet al., 2005) have been reported. In order to investigatethe normality of XCI in cloned pigs, we selected fiveX-linked genes and one ubiquitous autosomal gene tocompare their expression levels in major organs ofcloned piglets and age-matched controls by quantitativereal time real time reverse transcription polymerasechain reaction (RT-PCR). These genes are: (1) theuntranslated X inactivation-specific transcript (XIST),which resides in the X-inactivation center (XIC) andserves as the master regulatory switch for X chromo-some inactivation (Pennyet al., 1996); (2) thenon-codingantisense mRNA of XIST, TSIX (the reverse spelling ofXIST), which regulates both imprinted and randomXCI through modification of chromatin structure inthe mouse (Lee, 2000; Sado et al., 2005); (3) hypox-anthine guanine phosphoribosyltransferase 1 (HPRT1),a house-keeping gene on X-chromosome and its defi-ciency causes Lesch–Nyhan Syndrome in humansresulting symptoms such as gouty arthritis and kid-ney/bladder stones; (4) glucose-6-phosphate dehydro-genase (G6PD), an enzyme involved in the hexosemonophosphate pathway and its deficiency in theembryonic tissues impairs the development ofthe placenta, causing the death of the embryo (Longoet al., 2002); (5) V-raf murine sarcoma 3,611 viraloncogene homolog 1 (ARAF1), amember of the raf proto-oncogene superfamily, which encodes cytoplasmic pro-tein serine/threonine kinases and plays important rolesin cell growth and development (Lee et al., 1994); and (6)alpha-1 type IV collagen (COL4A1), located on porcinechromosome 11, when mutated causes vascular defectsin mice followed by porencephaly in some mutants(Gould et al., 2005). We found severe dysregulatedexpression of these genes in newborn deceased clonedpiglets and moderate dysregulation in the survivingclones when compared to their respective age-matchedcontrols.

MATERIALS AND METHODS

Piglets and Sample Collection

All pigs in this study were females and fell in two agegroups. Pigs in Group 1 were provided by PPLTherapeutics, Inc. and included six cloned pigs thatdied at or shortly after birth, and three controls from

conventional reproduction that were healthy at birthand sacrificed for tissue collection. Four of the six NT-derived piglets were transgenic with one allele ofthe porcine a1,3-galactosyltransferase (a1,3GT) geneexperimentally disrupted in the donor cells. The experi-mental protocols for knocking out this gene andgenerating these piglets have been described previously(Dai et al., 2002). The gestation period of thesepigs ranged from 115 to 121 days. Minor phenotypicabnormalities, such as curled toes, were observed inthree of the six cloned newborn pigs. These phenotypeshave been observed occasionally in cloned piglets, andare not necessarily lethal. Piglets with these kinds ofminor abnormalities have survived post-weaning andappeared to develop normally. For sample collection,deceased piglets were weighed, and tissues from majororgans (heart, lung, liver, kidney, brain, spleen) werecollected. Group 2 included seven cloned pigs derivedfrom a single donor cell line and five age-matchedcontrols. All pigs in Group 2 were generated atUniversity of Missouri-Columba and were euthanizedat 1 month of age for the collection of tissues from thesame six major organs. Tissues were snap frozen inliquid nitrogen and stored at �808C until analysis.Animal handling and experimentation were in accor-dance with the National Research Council’s publication‘‘Guide for the Care and Use of Laboratory Animals’’and approved by Institutional Animal Care and UseCommittees at University of Missouri-Columbia and anequivalent organization at PPL Therapeutics, Inc.(currently Revivicor, Inc., Blacksburg, VA).

RNA Preparation and ReverseTranscription (RT)

Total RNA from dissected tissues was extracted usingthe RNeasy mini kit (Qiagen, Valencia, CA). RNA wasthen treated with the DNA-free Kit (Ambion, Austin,TX) to remove any possible DNA contamination. Thecomplete removal of DNA contamination was confirmedby the absence of amplification of PCR products after40 cycles using treatedRNAasa template in the absenceof RT. RNA was then quantified by absorbance at 260/280 nm using a spectrophotometer. Before RT, RNAquality was examined by ratios of A260/A280 (all above1.85 and mostly above 1.90) and by gel electrophoresisfor the presence of two clear ribosomal RNAbands. OnlyRNA samples that did not show signs of degradationwere used in this study. For RT, 1 mg of total RNA wasadded to a 20 ml-reaction mixture containing randomhexamers and reverse transcriptase (New EnglandBiolabs, Beverly, MA). The reaction mixture wasincubated at 258C for 10 min followed by RT at 428Cfor 1 hr. The reverse transcriptase was then inactivatedat 958C for 5 min.

