Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
Expression pattern of subA in different tissues and blood-feeding status in Haemaphysalis flava
Lei Liu1 • Tian-yin Cheng1 • Fen Yan1
Received: 24 June 2016 / Accepted: 14 August 2016 / Published online: 15 September 2016� Springer International Publishing Switzerland 2016
Abstract Tick-borne-diseases (TBD) pose a huge threat to the health of both humans andanimals worldwide. Tick vaccines constitute an attractive alternative for tick control, due
to their cost-efficiency and environmental-friendliness. Subolesin, a protective antigen
against ticks, is reported to be a promising candidate for the development of broad-
spectrum vaccines. However, the entire length of its gene, subA, and its gene expression
pattern in different tissues and blood-feeding status (or different levels of engorgement)
have not been studied extensively. In our study, the full-length of subA in Haemaphysalis
flava, Rhipicephalus haemaphysaloides, Rhipicephalus microplus, and Dermacentor sini-
cus was cloned by RACE–PCR. The subA expression pattern was analyzed further in H.
flava in different tissues and blood-feeding status by RT-PCR. We found that the full-
length of subA in H. flava, R. haemaphysaloides, R. microplus, and D. sinicus was 1318,
1498, 1316, and 1769 bp, respectively, with encoded proteins at 180, 162, 162, and 166 aa
in length, respectively. The primary structure of subolesin in H. flava included three
conserved regions and two hypervariable regions, with no signal peptide. SubA expression
in female H. flava of different blood-feeding status was in the order of the fasted\ the 1/4-engorged\ the half-engorged\ the fully-engorged (p\ 0.01). Tissue expression of subAwas in the order of salivary gland[midgut[ integument (p\ 0.01), but its expression insalivary glands was not statistically different from that in ovaries. We concluded that
subolesin was a conserved antigen and that subA was expressed differentially in H. flava in
different tissues and blood-feeding status. Those features made subolesin feasible as a
potential target antigen for development of a universal vaccine for the control of tick
infestations and a reduction in TBD.
Keywords Tick � Subolesin � SubA � RACE � Vaccine
& Tian-yin [email protected]
1 College of Veterinary Medicine, Hunan Agricultural University, Changsha, Hunan 410128, China
123
Exp Appl Acarol (2016) 70:511–522DOI 10.1007/s10493-016-0088-4
http://crossmark.crossref.org/dialog/?doi=10.1007/s10493-016-0088-4&domain=pdfhttp://crossmark.crossref.org/dialog/?doi=10.1007/s10493-016-0088-4&domain=pdf
Introduction
Ticks are hematophagous ectoparasites of multiple classes of arthropods, which can cause
irritation, emaciation, anemia, and paralysis in host animals. Ticks are known to be
competent vectors that transmit a variety of pathogens, such as viruses, bacteria, protozoa,
fungi, and helminths. TBD have become a great threat to the health of both animals and
humans throughout the world (e.g., tick-borne-encephalitis (TBE), spotted fever,
babesiosis, Lyme disease, and anaplasmosis; Baneth 2014). Recently, novel TBD have
been discovered. Since 2007, more than 279 cases of the severe fever known as throm-
bocytopenia syndrome have been reported in Henan, Zhejiang, and Shandong, China
(Wang et al. 2016; Ye et al. 2015), which indicates that the disease now has a wide
distribution; bunyavirus, which was isolated from ticks, was shown to contribute to the
disease (Xu et al. 2011).
Thus far, tick control strategies have been implemented by applying acaricides. How-
ever, application of acaricides tends to cause selection of acaricide-resistant ticks, envi-
ronmental pollution, and drug residues in milk and meat products (Graf et al. 2004). Thus,
it is urgent to seek safer, more effective, and environmentally-friendly alternatives (Liu
et al. 2014); vaccination has emerged as one of the viable alternatives (de la Fuente et al.
2013). The efficiency of vaccines that use antigens Bm86 and Bm91 from R. microplus
(Rand et al. 1989; Willadsen et al. 1996) have provided a promising way to develop
vaccines against ticks. However, vaccine trials showed various levels of efficacy among
different strains of R. microplus and among closely related tick species, which suggested
that ticks exhibit genetic differences in the susceptibility to Bm86 vaccination (Canales
et al. 2009). Lacking broad-spectrum vaccinations against ticks awaits screening of pos-
sible antigen candidates that would be expressed in all classes of ticks.
