Final Formatted Thesis(1)

7/31/2019 Final Formatted Thesis(1)

1/65

Effects of the Ccnb1ip1mei4 Allele on Meiotic

Recombinatorial Protein Expression in Male Mice

Rebecca Swartz

May 1, 2009

Dr. Jeremy O. WardThesis Advisor

Submitted in partial fulfillment of the requirement for

High Honors

in

Molecular Biology and Biochemistry

Middlebury College

Committee in Charge

Approved:

_____________________________________Roger K. Sandwick

_____________________________________Susan M. DeSimone

_____________________________________


2/65

Jeremy O. Ward

2


3/65

Acknowledgements

First and foremost, I would like to thank my thesis advisor, Dr. Jeremy Ward. He

has provided an incredible experience in an undergraduate laboratory over the past year,

and I could not have asked for a more positive research experience for my thesis. His

guidance allowed me to come to my own conclusions so that I truly understood the biology

behind my work, and it helped me develop the thinking tools that will be invaluable in the

future.

Second, I thank my thesis committee members, Dr. Susan DeSimone and Dr. Roger

Sandwick, for their input and helpful suggestions not only in the process of completing this

thesis but also over my past years at Middlebury. Roger, as my academic advisor, has

helped me make decisions that have shaped my education and allowed me to gain from

Middlebury what I wanted in my college experience. Susan, as my first lab instructor, laid

the basis for my love of lab, which was only enhanced as a TA for BIOL145.

To my lab mates, Jeff, Sky, and Nancy, thanks for all of the laughs and

encouragement throughout the year. You guys have been a large part of making this

experience positive, and it was a joy to do science with you.

Finally, thank you to my family and friends. My parents fostered scientific

curiosity in me from a young age, and I suspect that a large part of why I love science is

because they both do, too. A special thank you to my mom for reading my thesis and forproviding feedback. To my friends, you all are incredible and I thank you for putting up

with my craziness and loving me despite it.

Thank you to Joanna Shipley and Judy Mayer of the Biology and Chemistry

departments, respectively. Thanks for all of your help over the years. I would also like to

thank Vicki Major, Stephanie Pierce, and everyone at the Middlebury College Animal

Housing Facilities. Finally, I would like to thank Dr. Andi Lloyd for her help with

statistical analysis and the Senior Work Fund, the Middlebury College Biology

Department, and NIH (grant awarded to JOW) for funding.

i


4/65

AbstractEffects of the Ccnb1ip1mei4 Allele on Meiotic Recombinatorial Protein Expression in

Male Mice

The recessive mei4 allele results in the sterility of both male and female

homozygous mice due to failed homologous recombination during prophase I of meiosis.

The mei4 mutation affects the protein expression of mCCNB1IP1, a putative E3 ubiquitin

ligase that helps regulate proper progression through meiosis I. During spermatogenesis,

spermatocytes from homozygous mutants arrest during metaphase I due to a defect in

homologous recombination. Prior data show that the proteins CDK2, MLH1, and MLH3

do not localize to sites of recombination in mei4/mei4 mice. This further characterized the

effects that the mei4 allele has on recombinatorial protein localization, as well as

determining if it affects gene expression or protein expression. The six proteins under

investigation are CDK2, H2AX, MSH4, MSH5, MLH1, and MLH3, all necessary for

proper homologous recombination in meiotic cells. Qualitative reverse transcriptase PCR

show all six genes are expressed in both wild type and mutant testes. Western blotting

shows the CDK2, MLH1, and H2AX proteins are expressed in mutant testes similarly to

wild type testes. Finally, H2AX is phosphorylated normally in response to double strand

breaks in mei4 homozygous spermatocytes. However, a significantly elevated proportion

ofmei4/mei4 spermatocytes have chromatin bound H2AX in pachynema when comparedto wild type pachytene spermatocytes. These findings suggest that mCCNB1IP1 has an

earlier role in recombination than previously believed, and it may facilitate H2AX

removal from chromatin.

ii


5/65

Table of Contents

Chapter 1: Introduction.........................................................................................................1

1.1 Spermatogenesis...........................................................................................................11.2 Meiosis.........................................................................................................................4

1.3 Prophase I.....................................................................................................................5

1.4 The Mechanism of Meiotic Recombination................................................................61.5 Recombinatorial Proteins.............................................................................................8

1.6 CCNB1IP1 and the mei4 Mutation............................................................................13

Chapter 2: Materials and Methods....................................................................................19

2.1 Qualitative RT-PCR...................................................................................................19

2.1.1 RNA Extraction................................................................................................19

2.1.2 cDNA Synthesis................................................................................................20

2.1.3 Primer Design...................................................................................................202.1.4 PCR...................................................................................................................21

2.2 Western Blotting........................................................................................................21

2.2.1 Protein Extraction.............................................................................................21

2.2.2 Protein Quantification.......................................................................................222.2.3 SDS-PAGE.......................................................................................................22

2.2.4 Transfer.............................................................................................................242.2.5 Probing for Specific Proteins............................................................................24

2.2.6 Visualization of Protein....................................................................................25

2.2.7 Stripping and Re-Probing the Membrane.........................................................252.3 Chromosome Spreads................................................................................................25

2.3.1 Microspreading Meiotic Nuclei........................................................................25

2.3.2 Immunolabeling................................................................................................27

2.3 Mice............................................................................................................................28

Chapter 3: Results................................................................................................................29

3.1 Expression of Genes Encoding Recombinatorial Proteins........................................29

3.2 Expression of Recombinatorial Proteins...................................................................293.3 Localization of H2AX on Meiotic Chromosomes...................................................30