Validation of the Comparative CT Method forQuantitative Real Time RT-PCR

Quantitative real time RT-PCR was performed usinganABIPrism7000SequenceDetectionSystem (AppliedBiosystems, Inc., Foster City, CA). Reactions were

Molecular Reproduction and Development. DOI 10.1002/mrd

266 L. JIANG ET AL.

performed in triplicates in 96-well optical reactionplates. Each reaction contained cDNA reverse tran-scribed from 10 ng total RNA, 1� SYBR Green PCRmaster mix and 0.3 mM of each specific primers, whichwere designed using PrimerExpress software (ABI) andsummarized in Table 1. The Tm for each primer pair wasbetween 59 and 608C and the thermal cycling conditionswere as follows: 508C for 2min, 958C for 10min, followedby 40 cycles of 15 sec at 958C for denaturation and 1minat 608C for annealing and extension. The fluorescenceintensity for each well of the PCR plate was auto-matically determined after every elongation step. Thespecificity of the PCR reaction was confirmed by a singlepeak in the dissociation curve (Fig. 1a) and also by asingle band in agarose gel electrophoreses (data notshown). Data were acquired and analyzed by ABI prismSDS software (ABI). The 18S ribosomal RNA was usedas an endogenous control throughout this study. Thecalibrator, which was included in every real time plate,was a mixture of RNA from all six organs.In order to use the comparative CT method for

quantification, also known as the DDCT method, eachpair of primers was validated for equal amplificationefficiency to primers of the endogenous reference (18SrRNA) at a wide range of cDNA concentrations. Briefly,serial dilutions of cDNA frommixed RNA samples weremade, real time RT-PCR reactions for both the 18SrRNA and each target gene was performed in triplicatesat each cDNA dilution (Fig. 1b). CT, the threshold cycle,was determined after setting the threshold in the linearamplification phase of the PCR reaction and DCT for aparticular genewas defined asCT(target gene)�CT(18SrRNA). As shown inFigure 1c, a linear regressionwith aslope (absolute value) of less than 0.1 was obtained foreach of the gene of interest, indicating that 18S rRNAand target genes had similar amplification efficiencywhich were close to 2.0 (Table 1), thus validating thequantitative nature of the RT-PCR reaction using theDDCT method. The relative expression level of a targetgene in a particular sample was calculated as: 2�DDCT,where DDCT¼DCT(sample)�DCT(calibrator). The amplifi-cation efficiency was determined by the followingformula: e¼10�1/slope, where the slope is from the linearregression of the each gene’s CT values over the log

values of serial dilutions of cDNA from 20, 5, 2.5, 1.25,0.625, and 0.3125 ng mixed RNA.

Distinguishing Transcripts of XIST and TSIX

BecauseXIST andTSIX are antisensemRNA for eachother, a regularRT reaction, inwhich randomhexamersare used for reverse transcription, would convertboth transcripts to the same double-stranded cDNAmolecule. Therefore, strand-specific primers wereused during RT and this was followed by real timePCR to determine mathematically the ratio of XISTand TSIX. The gene-specific RT primers for XISTand TSIX were 50-AGGTGTTGCTGGCTGATGCT-30; and 50-GAAGAGATGCTCCAGGCCAAT-30, respec-tively. These primers were subjected to reverse-phasecartridge purification and RT was conducted usingEndofree RT kit (Ambion, Austin, TX) per manu-facture’s instruction to reduce the endogenous primingby fragmented oligonucleotides.

Statistical Analysis

All statistical analyses were performed using SAS/STAT software (Version 8.2, Cary, NC). All data werefirst examined for distribution normality and varianceequality, the latter of which was tested by the foldedform of the F statistic (F0) (Steel and Torrie, 1980). Datawith normal distribution and equal variance weresubjected to pooled t-tests. Normally distributeddata with unequal variance were subjected to theCochran t-test. Data that were not normally distributedbut have equal variance were tested using theWilcoxonRank Sum test. Data that were neither normallydistributed nor equal in variance were log-transformedfirst and then tested as described above depending ontheir distribution and variance status. A P-value of lessthan 0.05 was considered statistically significant.