Subolesin (previous known as 4D8) was recognized and cloned originally from a cDNA
library of Ixodes scapularis (Almazan et al. 2003). It was reported to be effective in
reducing vectorial capacity and fertility of I. scapularis, Dermacentor variabilis, Derma-
centor marginatus, Amblyomma americanum, and Rhipicephalus sanguineus (de la Fuente
et al. 2006b) and, hence, subolesin was considered to be a tick protective antigen that might
be of significance in developing universal vaccines for the control of ticks (de la Fuente
et al. 2013).
To obtain more information on subolesin, we cloned the full-length of the subolesin
gene, subA, in H. flava, R. haemaphysaloides, R. microplus, and D. sinicus by RACE-PCR.
In particular, we analyzed the subA expression pattern further in different tissues and
feeding status of H. flava using RT-PCR.
Materials and methods
Tick collection
Haemaphysalis flava, R. haemaphysaloides, R. microplus, and D. sinicus were collected
from hedgehogs, goats, or dogs in Xinyang, Henan province (E114�060, N31�1250),Hengyang, Hunan province (E110�320, N26�070), Tongren, Guizhou province (E107�450,N27�070), and Taigu, Shanxi province (E111�230, N36�390).
512 Exp Appl Acarol (2016) 70:511–522
123
Total RNA extraction
RNA was extracted by EasyPure RNA Kit (Transgen Biotech, Beijing, China) from whole
ticks or dissected tick organs in the four species of ticks listed above. The quality of total
RNA was assessed by an A260 to A280 ratio by a NanoDrop ND-2000 (Thermo Scientific,
Waltham, MA, USA) and the quantity of RNA was evaluated by an Agilent Bioanalyzer
2100 (Agilent, CA, USA). cDNA was synthetized by following the manual of TransScript
All-in-One First-Strand cDNA Synthesis SuperMix for PCR (Transgen Biotech).
Cloning the open reading frame (ORF) of subA
ORF-F (50-ATGGCTTGTGCGACATTAAAGC-30) and ORF-R (50-GCTACGCCCAGC-TATTTGTCGT-3) were used as primers. PCR was performed at 94 �C for 5 min followedby 30 cycles that included denaturation at 94 �C for 30 s, annealing at 63 �C for 30 s, andan extension at 72 �C for 30 s for each cycle. A final extension at 72 �C for 7 min wasincluded also.
RCR products were electrophoresed in 1.5 % agarose. Target bands were recovered by
a gel extraction kit (Takara, Dalian). Ligation and transformation of PCR products were
performed according to the manual for the kit. Positive clones were selected and sequenced
by Sangon (Shanghai, China).
Rapid amplification of cDNA ends (RACE) for subA
30 and 50 RACE were employed to clone full-length of subA. Primers were designed basedon conserved nucleic acid sequences that were revealed by a multiple sequence alignment
of annotated subolesin cDNA sequences (EU301808, EU326280, DQ159968, JX856138)
from closely related tick species. Gene-specific primers (GSP) for 30-RACE and 50-RACEwere designed according to the amplified ORF of subA (Table 1).
A 1.5 ll sample of RNA from fully-engorged female ticks was used and first-strandcDNA was synthesized by 30-Full RACE Core Set with PrimeScriptTM Rtase (Takara,Dalian). The first round of amplification used 30 RACE-GSP1 and 30 RACE-outerP asprimers (Table 1) and first-strand cDNA was used as templates through 20 cycles. Con-
ditions were as follows: initial denaturation at 94 �C for 3 min, denaturation at 94 �C for30 s, annealing at 58 �C for 30 s, extension at 72 �C for 50 s, and a final extension at72 �C for 10 min. The second round of amplification was completed with 30 RACE-GSP2and 30 RACE-innerP as primers. Conditions were as follows: 94 �C for 3 min, 30 cycles at94 �C for 30 s, 64.5 �C for 30 s, 70 �C for 50 s, and a final extension at 72 �C for 10 min.
Dephosphorylation, decap-reaction, addition of 50-RACE adaptor, and reverse tran-scription were done according to the manual of the SMARTerTM RACE cDNA Amplifi-
cation Kit (Takara, Dalian). 50 RACE-GSP1 and 50 RACE-outerP were used as primers(Table 1). Conditions were as follows: 94 �C for 3 min, 20 cycles at 94 �C for 30 s, 64 �Cfor 30 s, 72 �C for 40 s, and 1 cycle at 72 �C for 10 min. The second round of amplifi-cation was performed with 50 RACE-GSP2 and 50 RACE-innerP as primers. Conditionswere as follows: 94 �C for 3 min, 26 cycles at 94 �C for 30 s, 60 �C for 30 s, 72 �C for30 s, and 1 cycle at 72 �C for 10 min.