..........................................................................................................................................34

3.4 Quantification ofH2AX Presence in Pachytene Spermatocytes............................35Chapter 4: Discussion..........................................................................................................38

4.1 Meiotic Genes Are Expressed in mei4/mei4 Mice....................................................38

4.2 CCNB1IP1 May Affect CDK2 but not MLH1 orH2AX Protein Expression........394.3 H2AX Phosphorylation Persists into Pachynema in mei4/mei4 Mice....................41

4.4 A Potential New Model for CCNB1IP1s Role in Meiosis......................................44

4.5 Future Directions........................................................................................................48

Bibliography.........................................................................................................................52

iii


6/65

Table of Figures

Figure 1.1 Stages and Progression of Spermatogenesis. (A) Artistic representation of

the seminiferous tubule, in which spermatogenesis occurs. Spermatogonia are located

closest to the basal lamina and migrate inward toward the inner lumen as they

develop into spermatocytes, then spermatid, and finally differentiating spermatid.The spermatozoa are then released into the lumen. (B) Schematic showing the

divisions and differentiation of germ cells in males. Spermatogonia mitotically divide

until they enter meiosis and develop into spermatocytes. After the completion of

meiosis I, they are secondary spermatocytes and enter the second meiotic division.

This renders haploid spermatids that then differentiate into mature sperm. Figure

adapted from Molecular Biology of the Cell 53 (Alberts 2002)........................................2

Figure 1.2 Chromosomes in mei4/mei4 Spermatocytes Contain RAD51 Foci in

Zygonema but Lack MLH3 and MLH1 Foci in Pachynema. (A and B) The DSB

repair protein RAD51 appears in foci (green) on zygotene chromosomes in both

mei4/+ and mei4/mei4 chromosome spreads counter labeled with anti-SYCP3 (red).

(C-F) Chromosome spreads from heterozygous (mei4/+) and mutant (mei4/mei4)spermatocytes were labeled with antibodies to MLH3 (green [C and D]) or MLH1

(green [E and F]) and counter-labeled with anti-SYCP3 (red). MLH3 and MLH1 foci

(white arrows) are present on mei4/+ chromosomes (C) and (E) but not on mei4/mei4

chromosomes (D) and (F). Figure and caption taken from Ward et al. (2007)............15

Figure 1.3 CDK2 Does Not Localize to Interstitial Sites on Synapsed mei4/mei4

Bivalents during Pachynema. (A) Wild-type (+/+) spermatocyte chromosome spread

labeled with antibodies against CDK2 (green) and SYCP3 (red). CDK2 localizes to

telomeric foci (open arrowheads), along the asynapsed axes of the sex chromosomes

(closed arrowheads), and at interstitial sites (white arrows) along synapsed wild-type

bivalents in pachynema. (B) mei4/mei4 spermatocyte chromosome spread labeled as

in (A) showing absence of CDK2 localization at interstitial loci. Despite loss at

interstitial sites, CDK2 localization is observed at telomeric foci (open arrowheads)

and at loci along the sex chromosomes (closed arrowheads). Figure and caption from

Ward et al. (2007).................................................................................................................16

Figure 1.4 Proposed Mechanism: HEI10mei4 Mediated Failure to Degrade CCNB3

Leads to Inability to Recruit MLH3 and MLH1 Resulting in Failed Recombination.

(A) During normal Prophase I, subsequent to DSB repair via RAD51, HEI10 mediates

the degradation of CCNB3 (B3) freeing CDK2 to associate with interstitial sites on

chromosome cores in pachynema. Subsequently (or contemporaneously), MLH3 and

MLH1 are recruited to recombination nodules containing CDK2. In diplonema,

MMR has occurred, MLH3, MLH1, and CDK dissociate from the cores and

chiasmata maintain homolog association until the onset of anaphase I. (B) In

mei4/mei4 animals, DSB formation and RAD51 foci occur normally. Inability of

HEI10mei4 to associate with B3 leads to the accumulation or mislocalization of B3

and the titration of the available CDK2. CDK2 is unable to associate with sites of

recombination, as are MLH3 and MLH1. In our model, failure to correct mismatches

during Holiday junction resolution leads to incomplete recombination intermediate

resolution and arrest at the metaphase I spindle checkpoint. Figure and caption from

Ward et al. (2007).................................................................................................................17

iv


7/65

Figure 3.5 Meiotic Genes Are Expressed in WT and mei4/mei4 Testes. Qualitative

RT-PCR using primers designed specifically for the cDNA transcripts of cdk2, h2ax,

msh4, msh5, mlh1, and mlh3 reveals that all of these genes are expressed in adult WT

(+/+) and mutant (-/-) testes. The two products amplified by the cdk2 primers were

expected and represent two different transcripts for cdk2 that have been

characterized in mice. (MW=molecular weight marker. The band shown representsa DNA fragment of approximately 1018 base pairs)........................................................31

Figure 3.6 Recombinatorial Proteins Are Expressed in WT and mei4/mei4 Testes.