RESULTS

ThemRNA levels of a total of five genes on the porcineX chromosome and one on the autosome were examinedin our study and the results are summarized inFigures 2–7. Comparisons of expression for each genewere made between controls and clones in a particularorgan. For the neonate group, four comparisons were


TABLE 1. Primers for Real Time RT-PCR

Gene Primer sequences (50 to 30) Product size (bp) Amplification efficiency

XIST F: GAAGAGATGCTCCAGGCCAAT 87 1.92R: AGGTGTTGCTGGCTGATGCT

HPRT11 F: CGTCTTGCTCGAGATGTGATG 98 1.91R: TCCAGCAGGTCAGCAAAGAA

G6PD F: CCTCCTGCAGATGCTGTGTCT 112 1.91R: CGCCTGCACCTCTGAGATG

ARAF1 F: CGGGATGGCATGAGTGTCTAC 108 1.98R: GACTGTCTTTCGCCCCTTGA

COL4A1 F: CAGCAACGAACCCCAGAAAT 120 1.89R: CAGCAAGAAGAGGCCAACAAG

18S rRNA F: GCCCGAAGCGTTTACTTTGA 93 1.96R: CCGCGGTCCTATTCCATTATT

F, forward primer; R, reverse primer.

X-LINKED GENE EXPRESSION IN CLONED PIGS 267

found to be significantly different between controls andclones among the 30 comparisons made. These includeHPRT1 expression in lung, brain, and spleen, andCOL4A1 gene expression in kidney (Figs. 2a and 3a).While the other genes studied appear to have normalexpression levels in all six organs. Interestingly, new-borndeceased cloneshad lower levels of expression in allsignificant differences detected. When we compared theexpression of each gene between controls and clonesin the surviving group, five comparisons were foundto be significantly different. All of these were due toupregulation in gene expression in the clones, includingthe expression of XIST in heart, lung, and spleen, andHPRT1 in lung and liver (Figs. 3b and 4b).

Relatively large variations in the expression levels ofthe genes studiedwere observed among different organsin newborns and this trend continued in 1-month-oldpigs, regardless of their reproduction method. Interest-ingly, the most dramatic differences were found for theautosomal COL4A1 gene, which were high in lung andkidney but very low in liver and brain in both agedgroups. For the X-linked genes, the liver seemed to havethe lowest XIST levels, while the brain had the highestHPRT1 levels.

In addition, we tested homogeneity of variance andfound six comparisons to have unequal variance in theclones when compared to the controls. These includeCOL4A1 expression in heart (Fig. 2a), HPRT1 expres-sion in heart and kidney (Fig. 3a), XIST expression inbrain (Fig. 4b), and G6PD expression in heart andkidney (Fig. 6a). Interestingly, larger varianceswere found in the clones for five out of six of theseheterogeneous variances. When clones and controlswere compared in groups, these large variances couldmask dysregulation of individual clones and result ina lack of significant differences. Therefore, we used2 standard deviations (2 SD) of the average expressionlevels of controls as a cut-off to compare the cloned pigsindividually, which gives us 95% confidence. Thenumbers of cloned pigs that had abnormal levels of geneexpression (>2 SD of controls’ levels) are presented inTable 2. Among all organs and genes studied, thehearts and lungs of deceased cloned pigs had the mostgene expression aberrations; the gene COL4A1 wasaberrantly expressed bymost organs of dead clones, butonly in the spleen of the live clones (Table 2). In clonesthat survived to 1-month of age, the liver and spleen hadthe least gene expression aberrations. Three (HPRT1,G6PD, and COL4A1) out of the five genes studied haddramatically less dysregulation in the live clones whencompared to the dead clones (Table 2). Interestingly,XIST appears to be the most deregulated gene inboth the deceased newborn clones as well as clones at1-month of age, when these animals were analyzedindividually.

To distinguish the XIST and TSIX transcripts,primers designed in the non-overlapping regions ofthese transcripts are necessary, as performed in themouse and human (Lee et al., 1999;Migeon et al., 2001).Due to the lack of complete sequence information, we


Fig. 1. Primer validation for quantitative real time RT-PCR usingthe comparativeCTmethod.a: A representativedissociation curvewitha single peak, indicating the specificity of the amplification for thetarget gene (G6PD). b: A representative amplification plot of real timeRT-PCR for the endogenous control, 18S rRNA, and the target gene(G6PD). The two sets of six curves for each gene (left set for 18S rRNA,right set for G6PD) represent serial cDNA dilutions of 20, 5, 2.5, 1.25,0.625, and 0.3125 ng (from left to right), respectively. The horizontalline in the middle was the threshold established for the calculation ofthe CT value. c: A representative linear regression between DCT, thatis, CT(18S rRNA)�CT(target gene) and the log value of cDNA amount.The absolute value of the slope (0.0413) was smaller than 0.1,demonstrating equal amplification efficiencies between the 18s rRNA(endogenous control) and the target gene (G6PD) within the cDNAdilutions tested. [See color version online at www.interscience.wiley.com.]