A phylogenetic tree of subA was also plotted using software MEGA 5.0 based on
available mRNA sequences of multiple tick species in Genbank. The signal peptide of
subolesin was analyzed in http://www.cbs.dtu.dk/services/SignalP/.
Exp Appl Acarol (2016) 70:511–522 513
123
http://www.cbs.dtu.dk/services/SignalP/
SubA expression in H. flava in different tissues and blood-feeding status
Fully-engorged and 1/2-engorged ticks were dissected, and three replicates each of
salivary glands, ovaries, midguts, and integument were isolated carefully. Total RNA was
extracted from whole ticks and also from different organs. The purity and density of total
RNA were tested by UV-spectrophotometry. cDNA was synthesized according to the
manual of the PrimeScript RT reagent Kit with gDNA Eraser (Takara, Dalian) with total
RNA at 0.70 lg. Standard curves were plotted based on serial dilution of cDNA fromfemale adult H. flava. Dissociation curves for subA and house-keeping gene b-actin wereplotted also in a regular way. RT-PCR was manipulated using SYBR� Premix Ex TaqTM
(Takara, Dalian), and an ABI7300 (Applied Biosystems, Waltham, MA, USA) was
employed to do quantitative analysis. The conditions of RT-PCR were as follows: initial
denaturation at 95 �C for 30 s, denaturation at 95 �C for 5 s, annealing at 60 �C for 60 s,and amplification for 40 cycles.
The 2-44Ct method was used for assessment and comparison of subolesin expression in
different tissues and blood-feeding status. Normalized expression of subA was compared
among different tissues and different feeding status using Student’s test.
Table 1 The design of RACE Primers
Primer Sequence (50 ? 30) Tm (�C) Ticks
30 RACE-GSP1 (Bm) CGTGCCACCAAAGTTGACT 55.5 R. microplus
30 RACE-GSP2 (Bm) CGAACGAATGATGAAGGAGCGAG 60.0
30 RACE-GSP1 (Rh) CGTGCCACCAAAGTTGACT 55.5 R. haemaphysaloides
30 RACE-GSP2 (Rh) AGGAGCGAGAGAGCAAGATACG 60.0
30 RACE-GSP1 (Hf) CGAAGATGTATGCCTTTGTCG 56.0 H. flava
30 RACE-GSP2 (Hf) AAGCTGGCCGAGCAGTACGAC 64.0
30 RACE-GSP1 (Ds) CGTGCCACCAAAGTTGACT 55.5 D. sinicus
30 RACE-GSP2 (Ds) GCTCGCAGAACAATACGACACATTTG 60.0
30 RACE-outerP TACCGTCGTTCCACTAGTGATTT – All four ticks
30 RACE-innerP CGCGGATCCTCCACTAGTGATTTCACTATAGG
–
50 RACE-GSP1 (Bm) CCCGTATCTTGCTCTCTCGCTCCTTC 65.0 R. microplus
50 RACE-GSP2 (Bm) TCGCAAATGAGCCCAACCT 58.0
50 RACE-GSP1 (Rh) GCTCTCTCGCTCCTTCATCATCCGT 65.0 R. haemaphysaloides
50 RACE-GSP2 (Rh) TCGCAAATGAGCCCAACCT 58.0
50 RACE-GSP1 (Hf) GCTCCTTCATCATCCGCTCGCAG 64.0 H. flava
50 RACE-GSP2 (Hf) AGGCATACATCTTCGTCGTTTCGG 60.0
50 RACE-GSP1 (Ds) GCGTAGCACCCTCAAACCGCTTCT 64.0 D. sinicus
50 RACE-GSP2 (Ds) AAGCAGTGGTATCAACGCAGAGT 58.0
50 RACE-outerP CATGGCTACATGCTGACAGCCTA – All four ticks
50 RACE-innerP CGCGGATCCACAGCCTACTGATGATCAGTCGATG
–
514 Exp Appl Acarol (2016) 70:511–522
123
Results
RNA extraction
A260/A280 of RNA extracts were 1.84, 1.98, 1.98, and 2.00 in H. flava, R. haema-
physaloides, R. microplus, and D. sinicus, respectively. RNA extracts were analyzed
further using an Agilent Bioanalyzer 2100 (Fig. 1). There were two major bands at 2000
and 25 nt, respectively.