Western blots were performed using antibodies against CDK2, MLH1, and H2AX todetermine protein expression in WT (+/+) and mei4/mei4 (-/-) testes. Bands with an

asterisk (*) represent specific antibody binding. All other bands are believed to be

non-specific. (A) CDK2 protein expression: One non-specific band appears in WT

extracts and no non-specific bands appear in mei4/mei4 extracts. The WT 30 kDa

CDK2 band is a doublet and the mei4/mei4 30 kDa CDK2 is a single band. The

bottom band of the WT doublet is not present in mei4/mei4 extracts. (B) MLH1

protein expression: The band at approximately 81kDa is considered to be specific for

MLH1. It is expressed in equal amounts in both WT and mutant testes. Several non-specific bands appear both in WT and mei4/mei4 extracts. (C) H2AX expression isequal in WT and mei4/mei4 testes. The antibody binds a 17kDa protein, the size of

H2AX. Alpha-tubulin was used as a loading control and shows even protein loading.

................................................................................................................................................32

Figure 3.7 H2AX Is Initially Phosphorylated Normally But Remains Chromatin

Bound Into Pachynema. (A and B) Phosphorylated H2AX staining (green) is present

throughout the cell on leptotene chromosome spreads counter-labeled with SCP3

(red) in both WT (+/+) and mei4/mei4 (-/-) spermatocytes. (C and D) H2AX stainingis profuse during zygonema in both WT and mei4/mei4 spermatocytes. (E) Pachytene

WT spermatocytes show H2AX only at the XY body. No H2AX is bound tosynapsed homologous chromosomes. (F) Two mei4/mei4 pachytene spermatocytes

both disply chromatin bound H2AX staining. Distinct H2AX foci are present alongthe paired chromosomes. XY body H2AX staining is comparable to that of the WTspermatocytes. (G and H) By diplonema, mei4/mei4 H2AX staining has returned tothat of WT cells. Phosphorylated H2AX is only present at the XY body. No H2AXstaining is seen along the now de-synpased chromosomes, and it is not present at sites

of crossover............................................................................................................................33

Figure 3.8 Mei4/mei4 Spermatocytes Have Significantly Elevated Proportions of

Chromatin Bound H2AX Compared to WT Spermatocytes in Both Mid- and LatePachynema. (A) A representative image of a WT spermatocyte in mid-pachynema,

showing no condensation of the telomeres. (B) A representative image of a WT

spermatocyte in late pachynema, showing bulbous temomeres that have condensed.(C) The proportion of WT (grey) and mei4/mei4 (blue) mid-pachytene and late

pachytene spermatocytes with chromatin bound H2AX. The proportion ofmei4/mei4 mid- and late pachytene spermatocytes with staining was significantly

elevated when compared with WT cells (*p


8/65

crossover products are rarely observed when repair follows this pathway. (B) The

synthesis-dependent strand annealing model of DSB repair do not show D-loop

formation or double Holliday junctions. The invading single-stranded DNA reanneals

to its sister strand and is used as a template for DNA synthesis and repair. This

pathway only yields non-crossover products. Figure adapted from Smith and Cromie

(2007)......................................................................................................................................46Figure 4.10 New Proposed Mechanism for CCNB1IP1 Function in Meiosis. In this

putative model, CCNB1IP1 targets H2AX. (A) In normal meiotic progressionthrough prophase I, CCNB1IP1 targets H2AX, leading to its ubiquitination at sites

proximal to DSBs. This ubiquitination results in H2AX expulsion from thechromatin, allowing the MSH4/MSH5 heteroduplex to bind and stabilize Holliday

junctions. The MSH4/MSH5 duplex combined with the stabilization of Holliday

junctions and the D-loop leads to the recruitment of CDK2, MLH1, and MLH3.

These proteins facilitate DNA repair and chiasmata formation. (B) In mei4/mei4

spermatocytes, CCNB1IP1 is not present, so H2AX is not ubiquitinated nor expelledfrom the chromatin, so the MSH4/MSH5 heteroduplex cannot bind. Consequently,

CDK2, MLH1, and MLH3 fail to localize to the chromatin, and recombination andchiasmata formation fails. Instead DSB repair follows the SDSA pathway, leading to

non-crossover product formation and no chiasmata........................................................48

vi


9/65

Table of Tables

Table 1.1 Recombinatorial proteins of interest. The proteins investigated in this

study, their function, stage in which they appear, and the phenotype of mice null in

the proteins encoding gene.................................................................................................10

Table 2.2 Primers used for RT-PCR of cDNA from total testes RNA. The sequencesfor each of the primers, forward and reverse, is provided, as well as the expected

product size in base pairs of the specific amplicon of each gene.....................................23

Table 2.3 Antibodies used in western blotting and fluorescent labeling of

chromosome spreads. All antibodies were stored as per manufacturers instructions.

................................................................................................................................................26

vii


10/65

Chapter 1: Introduction

This study targets enhancing the understanding of fertility and the genetic factors

that contribute to infertility. Couples who fail to conceive for one year or more arediagnosed as subfertile. Approximately 20-25% of cases of subfertility are due to

infertility of the male partner alone. Forty to fifty percent of these cases are idiopathic, in

that no exact cause can be determined other than a general sperm defect . Case studies

have implicated genetic factors, specifically various recessive alleles, in idiopathic male

subfertility. Furthermore, a combination of genes is likely responsible for subfertility

rather . These genetic abberations lead to defects in spermatogenesis, leading to inviable

gametes .

Mice are commonly used as mammalian models for the study of human fertility.

Mice were exposed to mutagens that created random mutations throughout the genome,

and a forward genetic screen was performed in order to isolate mice with mutations that

resulted in infertility. The mei4 mutation was identified as an allele in the murine ortholog

of the human enhancer of invasion 10 (Hei10) gene, now known as ccnb1ip1. Both male

and female mei4 homozygous mice are sterile . Because of this sterile phenotype resulting

from a homozygous genotype, the mei4 mutation was selected for further characterization

and study.