268 L. JIANG ET AL.

were unable to design such primers. Using strand-specific RT reactions should allow us to convert only theinterested mRNA to cDNA. However, we were still ableto detect positive band by gel electrophoresis in a RTreactionwithout any primers (data not shown), suggest-ing endogenous priming was not completely eliminateddespite the use of a system to reduce it. In order tocircumvent this problem, we combined strand-specificRT and real time PCR in order to mathematicallycalculate the ratios of XIST and TSIX expression. Weconducted these reactions in RNA extracts from alltissues and similar resultswere observed. Therefore, wepooledRNA(20ng) fromall six organs for strand-specificRT and real time PCR and only presented results fromthepooled sample (Fig. 7).We found that theCTvalues ofRT-PCR with TSIX strand-specific primer and RT-PCRwithout primers (endogenous priming only) were thesame. This indicated that there was noTSIX expressionin these pig tissues at these ages studied.

DISCUSSION

Abnormal expression of genes on the X-chromosomehave been reported in cloned bovine embryos and

full-term calves as well as in cloned mouse embryos(Wrenzycki et al., 2002; Xue et al., 2002). This is possiblydue to the insufficient reprogramming of the donor cellsand failure to reactivate/inactivate the X chromosomeduring embryonic development (Nolen et al., 2005). Thepresent study is the first to investigate gene transcrip-tion levels in full-term piglets produced by somatic cellNT. Specifically, expression of five X-linked genes andone autosomal gene was studied. We found that whileexpression of these genes in surviving cloneswas largelywithin the normal range, abnormal expression wasprevalent in deceased newborns.

Although porcine embryos from somatic cell NTacquire a typical methylation pattern as controlembryos and have normal telomere length (Kanget al., 2001b; Jeon et al., 2005), they display sporadicdysregulation of genes that are critical to embryodevelopment (Lee et al., 2004; Miyazaki et al., 2005).This is consistent with the widely reported abnormalgene expression in mouse and bovine NT embryos(Daniels et al., 2000; Kang et al., 2001a; Wrenzyckiet al., 2001, 2002; Bortvin et al., 2003; Han et al., 2003;Mann et al., 2003). Different from the cloned pig


Fig. 2. Relative transcription levels for the autosomalCOL4A1 inmajor organs of (a) deceased newbornclones or (b) 1-month-old surviving cloned piglets and their age-matched controls. The average expressionlevels of six organs of the control piglets were normalized to 1. Error bar represents standard deviation.Bars with asterisks (*) are significantly different between clones and controls.

Fig. 3. Relative transcription levels forHPRT1 inmajor organs of (a) deceasednewborn; (b) 1-month-oldsurviving cloned piglets and their age-matched controls. The average expression levels of six organs of thecontrol piglets were normalized to 1. Error bar represents standard deviation. Bars with asterisks (*) aresignificantly different between clones and controls.


embryos, however, bovine and murine cloned embryosalso have abnormal DNA methylation patterns(Kang et al., 2001a), suggesting species differences inDNA methylation reprogramming. The wide-spreadgene dysregulation in cloned embryos, regardless ofspecies, may be a major contributor to the substantialloss of embryos through pregnancy. Because XCI occursduring early embryonic development, the abnormalitiesof X-linked gene expression observed in full-termpigletsin the present study possibly persisted throughout fetaldevelopment, suggesting tolerance of these animals todysregulated gene expression.

In the present study, we found that comparing clonesto controls in groups is insufficient to discover the extentof expression anomalies. This is primarily due to thelarge degree of gene expression variation in the clonedanimals, despite the fact that many of them weregenetically identical to each other, for which a smallervariance would be expected. By accepting the averageexpression levels of each gene in control’s organs as thenorm and by defining expression by clones to beabnormal if it is higher/lower than 2 SD of the norm,