Cloning the ORF of subA
The ORF of subA were 540, 486, 486, and 498 bp in H. flava, R. haemaphysaloides, R.
microplus, and D. sinicus, respectively (Fig. 2).
Cloning the full-length of subA
The 30 of subAwere 614, 975, 971 and 1216 bp (Fig. 3) and the 50 of subAwere 457, 553, 464and 313 bp in H. flava, R. haemaphysaloides, R. microplus, and D. sinicus (Fig. 4), respec-
tively. After reassembly of the complete gene sequence, the full-length of subAwere 1318 bp
(KJ829652), 1498 bp (KM115650), 1316 bp (KM115649), and 1769 bp (KM115651) in H.
Fig. 1 Electrophoresis of totalRNA. (1— H. flava; 2— R.haemaphysaloides; 3— R.microplus; 4— D. sinicus; L.Ladder)
Fig. 2 Electrophoresis for amplified products of ORF of subA. (1— H. flava; 2— R. haemaphysaloides;3— R. microplus; 4— D. sinicus; M. Marker)
Exp Appl Acarol (2016) 70:511–522 515
123
flava, R. haemaphysaloides, R. microplus, and D. sinicus, respectively. Hence the subolesin
encoded were 180, 162, 162, and 166 aa accordingly.
Analysis of ORF of subA and subolesin encoded
The DNA sequence of four species of ticks were compared with that of the other 25 species
of ticks in Genbank. The ORF of subA were highly conservative, especially at the 50 endand the 30 end. The ORF of subA included three conservative regions and two hyper-variable regions. In addition, the conservative regions showed more similarity within the
same genus.
The phylogenetic tree showed species of Dermacentor had an individual monophyletic
clade and the other classes of ticks shared a monophyletic clade, including species of
Rhipicephalus, Amblyomma, Haemaphysalis, Ixodes, and Hyalomma (Fig. 5).
Based on the sequence of the known 29 species of ticks, we concluded that the primary
structure of the protein encoded was also highly conservative (Fig. 6). The 30 amino acid
residues in the amino terminal, the 43 amino acid residues in the middle, and the 57 amino
acid residues in the carboxyl terminal were identical. Furthermore, the first 17 amino acid
residues were identical, all in the form of MACATLKRTHDWDPLHSP. There were two
classes of amino acid sequences in the carboxyl terminal; one sequence ended with
Fig. 3 Electrophoresis for amplified products of 30 RACE. (1— H. flava; 2— R. haemaphysaloides; 3— R.microplus; 4— D.sinicus; M. Marker)
Fig. 4 Electrophoresis for amplified products of 50 RACE. (1— H. flava; 2— R. haemaphysaloides; 3— R.microplus; 4— D.sinicus; M. Marker)
516 Exp Appl Acarol (2016) 70:511–522
123
KLAEQYDTFVKFTYDQ, and the other sequence ended with DQIQKRFEGATPSYLS
following KLAEQYDTFVKFTYDQ. Accordingly, amino acid sequences in hypervariable
regions differed greatly.