1.1 Spermatogenesis

Spermatogenesis is the process through which viable spermatocytes are produced

from primordial germ cells (Figure 1.1). The first round of spermatogenesis in mice occurs

as a wave in which all cells are synchronized in their progression through the cell cycle.

After this first round, spermatogenesis continues in the seminiferous tubules throughout the

adult life of the mouse; however, the cell divisions are no longer synchronized. Duringspermatogenesis, cells are characterized into four types of spermatogenic cells:

spermatogonia, spermatocytes, spermatids, and spermatozoa. These four cell types are

further divided into substages, which differ with each category of cell . The beginning of

spermatogenesis in mice is marked by the division of gonocytes four days after birth

(Vergouwen et al. 1991), producing A spermatogonia. Gonocytes are germ cells that have

1


11/65

migrated to the seminiferous cords within the mouse testis . Some of these A

spermatogonia then differentiate into A1 spermatogonia in the seminiferous tubules. The

other A spermatogonia are stem cells that mitotically divide indefinitely (. After the

differentiating A spermatogonia undergo six further mitotic divisions, each producing a

different substage of spermatogonia (A2, A3, A4, intermediate, and B), the cells enter

meiosis and are termed spermatocytes . Upon completing meiosis, the spermatocytes

become haploid spermatids. These rounded spermatids develop and elongate into

spermatozoa in the seminiferous epithelium and migrate into the tubule lumen . In all,

murine spermatogenesis takes approximately four weeks to complete. The first two weeks

are devoted to meiosis, and the following two weeks to spermatid maturation .

As previously mentioned, the first round of murine spermatogenesis is

synchronized. Prior to the third day postpartum, all of the spermatogonia are type A1.

Starting at day 3, the spermatogonia begin to differentiate into spermatocytes. Cells first

enter meiosis at day 8 postpartum, and the completion of meiosis takes 13 days. Half of

the spermatogenic cells are in pachynema (the third phase of prophase I, after leptonema

and zygonema) in days 17-19. Meiosis is not complete until after day 20, when the first

round spermatids are observed .

Figure 1.1 Stages and Progression of Spermatogenesis. (A) Artistic representation of the seminiferous

tubule, in which spermatogenesis occurs. Spermatogonia are located closest to the basal lamina and

migrate inward toward the inner lumen as they develop into spermatocytes, then spermatid, and finallydifferentiating spermatid. The spermatozoa are then released into the lumen. (B) Schematic showing the

divisions and differentiation of germ cells in males. Spermatogonia mitotically divide until they enter

meiosis and develop into spermatocytes. After the completion of meiosis I, they are secondary

spermatocytes and enter the second meiotic division. This renders haploid spermatids that then

differentiate into mature sperm. Figure adapted fromMolecular Biology of the Cell53 (Alberts 2002).

2


12/65

3


13/65

1.2 Meiosis

Meiosis is the process through which cells are reduced from a diploid chromosome

number to the haploid number found in germ cells of sexually reproducing organisms.

Unlike mitosis, meiosis involves two cell divisions; however, the genome is replicated only

once prior to division, thus rendering haploid cells after the two successive cell divisions.

The two cell divisions are termed meiosis I (MI) and meiosis II (MII), and each consists of

a round of prophase, metaphase, anaphase, telophase, and cytokinesis. Following S phase

in mitotic cells (the phase of mitosis in which genome replication occurs), sister chromatids

are separated into two daughter cells, each of which are diploid . In meiosis, on the other

hand, homologous chromosomes (one maternal and one paternal) are segregated in the MI

division, and then sister chromatids are separated in the MII division . Thus, MII is more

similar to mitosis than MI, though it does not directly follow S phase.

During MI, the meiotic cell must ensure that the homologous chromosomes are

separated rather than the sister chromosomes. To accomplish this, the homologous

chromosomes align and pair through protein associations. This interaction between

homologues marks prophase I . The specific association that occurs during prophase I

facilitates homologous recombination, important for increasing genetic diversity within a

population and ensuring proper progression through MI. During homologousrecombination, segments of DNA that are homologous on the maternal and paternal

chromosome arms are exchanged. This exchange of genetic material requires the close

physical association of the chromosomes, which is facilitated and stabilized by specialized

proteins. Furthermore, the association of the homologues allows them to properly align on

the metaphase plate during metaphase I .

Before anaphase I can commence, the homologous chromosomes must dissociate.

The proteins that stabilize homologue interactions dissociate, while the proteins stabilizing

the cohesion between sister chromatids remain . The transition from metaphase I to

anaphase I is controlled by a spindle checkpoint. This checkpoint further ensures the

proper segregation of chromosomes in MI. Interestingly, studies suggest that oocytes are

capable of passing the spindle checkpoint, even when mutations or damage prevent proper

alignment and segregation of homologous chromosomes. Spermatocytes with misaligned

4


14/65

homologous chromosomes, however, arrest at metaphase I and eventually undergo

apoptosis . After anaphase I, telophase I and cytokinesis produce two daughter cells that

each contain one pair of sister chromatids connected at centromeres. In males, the two

daughter cells then proceed through MII, similar mechanistically to mitosis, and four

unique haploid daughter cells result .

1.3 Prophase I

As previously mentioned, prophase I plays a unique role in meiosis because it is

primarily during this phase that the proper segregation of homologous chromosomes is

ensured. During prophase I, homologous chromosomes synapse and recombine.