we found 65 out of 180 (36%) expression levels(6 pigs�pig� 5 genes/organ¼180 expression levelsstudied) in deceased newborns were abnormal versusonly 4 out of 30 (13%) expression levels (6 organs�5 genes¼30) when clones and controls were comparedin groups. In fact, the expression of all but one gene(ARAF1) in organs of individual deceased clones wasfound to be significantly dysregulated using thiscomparison and was likely abnormal (Table 2). Similarexpression abnormalities were found in DNA methyla-tion in cloned pigs and deceased cloned bovinecalves (Archer et al., 2003; Li et al., 2005; Yang et al.,2005). The same 2 SD comparisons in the survivingclones revealed much less dysregulation (Table 2). Thisstrongly suggests a correlation between the normality ofgene expression and viability of the cloned piglets. Ourfinding was in accordance with a recent study in whichthe expression of several imprinted genes were found tobe relatively normal in bovine clones that survivedto adulthood compared to those that died at/afterbirth (Yang et al., 2005). Interestingly, all the above-mentioned studies, together with ours, reported more


Fig. 4. Relative transcription levels for XIST in major organs of (a) deceased newborn; (b) 1-month-oldsurviving cloned piglets and their age-matched controls. The average expression levels of six organs of thecontrol piglets were normalized to 1. Error bar represents standard deviation. Bars with asterisks (*) aresignificantly different between clones and controls.

Fig. 5. Relative transcription levels forARAF1 inmajor organs of (a) deceasednewborn; (b) 1-month-oldsurviving cloned piglets and their age-matched controls. The average expression levels of six organs of thecontrol piglets were normalized to 1. Error bar represents standard deviation. Bars with asterisks (*) aresignificantly different between clones and controls.

270 L. JIANG ET AL.

variation of gene expression in the cloned group,suggesting the universal random nature of nuclearreprogramming in different species.We also noticed large variations in the expression

levels of the same genes among different organs,regardless of how the animals were reproduced. Thissuggests that the expression of X-linked genes is notonly regulated by XCI but also by their own individualpromoters which may be subjected to tissue-specific stimulation/inhibition. The relatively consistentrecapitulation of tissue specificity of gene expression inthe cloned animals indicates that organ specific func-

tions may be reprogrammed, despite the lack ofcomplete reprogramming of XCI.

Finally, TSIX has been shown to repress XISTexpression in cis and to regulate both imprinted andrandom X inactivation in mice (Lee and Lu, 1999;Lee, 2000). Unlike mice where TSIX expression islimited to undifferentiated cells, TSIX was reportedto be present in human embryonic cell lines, fetalsomatic cells, placental tissues, and skin fibroblastsfrom 2-month-old females (Migeon et al., 2001, 2002;Chow et al., 2003), and even in adult bovine organs(Farazmand et al., 2004). These studies used TSIX-


Fig. 6. Relative transcription levels forG6PD in major organs of (a) deceased newborn; (b) 1-month-oldsurviving cloned piglets and their age-matched controls. The average expression levels of six organs of thecontrol piglets were normalized to 1. Error bar represents standard deviation. Bars with asterisks (*) aresignificantly different between clones and controls.

Fig. 7. A quantitative real time amplification plot for the determination of the TSIX transcripts. Theseries of curves on the left represent triplicate amplifications of XIST using the XIST-specific primer. Theseries of curves on the right represent triplicate amplificationsTSIX using either theTSIX-specific primeror no primers. The amplification curves forTSIXwith andwithout primers overlapped, indicating a lack ofTSIX transcripts in the samples.The sameamount of totalRNAwasused inall amplifications in this figure.[See color version online at www.interscience.wiley.com.]


specific or strand-specific RT-PCR to distinguish theantisense transcripts ofTSIX fromXIST. Due to limitedsequence information at the porcine XIST/TSIX locus,we were unable to design primers in non-overlappingregions of TSIX and XIST. The novel combination ofstrand-specific RT and quantitative real time PCR,however, allowed us to assertively conclude that TSIXwas absent in our samples from newborn and 1-month-old pigs.

In summary, we document for the first time thatcloned, deceased newborn pigs have prevalent abnorm-alities in the levels of X-linked genes, while clones thatsurvived to 1-month of age tend to have only moderatelevels of expression abnormalities. Pigs do not expressTSIX in major organs after birth.

ACKNOWLEDGMENTS

The authors would like to thank Dr. Lan Yang for thetechnical support and helpful discussion;Marina Julianand Sadie L. Smith for their critical reading of themanuscript; Dr. Thomas Hoagland for the help onstatistical analysis; Dr. David Ayares and Pete Jobstat Revivicor, Inc. for their help on collecting samplesfrom neonatal piglets. The authors also would like toacknowledge the support from theNIH via the NationalCenter for Research Resources (to RSP; R01/RR013438)and USDA (to XCT and XY).