Rhipicephalus_sanguineus-JX193845.1.seq: 0.017Rhipicephalus_haemaphysaloides-KM115650.1.seq: 0.029Rhipicephalus_annulatus-JX193844.1.seq: 0.029Rhipicephalus_decoloratus-JX193843.1.seq: 0.026
Rhipicephalus_microplus-EU301808.1.seq: 0.018Rhipicephalus_appendiculatus-DQ159967.1.seq: 0.023Rhipicephalus_evertsi-JX193846.1.seq: 0.019
Amblyomma_americanum-JX193819.1.seq: 0.034Amblyomma_cajennense_-JX193823.1.seq: 0.033Amblyomma_hebraeum-EU262598.1.seq: 0.032Amblyomma_variegatum_-JX193824.1.seq: 0.027Amblyomma_macula-JX193825.1.seq: 0.050Haemaphysalis_elliptica-_JX193850.1.seq: 0.066
Haemaphysalis_flava-KJ829652.1.seq: 0.034Haemaphysalis_qinghaiensis-EU326280.1.seq: 0.032Haemaphysalis_punctata-DQ159972.1.seq: 0.049
Ixodes_persulcatus_-KM888876.1.seq: 0.040Ixodes_scapularis-XM_002414448.1.seq: 0.039Ixodes_ricinus-DQ159961.1.seq: 0.040
Ornithodoros_moubata-HM622147.1.seq: 0.087Ornithodoros_savignyi_-JX193851.1.seq: 0.098
Ornithodoros_turicata-KP708703.1.seq: 0.113Hyalomma_anatolicum-JX193848.1.seq: 0.032Hyalomma_marginatum-DQ159971.1.seq: 0.041
Dermacentor_reticulatus-JX193847.1.seq: 0.029Dermacentor_sinicus-KM115649.1.seq: 0.007Dermacenttor_silvarum-_JX856138.1.seq: 0.005Dermacentor_marginatus_-DQ159969.1.seq: 0.009Dermacentor_variabilis-AY652657.2.seq: 0.019
0.05
Fig. 5 Phylogenetic tree of subA for various tick species based on nucleotide sequences. A phylogenetictree of subA was constructed by software MEGA 5.0 based on available mRNA sequences of multiple tickspecies in Genbank. The accession numbers of subA sequences from multiple species of ticks are shownafter their names
Exp Appl Acarol (2016) 70:511–522 517
123
SubA expression in H. flava in different tissues and blood-feeding status
A standard curve was made based on a fivefold serial dilution of cDNA templates. Stan-
dard slopes of the target gene and b-actin were -3.39 and -3.34, and correlation coef-ficients were 0.999 and 0.998, respectively (Fig. 7). Amplification efficiency of the target
Fig. 6 Multiple alignment of subA amino acids sequences in ticks. The predicted amino acid sequences offour species of ticks were compared with that of an additional 25 species of ticks in Genbank. The accessionnumbers of subA sequences from multiple species of ticks are shown after their names
518 Exp Appl Acarol (2016) 70:511–522
123
gene and b-actin were estimated to be 97.3 and 99.4 %, respectively. Tm of the target geneand b-actin were 83.2 and 87.2 �C, respectively, based on the dissociation curves (Fig. 8).
Expression of subA was associated positively with the amount of blood consumed by
ticks, because fully-engorged ticks had the highest expression (p\ 0.01) (Fig. 9a). Tissueexpression of subA was in the order of salivary gland[midgut[ integument (p\ 0.01),but its expression in the salivary gland was not statistically different from that in the ovary
(Fig. 9b).
Discussion
Almazánet al. (2003) screened subolesin initially from a cDNA library of I. scapularis and
the author obtained its partial gene sequence. Further studies showed that subolesin was a
conservative antigen with a mRNA full-length of 2693 bp, an ORF length of 555 bp, and a
coded protein length of 184 aa (mw 20.7 kDa); in addition, the animals that were
Fig. 7 The standard curves of subA and b-actin. Standard curves were made based on a fivefold serialdilution of cDNA templates. Standard slopes of the target gene and b-actin were -3.39 and -3.34, andcorrelation coefficients were 0.999 and 0.998, respectively
Fig. 8 The dissociation curves of subA (a) and b-actin (b). Tm of the target gene and b-actin were 83.2 and87.2 �C, respectively
Exp Appl Acarol (2016) 70:511–522 519
123
immunized with recombinant protein of subolesin showed reduced tick infections, tick egg
production, and tick vitalities (Almazan et al. 2005; de la Fuente et al. 2006a, b, c).
However, the full-length and expression pattern of subolesin in other ticks has not been
studied so far. Thus, our study aimed to clone the full-length of subA of the primary
species of ticks found near/in Hunan Province, China and to investigate its expression in
different blood-feeding status and tissues of H. flava.
Only 18 s rRNA band was found after total RNA extraction. However, based on the
OD260/OD280 and our years of experience, it was unlikely due to any error during RNA
extraction. It was deduced that there was also a ‘‘hidden break’’ in 28 s RNA of ticks as
well as in other animals like protozoans, coelenterates, platyhelminthes, nemathelminthes,
and some arthropods (Ishikawa 1977). At 40–60 �C, the hydrogen bond that links twofractions of 28 s rRNA break into two fractions. In bees, those two fractions were 1900 and
2000 nt, which was similar to the length of 18 s rRNA (Winnebeck et al. 2010).