Homologous chromosomes associate with each other through a protein complex called the

synaptonemal complex (SC). The SC only forms in meiotic cells, and the different stages

of its formation define the five different sub-stages of prophase I: leptonema, zygonema,

pachynema, diplonema, and diakenesis .

Leptonema, the first substage of prophase I, is marked by the beginning of SC

formation. SCs are composed of three different protein elements: two lateral elements

(LE) and one central element (CE). During leptonema, the protein SCP3 begins to form

the lateral elements. Until fully formed, these lateral elements are termed axial elements

(AE). The AE begin to associate along each of the two pairs of sister chromatids,preparing them for synapsis. The end of leptonema and progression into zygonema is

marked by the completion of the LE, as a continuous filament of SCP3 along the sister

chromatids has formed .

Zygonema is defined by the initiation of homologous chromosome association.

The chromosomes align with each other, and the central element, composed of the protein

SCP1, forms. The formation of the CE results in the homologous chromosomes being

attached through a protein network. SCP1 acts as a zipper that effectively zips the two

SCP3-coated chromosomes together. The LE and CE combine to make the fully formed

SC .

The next stage of prophase I, pachynema, is characterized by the complete

formation of the SC, resulting in complete synapsis along the entire length of the

homologous chromosomes. Pachynema is the longest stage of prophase I and includes an

5


15/65

important checkpoint, the pachytene checkpoint . This checkpoint ensures that the

homologous chromosomes are fully synapsed and that DNA repair via homologous

recombination has occurred. A cell cycle checkpoint at this stage of meiosis is important

because synapse and recombination result in chiasmata, a structure that keeps the

chromosomes connected through prophase I, facilitating proper alignment in metaphase I.

This alignment leads to the proper segregation of chromosomes in MI. Without this

checkpoint, the cell would have no way of ensuring that each daughter cell has the proper

number of chromosomes, which would lead to aneuploidy in some cells. Significantly, the

pachytene checkpoint in budding yeast is only activated if recombination has been initiated

but not completed. If no recombination occurs, the cell continues through prophase I

without activating the checkpoint .

The fourth stage of prophase I is diplonema. Diplonema is marked by the

dissolution of the CE. As this occurs, the homologous chromosomes dissociate from one

another. However, because of the recombination that occurred during pachynema, the

homologous chromosomes remain connected at points of reciprocal recombination, termed

chiasmata. SCP1 thus remains associated with the LE at these points of genetic crossover.

Components of the LE do not dissociate during diplonema.

As the SC continues to dissemble and the LE dissociate from the chromosomes, the

spermatocytes enter diakinesis. During this final stage of prophase I, the chromosomes

migrate toward the metaphase plate, at which point the cell enters metaphase I of meiosis.

The homologous chromosomes remain connected at chiasmata until the cell enters

metaphase I and the chromosomes are properly aligned on the metaphase plate .

1.4 The Mechanism of Meiotic Recombination

During prophase I, a series of protein-mediated events leads to recombination, the

formation of crossover products, and chiasmata. Homologous recombination begins with

the production of DNA double strand breaks (DSBs) by the protein SPO11, a homodimeric

topoisomerase . These DSBs occur throughout the genome. Mice that lack SPO11 are

infertile and their homologous chromosomes show a failure to synapse. This indicates that

the synapsis of homologous chromosomes requires the initiation of recombination through

the formation of DSBs . After the DSBs are established, SPO11 remains covalently

6


16/65

attached to the 5 end of the DNA, though the removal of SPO11 is necessary for the

progression of recombination and the repair of the DSB. SPO11 is removed from DNA

through the excision of the DNA to which it is attached. Mre11 is thought to catalyze this

reaction through its endonuclease activity . This nuclease activity may assist in processing

the 5 ends of the DSBs, leaving 3 single-strand over-hangs.

In order for genetic exchange to occur, the 3 single stranded DNA overhang from

one chromosome must invade the same region on its homologous chromosome. DMC1

and RAD51 are the proteins that primarily catalyze strand invasion between homologous

chromosomes, which ultimately leads to the formation of Holiday junctions . Together,

these two proteins are components of early nodules. Early recombination nodules form at

sites of DSBs and are early markers for sites of recombination. They first begin to appear

in late leptonema and zygonema. As the homologous chromosomes synapse, early

recombination nodules are replaced by late recombination nodules in pachynema.

Importantly, not all early nodules become late nodules. This means that not every DSB

that is created by SPO11 results in homologous recombination and crossover product

formation. Many more DSBs are created than are resolved as crossover products through

recombination. Late nodules are composed of meiotic proteins other than DMC1 and

RAD51. Though the composition of late nodules has not been clearly elucidated, data

suggest that the mismatch repair proteins MSH4, MSH5, and MLH1 are good candidates.

These proteins act in the same meiotic pathway, that of crossover product formation, and

mutants lacking one of the three proteins have a decreased frequency of crossover products.

Additionally, late nodules mark the sites of crossover events during pachynema .

DSBs caused by SPO11 lead to two types of products: crossover and noncrossover.

These have been proposed to have two different mechanisms and functions in mammals,

and the pathway that the repair of a DSB takes is determined early in recombination. Both

crossover and noncrossover products are formed during pachynema, though they require

different proteins to form . Crossover products are of greater interest than noncrossover

products in this study because they result in the eventual formation of chiasmata and are

important for correct chromosome segregation during meiosis. Thus, crossover products

are important when examining defects in pathways associated with homologous

recombination.