REFERENCES

ArcherGS,DindotS,FriendTH,WalkerS, ZaunbrecherG,LawhornB,Piedrahita JA. 2003. Hierarchical phenotypic and epigenetic varia-tion in cloned swine. Biol Reprod 69:430–436.

Betthauser J, ForsbergE, AugensteinM, Childs L, EilertsenK,Enos J,Forsythe T, Golueke P, JurgellaG, KoppangR, Lesmeister T,MallonK, Mell G, Misica P, Pace M, Pfister-Genskow M, Strelchenko N,VoelkerG,WattS,ThompsonS,BishopM.2000.Production of clonedpigs from in vitro systems. Nat Biotechnol 18:1055–1059.

BortvinA,EgganK, SkaletskyH,AkutsuH,BerryDL,YanagimachiR,Page DC, Jaenisch R. 2003. Incomplete reactivation of Oct4-relatedgenes in mouse embryos cloned from somatic nuclei. Development130:1673–1680.

Cezar GG, Bartolomei MS, Forsberg EJ, First NL, Bishop MD,Eilertsen KJ. 2003. Genome-wide epigenetic alterations in clonedbovine fetuses. Biol Reprod 68:1009–1014.

Chow JC, Hall LL, Clemson CM, Lawrence JB, Brown CJ. 2003.Characterization of expression at the human XIST locus in somatic,

embryonal carcinoma, and transgenic cell lines. Genomics 82:309–322.

Cibelli JB, Stice SL, Golueke PJ, Kane JJ, Jerry J, Blackwell C, Poncede Leon FA, Robl JM. 1998. Cloned transgenic calves produced fromnonquiescent fetal fibroblasts. Science 280:1256–1258.

Dai Y, Vaught TD, Boone J, Chen SH, Phelps CJ, Ball S, Monahan JA,Jobst PM,McCreath KJ, Lamborn AE, Cowell-Lucero JL, Wells KD,ColmanA, Polejaeva IA, Ayares DL. 2002. Targeted disruption of thealpha1,3-galactosyltransferase gene in cloned pigs. Nat Biotechnol20:251–255.

DanielsR,Hall V, TrounsonAO. 2000.Analysis of gene transcription inbovine nuclear transfer embryos reconstructed with granulosa cellnuclei. Biol Reprod 63:1034–1040.

Eggan K, Akutsu H, Hochedlinger K, Rideout W III, Yanagimachi R,Jaenisch R. 2000. X-Chromosome inactivation in cloned mouseembryos. Science 290:1578–1581.

Eggan K, Baldwin K, Tackett M, Osborne J, Gogos J, Chess A, Axel R,Jaenisch R. 2004. Mice cloned from olfactory sensory neurons.Nature 428:44–49.

Farazmand A, Basrur PK, Stranzinger G, Graphodatskaya D, ReyesER, King WA. 2004. Expression of XIST sense and antisense inbovine fetal organs and cell cultures. Chromosome Res 12:275–283.

Galli C, Lagutina I, Crotti G, Colleoni S, Turini P, Ponderato N, DuchiR, Lazzari G. 2003. Pregnancy: A cloned horse born to its dam twin.Nature 424:635.

Gould DB, Phalan FC, Breedveld GJ, vanMil SE, Smith RS, SchimentiJC, Aguglia U, van der Knaap MS, Heutink P, John SW. 2005.Mutations in Col4a1 cause perinatal cerebral hemorrhage andporencephaly. Science 308:1167–1171.

HanDW,Song SJ,UhumSJ,Do JT,KimNH,ChungKS, LeeHT. 2003.Expression of IGF2 and IGF receptor mRNA in bovine nucleartransferred embryos. Zygote 11:245–252.

Hochedlinger K, Jaenisch R. 2002. Monoclonal mice generated bynuclear transfer frommature B and T donor cells. Nature 415:1035–1038.

Jeon HY, Hyun SH, Lee GS, Kim HS, Kim S, Jeong YW, Kang SK, LeeBC, Han JY, Ahn C, Hwang WS. 2005. The analysis of telomerelength and telomerase activity in cloned pigs and cows. Mol ReprodDev 71:315–320.

Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, Han YM.2001a. Aberrant methylation of donor genome in cloned bovineembryos. Nat Genet 28:173–177.

Kang YK, Koo DB, Park JS, Choi YH, Kim HN, Chang WK, Lee KK,HanYM. 2001b.Typical demethylation events in clonedpig embryos.Clues on species-specific differences in epigenetic reprogramming ofa cloned donor genome. J Biol Chem 276:39980–39984.