The present study succeeded in cloning the full-length of subA in H. flava, R.
haemaphysaloides, R. microplus, and D. sinicus, which were 1318, 1498, 1316 and
1769 bp, respectively. As far as we know, there was only one full-length of subA mRNA
of I. scapularis in GenBank before our study. After conducting a similarity comparison of
the ORF of subA among 29 species of ticks, we found that ORF of subA was highly
conservative, especially at the 50 end and the 30 end, which made cloning of subA fromother ticks possible. However, we also found that certain regions in ORF of sub A were
hypervariable. Those sequences could be used to identify different genera of ticks.
Compared to the nucleic acid sequence, the primary structure of the subolesin protein
showed greater similarity, especially within the same genus. The putative protein consisted
of three conservative regions and two hypervariable regions, without any known signal
peptide as revealed by bioinformatics methods. Also, conservative regions were much
wider than hypervariable regions. Secondary structure of the putative protein showed
major irregular coils and a-helixes. Our findings were thus consistent with studies by
Fuente and other researchers (de la Fuente et al. 2006a, b, 2013; Goto et al. 2008), who also
a
bc
d
e
0123456789
10
Rela
�ve
expr
essi
on o
f sub
Aag
ains
t β-a
c�n
a
b
c
b
d
e
f
e
05
1015202530354045
Midgut Salivary glands Integument Ovary
Rela
�ve
expr
essi
on o
f sub
A ag
ains
t β-a
c�n
1/2-engorged
full engorgedA
B
Fig. 9 The expression of subA in H. flava of different blood-feeding status (a) and tissues (b) by RT-PCR.SubA expression in different feeding status and tissues was compared by Student’s t test. Data not sharing acommon letter in (a) indicated there was a significant difference regarding total subA expression in H. flavaof different blood-feeding status (p\ 0.01). Data within the same tissue not sharing a common letter in(b) indicated there was a significant difference (p\ 0.01). Data not sharing a common letter among differenttissues indicated there was a significant difference (p\ 0.01)
520 Exp Appl Acarol (2016) 70:511–522
123
reported that the subolesin protein was highly conservative. However, given the existence
of hypervariable regions, the conserved sequence of subolesin should be used to develop a
universal vaccine.
The total expression of subA was associated positively with the amount of blood vol-
ume in the tick; fully-engorged ticks showed the highest expression. Compared with half-
engorged ticks, the subA expression in salivary glands, midguts, ovaries, and integument
were higher in fully-engorged ticks (p\ 0.01). Yu (2015) reported that in adult R.haemaphysaloides, expression of subA was higher in half-engorged ticks than in ticks that
had fasted, which was also consistent with our results. Our results were also similar to
studies that showed a reduced blood uptake in subolesin-challenged ticks, which indicated
that subolesin might be related closely to blood feeding (Bensaci et al. 2012; de la Fuente
et al. 2006a; Lu et al. 2016).
As we showed, subA expression in the salivary glands and ovaries were higher than in
midguts and integument of both engorged and half-engorged ticks (p\ 0.01). Luet al.(2016) also reported a high level of subA transcription in salivary glands and ovaries in R.
haemaphysaloides, which was similar to our study, but its transcriptional level in the
midgut and integument was consistently high and not different from that in the salivary
gland and ovary (Lu et al. 2016). It was possible that subolesin expression varied between
tick species (Zivkovic et al. 2010). The subA expression pattern in the ovary might explain
why ticks that sucked blood from recombinant, subolesin immunized hosts showed reduced
fertility: perhaps, antibodies that bound with subolesin blocked its specific physiological
function in the ovary. In fact, one of the criteria for an effective vector-protective antigen
was that the formation of the antibody-antigen complex should disrupt the normal function
of the vector protein (Elvin and Kemp 1994). Because salivary glands and their secretions
played a critical role in pathogen transmission (Liu et al. 2014), related proteins in salivary
glands were considered to be potential target antigens for vaccine development. Previous
studies revealed that ticks submitted to RNA interference of subA had a lower intake of
blood (de la Fuente et al. 2006a). Together with our data, it seems possible that subolesin,
in addition to its function in the regulation of innate immunity and gene expression in
vectors, was involved in the regulation of feeding of ticks directly or indirectly. However,
those assumptions remain to be confirmed by trials in vivo.