7


17/65

1.5 Recombinatorial Proteins

Undergoing a very distinct process, meiotic cells, particularly those in meiosis I,

specifically express proteins important for proper progression and completion of this

process. Many of these proteins function in meiotic synapsis and recombination.,

Depending on their function and in which phase of meiosis (specifically prophase I) they

are expressed, meiotic proteins fall into four categories: synaptonemal complex proteins,

pre-synaptic proteins, post-synaptic proteins, and proteins that form foci at crossover sites .

Some of the synaptonemal proteins, SCP1 and SCP3, have already been introduced. The

proteins MSH5, MSH4, MLH3, MLH1, CDK2, and H2AX are of particular interest in this

study.

MSH5 is a mammalian MutS homolog. MutS is a bacterial DNA mismatch repair

protein; however, MSH5 is only expressed in meiotic cells and does not function in

mismatch repair . Rather, it assists in crossing-over during recombination; making MSH5

integral to proper progression through meiosis. Msh5-/- mice are sterile, as their testes

contain no epididymal spermatozoa. Spermatogenesis in these mice proceeds to the

formation of type A spermatogonia; however, it arrests before pachynema . After arrest,

the spermatogonia undergo apoptosis so that essentially no spermatogenic cells remain in

adult msh5-/- mice . Studies have shown that the msh5-/- meiotic arrest in pachynema is

due to aberrant SC formation . MSH5 seems to be a pre-synaptic protein because it first

appears before synapsis of homologous chromosomes. Data also suggest that MSH5

associates with chromosomes after recombination DSB formation and initiation because

Rad51 is still shown to localize to unsynapsed chromosomes in msh5-/- mice . Taken

together, these data suggest that MSH5 plays a role in synapse formation and possibly in

recombination intermediate formation .

Another MutS homolog specifically expressed in meiotic cells is MSH4. MSH4

and MSH5 form a heterodimer in yeast so the same may be true in mice. This possibility is

supported by data showimg that in male mice, MSH4 is only expressed in the testes and

functions in the same pathway as MSH5. However, it associates with chromosomes later

than MSH5. Both of these MutS homologs are required for proper progression through

meiosis. Because they act in the same pathway, many of the phenotypes of the msh4-/-

mutants are the same as those of the msh5-/- mutants. Indeed, both male and female

8


18/65

msh4-/- mice are sterile and have aberrant homologous chromosome pairing. Kneitz et al.

(2000) found that MSH4 co-localizes with the SC in early prophase I through mid-

pachynema when the foci begin to decrease. Furthermore, MSH4 may have an additional

role later in meiosis related to the resolution of recombination intermediates. This

hypothesis arises from work in yeast in which the absence of MSH4 does not affect

synapsis but results in a decreased frequency of crossover products. Additionally, MSH4

foci appear on pachytene chromosome spreads from wild-type mice .

While MSH4 and MSH5 act in the same pathway, MSH4 also interacts with MLH3

and MLH1 . Interestingly, MLH3 and MLH1 do not co-localize to all of the MSH4 foci.

Only a small portion of MSH4 foci become MLH3-MLH1 foci. This suggests that the

MSH4-MSH5 complex recognizes many DSBs, and the MLH1-MLH3 complex then

localizes to and stabilizes some of these foci, which leads to genetic crossover sites. The

DSBs at unstabilized MSH4-MSH5 foci are repaired via noncrossover repair .

MLH3 foci first begin to appear early in pachynema and continue to be present into

early diplonema . Thus, it appears that as MSH4-MSH5 foci are diminishing, MLH3

replaces them at locations of crossover recombination. To further

9


19/65

Table 1.1 Recombinatorial proteins of interest. The proteins investigated in this study, their function,

stage in which they appear, and the phenotype of mice null in the proteins encoding gene.

10

PROTEIN RECOMBINATORIAL

FUNCTION

STAGE OF

ACTIVITY

NULL MUTANT

PHENOTYPE

MSH5 Crossing over Zygonema Sterility: early

pachytene arrest

MSH4 Crossing over Late zygonema Sterility: pachytene

arrestMLH3 DNA mismatch repair Early pachynema Sterility: metaphase

I arrest

MLH1 DNA mismatch repair Pachynema Sterility: pachytene

arrest

CDK2 Unknown Pachynema Sterility: pachytene

arrest

H2AX DSB detection Late leptonema andzygonema

Male: earlypachytene arrest

Female: no arrest


20/65

elucidate the role of MLH3 in meiosis, mlh3-/- mice have been studied. These mice, both

male and female, are infertile; however, they do not display a predisposition to cancers as

might be expected given the mismatch repair activities of MLH3. This suggests that

MLH3 does not act in mismatch repair pathways outside of meiotic recombination. Unlike

in msh4-/- and msh5-/- mice, mlh3-/- spermatogenesis does not arrest until either

diplonema or metaphase I of meiosis. Furthermore, synapsis occurs in the null mutants as

it does in wild-type mice, giving further support that MLH3 functions at a later point in

meiosis than the MSH4-MSH5 complex . The number of crossover products in

spermatogenesis was also lower in the mlh3-/- mice. Crossover events were 85-94% less

frequent in mutant than in wild-type cells, while non-crossover events were increased,

indicating that some of the recombination intermediates normally resolved as crossover

products are diverted to a pathway resulting in non-crossover products. These findings

point to the role of MLH3 in crossover formation and recombination intermediate

resolution . Finally, MLH1 does not localize to chromosomes in mlh3-/- cells. This

suggests that MLH3 binds DNA before MLH1 and may recruit MLH1 .