Kato Y, Tani T, SotomaruY, KurokawaK,Kato J,DoguchiH, YasueH,Tsunoda Y. 1998. Eight calves cloned from somatic cells of a singleadult. Science 282:2095–2098.

Kolber-Simonds D, Lai L, Watt SR, Denaro M, Arn S, Augenstein ML,Betthauser J, Carter DB, Greenstein JL, Hao Y, Im GS, Liu Z, MellGD, Murphy CN, Park KW, Rieke A, Ryan DJ, Sachs DH, ForsbergEJ, Prather RS, Hawley RJ. 2004. Production of alpha-1,3-galacto-syltransferase null pigs bymeans of nuclear transferwith fibroblasts


TABLE 2. Number of Cloned Pigs in Either the Group of Dead Neonates (n¼6) orthe Group of Live Piglets at 1-Month of Age (n¼7) That had Gene Expression

Dysregulation by at Least 2 SD of the Average Expression Levels of Age-MatchedControl Pigs

XIST HPRT1 G6PD ARAF1 COL4A1

Live Dead Live Dead Live Dead Live Dead Live Dead

Heart 5 0 0 3 1 5 1 0 0 6Lung 4 4 4 6 1 1 1 1 0 1Liver 3 3 2 5 0 1 0 0 0 3Kidney 1 3 1 6 1 0 3 0 0 3Brain 2 0 0 5 2 3 2 0 0 0Spleen 4 4 0 1 0 1 0 0 1 0

272 L. JIANG ET AL.

bearing loss of heterozygosity mutations. Proc Natl Acad Sci USA101:7335–7340.

Kubota C, Yamakuchi H, Todoroki J, Mizoshita K, Tabara N, BarberM, Yang X. 2000. Six cloned calves produced from adult fibroblastcells after long-term culture. Proc Natl Acad Sci USA 97:990–995.

Lai L,Kolber-SimondsD, ParkKW,CheongHT,Greenstein JL, ImGS,Samuel M, Bonk A, Rieke A, Day BN, Murphy CN, Carter DB,Hawley RJ, Prather RS. 2002. Production of alpha-1,3-galactosyl-transferase knockout pigs by nuclear transfer cloning. Science 295:1089–1092.

Lee JT. 2000. Disruption of imprinted X inactivation by parent-of-origin effects at Tsix. Cell 103:17–27.

LeeJT,LuN. 1999.Targetedmutagenesis ofTsix leads tononrandomXinactivation. Cell 99:47–57.

Lee JE, Beck TW,BrennscheidtU,DeGennaro LJ, RappUR. 1994. Thecomplete sequence and promoter activity of the human A-raf-1 gene(ARAF1). Genomics 20:43–55.

Lee JT, Davidow LS, Warshawsky D. 1999. Tsix, a gene antisense toXist at the X-inactivation centre. Nat Genet 21:400–404.

Lee SH, Kim DY, Nam DH, Hyun SH, Lee GS, Kim HS, Lee CK,Kang SK, Lee BC, Hwang WS. 2004. Role of messenger RNAexpression of platelet activating factor and its receptor in porcinein vitro-fertilized and cloned embryo development. Biol Reprod 71:919–925.

Li S, Li Y, Du W, Zhang L, Yu S, Dai Y, Zhao C, Li N. 2005. Aberrantgene expression in organs of bovine clones that diewithin 2days afterbirth. Biol Reprod 72:258–265.

Longo L, Vanegas OC, Patel M, Rosti V, Li H, Waka J, Merghoub T,Pandolfi PP, Notaro R, Manova K, Luzzatto L. 2002. Maternallytransmitted severe glucose 6-phosphate dehydrogenase deficiency isan embryonic lethal. Embo J 21:4229–4239.

Lyon MF. 1961. Gene action in the X-chromosome of the mouse (Musmusculus L.). Naturwissenschaften 190:372–373.

Mann MR, Chung YG, Nolen LD, Verona RI, Latham KE, BartolomeiMS. 2003. Disruption of imprinted gene methylation and expressionin cloned preimplantation stage mouse embryos. Biol Reprod 69:902–914.

Migeon BR, Chowdhury AK, Dunston JA,McIntosh I. 2001. Identifica-tion of TSIX, encoding an RNA antisense to human XIST, revealsdifferences from its murine counterpart: Implications for X inactiva-tion. Am J Hum Genet 69:951–960.

