Faithfulness and Infidelity: Homologous Recombination and DNA Double-Strand Break Repair in Mammalian Cells Ongoing projects Fidelity of recombination and DNA double-strand break repair in mammalian genomes At-risk DNA motifs in mammalian chromosomes Methods for making targeted alterations to a mammalian genome Influence of gravitational force on recombination and repair Effect of chemotherapy on genome stability Homologous Recombination: The exchange of information (nucleotides) between similar DNA sequences. Recombination is involved in: Genome maintenance -- DNA repair, replication rescue Generation of genetic diversity in meiosis Development of disease (cancer, hypercholesterolemia, age-related disorders) Gene targeting Homologous Recombination, Holliday Model crossover noncrossover (gene conversion) Homologous Recombination, Double-Strand Break Repair noncrossover crossover Problem: How does a cell balance the benefits of efficient DNA recombination & repair against the risk of deleterious rearrangements? How similar must two sequences be in order to undergo recombination in mammalian chromosomes? Recombination Rate ~ 134 bp Question: What cellular players are responsible for the exquisite sensitivity of recombination to mismatches ? Likely candidates -- DNA mismatch repair proteins Some known functions of eukaryotic MMR proteins Mutation avoidance (spell-checking) Antirecombination Prevention of homeologous recombination (in yeast and bacteria) Implicated in DSB repair in yeast Meiosis Promotion of meiotic crossovers Proper segregation of homologs Cell signaling of certain types of DNA damage Apoptosis/cell cycle checkpoints Mutations in certain MMR genes lead to hereditary nonpolyposis colorectal cancer (HNPCC) _________________________ Eukaryotic MutS and MutL homologs: MutS homologs MutL homologs S. cerevisaeMammalian MSH1 MSH2 MSH3 MSH4 MSH5 MSH6 MSH2 MSH3 MSH4 MSH5 MSH6 MLH1 PMS1 MLH2 MLH3 MLH1 PMS2 PMS1 MLH3 Substrates to measure homologous and homeologous recombination: B hygneotk1 BHH B hygneotk2tk1 BHH Homologous donor: Homeologous donor: Homologous and Homeologous Recombination Frequencies in Mlh1-/- Mouse Embryonic Fibroblasts Homologous and Homeologous Recombination Frequencies in Msh2-/- Chinese Hamster Ovary Cells B hygneotk1 B BH neotk1 B Screening for gene conversions versus crossovers: 3.9 kb Gene conversion: Crossover (pop-out): B 3.9 kb 4.5 kb Representative Southern Blot Analysis of Recombinants (BamHI digests) crossover gene conversion Conclusion: A single defect in MMR gene Msh2 or Mlh1 does not lift the barrier to spontaneous homeologous recombination in a mammalian genome What about a possible role for MMR proteins in double-strand break repair? Accurate Double-Strand Break Repair via Homologous recombination noncrossover crossover Error-prone Nonhomologous End-Joining (NHEJ) Does MMR have a role in error- prone DSB repair via NHEJ? t Repair by NHEJ Nonfunctional fusion gene (G418 S ) I-SceI tk neo k t k DSB induction neo Functional fusion gene (G418 R ) neo NHEJ Events-Representative PCR Samples Sequence 5 to junctionSequence 3 to junctionDel size (L/R)No. clones Sequences of Mlh1 +/+ repair junctions: Sequences of Mlh1 -/- repair junctions Sequence 5 to junctionSequence 3 to junction Del size (L/R) No. clones >100 Frequency of NHEJ events Number of base pairs deleted Deletion Sizes Associated with NHEJ Mlh1 -/- Median Deletion = 1 bp Mlh1 +/+ Median Deletion = 46 bp Mlh1-/- Mlh1 + /+ NHEJ Junctions in MMR Proficient Cells Display a Greater Usage of Terminal Homology Conclusions No evidence that Mlh1 status affects overall efficiency of NHEJ NHEJ repair junctions in Mlh1+/+ cells display larger deletions and more terminal microhomology relative to repair junctions in Mlh1-/- cells Mlh1+/+ cells display a greater frequency of complex rearrangements in association with DSB repair than do Mlh1-/- cells. (Could this be related to the stable karyotypes of HNPCC tumors?) Conclusions, continued Both Mlh1+/+ and Mlh1-/- cells are proficient at precise ligation Msh2+/+ fibroblasts display more microhomology at NHEJ repair junctions than do Msh2-/- fibroblasts MMR Collapse of joined intermediate with concomitant end trimming or unwinding MMR binding to mismatched bases in overlapped ends Joining of intermediates with suitable homology Gap filling and ligation Model for Inhibition of NHEJ by MMR Does MMR play a role in accurate recombinational repair of a DSB? Substrates to measure DSB-induced homologous and homeologous recombination: B hygneotk1 BHH B hygneotk2tk1 BHH I-SceI Homologous donor: Homeologous donor: I-SceI Spontaneous and DSB-induced Homologous Recombination Frequencies in Msh2+/+ and Msh2-/- Chinese Hamster Ovary Cells Conclusions: A DSB can induce high levels of HR in Msh2+/+ and Msh2-/- CHO cells Gene conversions predominate among spontaneous or DSB-induced HR events in MMR proficient or deficient cells Gene conversion tracts are longer in Msh2-/- cells than in Msh2+/+ cells To our knowledge, our work provides the first unequivocal demonstration of accurate recombination as a major DSB repair pathway in a mammalian cell Future work Investigate the effects of additional MMR mutations or combinations of MMR mutations in the control of recombination fidelity. Investigate the role of RecQ family helicases (BLM and WRN) in recombination fidelity and in DSB repair. Determine if a DSB can by itself provoke homeologous recombination. Future work, continued Explore how various genes associated with genome maintenance impact DSB repair pathways in mammalian chromosomes. (Some genes of interest-- p53, BLM, WRN, Ku70/80, BRCA1&2) Useful approaches use mutant (or K0d) human and rodent cell lines, and RNAi Acknowledgments Laura Bannister Yunfu Lin Tamas Lukacsovich Jason Smith from Christmann et al. (2003) Toxicology 193:3-34 Screen for homologous recombination: Recipient: HSV-tk1 I-SceI catatcgggggggaggctgggagctTAGGGATAACAGGGTAATAGCTcacatgccccgccc catgtcgggggggaggctgggagttcacatgccccgccc Recombinant sequence: Recipient sequence: Donor: HSV-tk1 AluI Donor sequence: catgtcgggggggaggctgggagtt cacatgccccgccc Screen for loss of AluI sites: from Schofield and Hsieh (2003) Annu. Rev. Microbiol. 57: This end of newly synthsized DNA can be re-joined to other side of DSB by NHEJ HR, revisited CAGGGTAATCTAGATAGGGATAA (-23 bp) GTAGGGATAACAGGGTAATCAGCT (+24 bp) DSB induction at both I-Sce I sites TAGGGATAA precise ligation of DNA termini I-Sce I Assay for high-fidelity DSB repair (precise ligation) GTAGGGATAACAGGGTAATCTAGATAGGGATAACAGGGTAATCAGCT CATCCCTATTGTCCCATTAGATCTATCCCTATTGTCCCATTAGTCGA I-Sce I Xba I I-Sce I ATCCC TATTGTCCCATTA CAGGGTAAT (+47 bp) ____________ Ways in Which MMR May Block Homeologous Recombination