Our results showed that subolesin, as well as its gene subA, were both conservative
among tick species that we tested. SubA expression in H. flava was higher after a blood
meal. In addition, subA expression was higher in salivary glands and ovaries than in any
other tissues that we tested. In conclusion, our data further indicated that subolesin is an
ideal candidate as an antigen target for development of a universal vaccine for the control
of ticks.
Acknowledgments This research was supported financially by a grant from the National Natural ScienceFoundation of China (No. 31372431).
References
Almazan C, Kocan KM, Bergman DK, Garcia-Garcia JC, Blouin EF, de la Fuente J (2003) Identification ofprotective antigens for the control of ixodes scapularis infestations using cDNA expression libraryimmunization. Vaccine 21:1492–1501
Almazan C, Blas-Machado U, Kocan KM, Yoshioka JH, Blouin EF, Mangold AJ, de la Fuente J (2005)Characterization of three ixodes scapularis cdnas protective against tick infestations. Vaccine23:4403–4416. doi:10.1016/j.vaccine.2005.04.012
Exp Appl Acarol (2016) 70:511–522 521
123
http://dx.doi.org/10.1016/j.vaccine.2005.04.012
Baneth G (2014) Tick-borne infections of animals and humans: a common ground. Int J Parasitol44:591–596. doi:10.1016/j.ijpara.2014.03.011
Bensaci M, Bhattacharya D, Clark R, Hu LT (2012) Oral vaccination with vaccinia virus expressing the tickantigen subolesin inhibits tick feeding and transmission of Borrelia burgdorferi. Vaccine30:6040–6046. doi:10.1016/j.vaccine.2012.07.053
Canales M, Almazan C, Naranjo V, Jongejan F, de la Fuente J (2009) Vaccination with recombinantBoophilus annulatus Bm86 ortholog protein, Ba86, protects cattle against B. annulatus and B.microplus infestations. BMC Biotechnol 9:29. doi:10.1186/1472-6750-9-29
de la Fuente J, Almazan C, Blas-Machado U, Naranjo V, Mangold AJ, Blouin EF, Gortazar C, Kocan KM(2006a) The tick protective antigen, 4D8, is a conserved protein involved in modulation of tick bloodingestion and reproduction. Vaccine 24:4082–4095. doi:10.1016/j.vaccine.2006.02.046
de la Fuente J, Almazan C, Blouin EF, Naranjo V, Kocan KM (2006b) Reduction of tick infections withAnaplasma marginale and A. phagocytophilum by targeting the tick protective antigen subolesin.Parasitol Res 100:85–91. doi:10.1007/s00436-006-0244-6
de la Fuente J, Almazan C, Naranjo V, Blouin EF, Kocan KM (2006c) Synergistic effect of silencing theexpression of tick protective antigens 4D8 and RS86 in Rhipicephalus sanguineus by RNA interfer-ence. Parasitol Res 99:108–113. doi:10.1007/s00436-006-0132-0
de la Fuente J, Moreno-Cid JA, Galindo RC, Almazan C, Kocan KM, Merino O, Perez de la Lastra JM,Estrada-Pena A, Blouin EF (2013) Subolesin/Akirin vaccines for the control of arthropod vectors andvectorborne pathogens. Transbound Emerg Dis 60(Suppl 2):172–178. doi:10.1111/tbed.12146
Elvin CM, Kemp DH (1994) Generic approaches to obtaining efficacious antigens from vector arthropods.Int J Parasitol 24:67–79
Goto A, Matsushita K, Gesellchen V, El Chamy L, Kuttenkeuler D, Takeuchi O, Hoffmann JA, Akira S,Boutros M, Reichhart JM (2008) Akirins are highly conserved nuclear proteins required for NF-kappaB-dependent gene expression in drosophila and mice. Nat Immunol 9:97–104. doi:10.1038/ni1543
Graf JF, Gogolewski R, Leach-Bing N, Sabatini GA, Molento MB, Bordin EL, Arantes GJ (2004) Tickcontrol: an industry point of view. Parasitology 129(Suppl):S427–S442
Ishikawa H (1977) Evolution of ribosomal RNA. Comp Biochem Physiol B Comp Biochem 58:1–7Liu XY, de la Fuente J, Cote M, Galindo RC, Moutailler S, Vayssier-Taussat M, Bonnet SI (2014) IrSPI, a