Migeon BR, Lee CH, Chowdhury AK, Carpenter H. 2002. Speciesdifferences in TSIX/Tsix reveal the roles of these genes inX-chromosome inactivation. Am J Hum Genet 71:286–293.

Miyazaki K, Tomii R, Kurome M, Ueda H, Hirakawa K, Ueno S,Hiruma K, Nagashima H. 2005. Evaluation of the quality of porcinesomatic cell nuclear transfer embryo by gene transcription profiles.J Reprod Dev 51:123–131.

Nolen LD, Gao S, Han Z,MannMR, Gie Chung Y, Otte AP, BartolomeiMS, LathamKE. 2005. X chromosome reactivation and regulation incloned embryos. Dev Biol 279:525–540.

Onishi A, IwamotoM, Akita T,Mikawa S, Takeda K, Awata T, HanadaH, Perry AC. 2000. Pig cloning by microinjection of fetal fibroblastnuclei. Science 289:1188–1190.

Penny GD, Kay GF, Sheardown SA, Rastan S, Brockdorff N. 1996.Requirement for Xist in X chromosome inactivation. Nature379:131–137.

Polejaeva IA, Chen SH, Vaught TD, Page RL, Mullins J, Ball S, Dai Y,Boone J, Walker S, Ayares DL, Colman A, Campbell KH. 2000.Cloned pigs produced by nuclear transfer from adult somatic cells.Nature 407:86–90.

Ramsoondar JJ,Machaty Z, Costa C,Williams BL, FodorWL, BondioliKR. 2003. Production of alpha 1,3-galactosyltransferase-knockoutcloned pigs expressing human alpha 1,2-fucosylosyltransferase. BiolReprod 69:437–445.

SadoT,Hoki Y, SasakiH. 2005. Tsix silences Xist throughmodificationof chromatin structure. Dev Cell 9:159–165.

Senda S, Wakayama T, Yamazaki Y, Ohgane J, Hattori N, Tanaka S,Yanagimachi R, Shiota K. 2004. Skewed X-inactivation in clonedmice. Biochem Biophys Res Commun 321:38–44.

Shin T, Kraemer D, Pryor J, Liu L, Rugila J, Howe L, Buck S, MurphyK, Lyons L,WesthusinM. 2002. A cat cloned by nuclear transplanta-tion. Nature 415:859.

Steel R, Torrie J. 1980. Analysis of covariance, In: Principles andProcedures of Statistics: a Biometrical Approach. New York:McGraw-Hill, pp. 111–113.

Wakayama T, Yanagimachi R. 1999. Cloning of male mice from adulttail-tip cells. Nat Genet 22:127–128.

Wakayama T, Shinkai Y, Tamashiro KL, Niida H, Blanchard DC,Blanchard RJ, Ogura A, Tanemura K, Tachibana M, Perry AC,Colgan DF, Mombaerts P, Yanagimachi R. 2000. Cloning of mice tosix generations. Nature 407:318–319.

Wilmut I, SchniekeAE,McWhir J,KindAJ,CampbellKH. 1997.Viableoffspring derived from fetal and adult mammalian cells. Nature385:810–813.

Wrenzycki C, Wells D, Herrmann D, Miller A, Oliver J, Tervit R,Niemann H. 2001. Nuclear transfer protocol affects messenger RNAexpression patterns in cloned bovine blastocysts. Biol Reprod65:309–317.

Wrenzycki C, Lucas-Hahn A, Herrmann D, Lemme E, Korsawe K,Niemann H. 2002. In vitro production and nuclear transfer affectdosagecompensationof theX-linkedgenetranscriptsG6PD,PGK,andXist in preimplantation bovine embryos. Biol Reprod 66:127–134.

XueF, TianXC,DuF,KubotaC, TanejaM,DinnyesA,DaiY, LevineH,Pereira LV, Yang X. 2002. Aberrant patterns of X chromosomeinactivation in bovine clones. Nat Genet 31:216–220.

Yang L, Chavatte-Palmer P, Kubota C, O’Neill M, Hoagland T, RenardJP, TanejaM, Yang X, Tian XC. 2005. Expression of imprinted genesis aberrant in deceased newborn cloned calves and relatively normalin surviving adult clones. Mol Reprod Dev 71:431–438.

Zhang S, Kubota C, Yang L, Zhang Y, Page R, O’Neill M, Yang X, TianXC. 2004. Genomic imprinting of H19 in naturally reproduced andcloned cattle. Biol Reprod 71:1540–1544.



Documents

Expression of X-linked genes in deceased neonates and surviving cloned female piglets