Despite MLH3 preceding MLH1 temporally in terms of associating with

recombination nodules, mlh1-/- spermatogenesis arrests earlier than mlh3-/-

spermatogenesis, in pachynema. Unlike mlh3-/- mutants, mlh1-/- somatic cells show

genomic instability due to impaired mismatch repair, indicating that MLH1 has a role other

than in meiotic recombination alone. Nevertheless, males and females that lack MLH1 are

sterile and show no chiasmata formation. Because pachytene arrest in spermatogenesis

leads to apoptosis, Edelmann et al. (1996) postulate that the lack of MLH1 triggers the

pachytene checkpoint, leading to meiotic arrest and apoptosis . However, Eakeret al.

(2002) found that MLH1-knockout spermatocytes are capable of progressing to metaphase

I but arrest because of improper alignment along the metaphase plate. Thus, they conclude

that the spindle checkpoint is triggered rather than the pachytene checkpoint .

Another meiotic protein, CDK2, is a kinase expressed ubiquitously throughout

mammalian systems. In mitotic cells, it functions to help regulate cell proliferation,

particularly the transition from G2 to M phase. Interestingly, Ortega et al. (2003) found

that mutants that lack CDK2 have no defects in somatic cells. Rather, a lack of CDK2

affects meiotic progression. This indicates that CDK2 is necessary for meiotic progression

11


21/65

but not mitotic progression. Spermatocytes without CDK2 arrest in pachytene due to an

inability to synapse. Specifically, the axial elements are unable to form correctly. Because

CDK2 is a kinase and has such a prominent role in meiosis, its target protein is believed to

be a meiotic protein. This target, however, has yet to be elucidated. Becausescp3-/- mice

are fertile, SCP3 is not CDK2s target . Given CDK2s role in regulating the transition

from G2 to M phase in somatic cells, it makes sense that in germ cells, CDK2 localizes

with MLH1 because of its function in mismatch repair. In somatic cells, CDK2 helps

ensure that the DNA is not damaged before proceeding through mitosis, so it follows that

CDK2 might also target a DNA repair protein during meiosis .

Finally, H2AX is a histone protein that is part of nucleosomes, which facilitate

DNA condensation into chromatin within cells. Upon the creation of DSBs by SPO11,

H2AX is immediately phosphorylatedon serine residue 139. Phosphorylated H2AX is

termed H2AX and signals to the cell that DNA damage has occurred, leading to the

recruitment of DNA repair enzymes. Gamma-H2AX disappears once the homologous

chromosomes are synapsed in pachynema, but it remains present in the sex body (the

silenced X and Y chromosomes present in spermatogenic cells) . The phosphorylation of

H2AX in response to SPO11 activity is independent of the H2AX phosphorylation

involved in remodeling chromatin in the sex body .

H2ax-/- mice display an interesting phenotype in which males are sterile(spermatocytes arrest in pachynema) while females remain fertile. These mutants are also

sensitive to DNA damaging ionizing radiation. They do not, however, have impaired

mitotic checkpoints. They also fail to form a sex body, and MLH1 is not distributed as it

is in wild type cells . The difference between fertility in males and females is due to

H2AX, or lack thereof, in the sex body rather than the response to DSBs. During meiosis,

sex chromosomes need to be silenced; however, without phosphorylation of H2AX, the sex

body never condenses and the X and Y chromosomes never synapse . This silencing is not

required in females because they have two homologous X chromosomes that can be paired,

rather than an X and Y chromosome that cannot synapse. In this way, H2AX is different in

the way that it appears to affect meiotic progression.

12


22/65

1.6 CCNB1IP1 and the mei4 Mutation

After a forward genetic screen, the mei4 mutation was identified as a potential

candidate for the study of fertility. Male and female mice that are homozygous with the

recessive mei4 allele are infertile due to meiotic arrest during MI. The mutation was

identified as a single base mutation in the gene encoding the protein CCNB1IP1, also

called Hei10 .

In humans, CCNB1IP1 is a putative E3 ubiquitin ligase whose interaction with B

cyclins is thought to help regulate the transition from G2 to M phase during mitosis.

Specifically, human CCNB1IP1 interacts with CCNB1, leading to its ubiquitination and

subsequent degradation via the ubiquitin-proteasome pathway in vitro . CCNB1IP1s

function is extremely important to understand because, as a cell cycle regulator, it is

implicated in several human cancers. Interestingly, HEI10 up-regulation has been linked to

metastatic melanoma . This finding led Singh et al. (2007) to investigate CCNB1IP1s role

in metastasis and cell proliferation. They found that CCNB1IP1 is necessary for proper

cellular proliferation because cells with decreased levels of CCNB1IP1 do not divide at

rates equivalent to wild-type cells. Furthermore, cells with low levels of CCNB1IP1

protein expression show increased invasiveness and motility, implicating it in the control of

metastasis . These results are in keeping with CCNB1IP1s targeting of cyclin B1 because

decreased levels of CCNB1IP1 in cells would lead to increased levels of cyclin B1 and its

kinase Cdk1, which would halt progression through the cell cycle. Metastasis would be

influenced because Cdk1s increased activity allows it to activate several other proteins

involved in cell motility.