tick serine protease inhibitor involved in tick feeding and Bartonella henselae infection. PLoS NeglTrop Dis 8:e2993. doi:10.1371/journal.pntd.0002993
Lu P, Zhou Y, Yu Y, Cao J, Zhang H, Gong H, Li G, Zhou J (2016) RNA interference and the vaccine effectof a subolesin homolog from the tick Rhipicephalus haemaphysaloides. Exp Appl Acarol 68:113–126.doi:10.1007/s10493-015-9987-z
Rand KN, Moore T, Sriskantha A, Spring K, Tellam R, Willadsen P, Cobon GS (1989) Cloning andexpression of a protective antigen from the cattle tick Boophilus microplus. Proc Natl Acad Sci USA86:9657–9661
Wang D, Wang Y, Yang G, Liu H, Xin Z (2016) Ticks and tick-borne novel bunyavirus collected from thenatural environment and domestic animals in Jinan city, East China. Exp Appl Acarol 68:213–221.doi:10.1007/s10493-015-9992-2
Willadsen P, Smith D, Cobon G, McKenna RV (1996) Comparative vaccination of cattle against Boophilusmicroplus with recombinant antigen Bm86 alone or in combination with recombinant Bm91. ParasiteImmunol 18:241–246
Winnebeck EC, Millar CD, Warman GR (2010) Why does insect RNA look degraded? J Insect Sci 10:159.doi:10.1673/031.010.14119
Xu B, Liu L, Huang X, Ma H, Zhang Y, Du Y, Wang P, Tang X, Wang H, Kang K, Zhang S, Zhao G, WuW, Yang Y, Chen H, Mu F, Chen W (2011) Metagenomic analysis of fever, thrombocytopenia andleukopenia syndrome (FTLS) in Henan Province, China: discovery of a new bunyavirus. PLoS Pathog7:e1002369. doi:10.1371/journal.ppat.1002369
Ye L, Shang X, Wang Z, Hu F, Wang X, Xiao Y, Zhao X, Liu S, He F, Li F, Wang C, Jiang J, Lin J (2015) Acase of severe fever with thrombocytopenia syndrome caused by a novel bunyavirus in Zhejiang,China. Int J Infec Dis 33:199–201. doi:10.1016/j.ijid.2015.02.003
Yu YF (2015) Characterization and functional analysis of innate immunity associated molucules fromRhipicephalus haemaphysaloides tick. PhD dissertation, Chinese Academy of Agricultural Sciences
Zivkovic Z, Torina A, Mitra R, Alongi A, Scimeca S, Kocan KM, Galindo RC, Almazan C, Blouin EF,Villar M, Nijhof AM, Mani R, La Barbera G, Caracappa S, Jongejan F, de la Fuente J (2010) Subolesinexpression in response to pathogen infection in ticks. BMC Immunol 11:7. doi:10.1186/1471-2172-11-7
522 Exp Appl Acarol (2016) 70:511–522
123
http://dx.doi.org/10.1016/j.ijpara.2014.03.011http://dx.doi.org/10.1016/j.vaccine.2012.07.053http://dx.doi.org/10.1186/1472-6750-9-29http://dx.doi.org/10.1016/j.vaccine.2006.02.046http://dx.doi.org/10.1007/s00436-006-0244-6http://dx.doi.org/10.1007/s00436-006-0132-0http://dx.doi.org/10.1111/tbed.12146http://dx.doi.org/10.1038/ni1543http://dx.doi.org/10.1038/ni1543http://dx.doi.org/10.1371/journal.pntd.0002993http://dx.doi.org/10.1007/s10493-015-9987-zhttp://dx.doi.org/10.1007/s10493-015-9992-2http://dx.doi.org/10.1673/031.010.14119http://dx.doi.org/10.1371/journal.ppat.1002369http://dx.doi.org/10.1016/j.ijid.2015.02.003http://dx.doi.org/10.1186/1471-2172-11-7
Expression pattern of subA in different tissues and blood-feeding status in Haemaphysalis flavaAbstractIntroductionMaterials and methodsTick collectionTotal RNA extractionCloning the open reading frame (ORF) of subARapid amplification of cDNA ends (RACE) for subASubA expression in H. flava in different tissues and blood-feeding status
ResultsRNA extractionCloning the ORF of subACloning the full-length of subAAnalysis of ORF of subA and subolesin encodedSubA expression in H. flava in different tissues and blood-feeding status
DiscussionAcknowledgmentsReferences