In mice, the exact mechanism of CCNB1IP1s function has yet to be elucidated. To

this end, the mei4 mutation is under investigation in this study. Meiotic cells in mei4/mei4

mice arrest in MI due to improper synapsis of homologous chromosomes during

pachynema. This is seen in diplotene chromosome spreads in which the chromosomes

appear as univalents rather than bivalents. Furthermore, CDK2, MLH1, and MLH3 fail to

localize properly to crossover sites during pachynema. Though recombination is initiated,

as seen by normal localization of RAD51 to chromosomes in zygonema, no chiasmata are

formed, indicating failed recombination. No MLH1 or MLH3 foci are observed on

pachytene chromosomes (Figure 1.2). Interestingly, CDK2 foci are observed at the

13


23/65

telomeres of chromosomes but not at interstitial sites of recombination (Figure 1.3). This

indicates that the localization of CDK2 to the telomeres occurs through a different pathway

than its localization to interstitial sites .

These observed defects have led to the hypothesis that CCNB1IP1 may target

CCNB3 for degradation. Consistent with this hypothesis, CCNB3 is integral for the

completion of meiosis. CCNB3 mRNA is expressed specifically in leptotene and zygotene

spermatocytes. By pachynema, CCNB3 mRNA expression is no longer observed.

Furthermore, CCNB3 has been shown to directly interact with CDK2 . Cells that over-

express CCNB3 also show failed spermatogenesis . This observation is important to note

because in the mei4/mei4 mice, CCNB1IP1 would not degrade CCNB3, so it would be

present at higher-than-normal levels, leading to the observed failure of spermatogenesis.

Taken together, these data have led to the model for the mechanism of CCNB1IP1

function, as it relates to the mei4 allele, proposed by Ward et al. (Figure 1.4). In this

model, recombination is initiated independently of CCNB1IP1. During pachynema,

CCNB1IP1 targets CCNB3 for degradation, at which point CDK2 is free to bind to

synapsed homologous chromosomes. The binding of CDK2 then recruits MLH1 and

MLH3 to repair DNA mismatches, leading to crossover events and chiasmata formation.

In mei4/mei4 spermatocytes, recombination is initiated, but CCNB3 is not degraded, so

CDK2 is unable to bind to the synapsed chromosomes. Thus, MLH1 and MLH3 are not

recruited for mismatch repair, and chromosomes fail to form proper chiasmata, resulting in

the observed prevalence of univalents.

14


24/65

Figure 1.2 Chromosomes in mei4/mei4 Spermatocytes Contain RAD51 Foci in Zygonema but Lack

MLH3 and MLH1 Foci in Pachynema. (A and B) The DSB repair protein RAD51 appears in foci (green)on zygotene chromosomes in both mei4/+ and mei4/mei4 chromosome spreads counter labeled with anti-

SYCP3 (red). (C-F) Chromosome spreads from heterozygous (mei4/+) and mutant (mei4/mei4)

spermatocytes were labeled with antibodies to MLH3 (green [C and D]) or MLH1 (green [E and F]) and

counter-labeled with anti-SYCP3 (red). MLH3 and MLH1 foci (white arrows) are present on mei4/+chromosomes (C) and (E) but not on mei4/mei4 chromosomes (D) and (F). Figure and caption taken from

Ward et al. (2007).

15


25/65

Figure 1.3 CDK2 Does Not Localize to Interstitial Sites on Synapsed mei4/mei4 Bivalents during

Pachynema. (A) Wild-type (+/+) spermatocyte chromosome spread labeled with antibodies against CDK2

(green) and SYCP3 (red). CDK2 localizes to telomeric foci (open arrowheads), along the asynapsed axes of

the sex chromosomes (closed arrowheads), and at interstitial sites (white arrows) along synapsed wild-type

bivalents in pachynema. (B) mei4/mei4 spermatocyte chromosome spread labeled as in (A) showing

absence of CDK2 localization at interstitial loci. Despite loss at interstitial sites, CDK2 localization is

observed at telomeric foci (open arrowheads) and at loci along the sex chromosomes (closed arrowheads).Figure and caption from Ward et al. (2007).

16


26/65

Figure 1.4 Proposed Mechanism: HEI10mei4 Mediated Failure to Degrade CCNB3 Leads to Inability

to Recruit MLH3 and MLH1 Resulting in Failed Recombination. (A) During normal Prophase I,subsequent to DSB repair via RAD51, HEI10 mediates the degradation of CCNB3 (B3) freeing CDK2 to

associate with interstitial sites on chromosome cores in pachynema. Subsequently (or contemporaneously),MLH3 and MLH1 are recruited to recombination nodules containing CDK2. In diplonema, MMR has

occurred, MLH3, MLH1, and CDK dissociate from the cores and chiasmata maintain homolog association

until the onset of anaphase I. (B) In mei4/mei4 animals, DSB formation and RAD51 foci occur normally.

Inability of HEI10mei4 to associate with B3 leads to the accumulation or mislocalization of B3 and the

titration of the available CDK2. CDK2 is unable to associate with sites of recombination, as are MLH3 and

MLH1. In our model, failure to correct mismatches during Holiday junction resolution leads to incomplete

recombination intermediate resolution and arrest at the metaphase I spindle checkpoint. Figure and caption

from Ward et al. (2007).

17


27/65

To further elucidate the role of CCNB1IP1 in homologous recombination, this

study will focus on the gene expression, protein expression, and protein localization of

several proteins important for homologous recombination. The failure of CDK2, MLH1,

and MLH3 to localize to interstitial foci could be the result of different defects in

regulation. First, the expression of these proteins could be affected on a transcriptional

level by the mutation of CCNB1IP1. If the genes are not expressed, the protein will not be

expressed because the transcript is not present. To this end, reverse transcriptase PCR (RT-

PCR) will be performed to determine the expression of these genes. Several other meiotic

proteins including MSH4, MSH5, and H2AX will be examined concurrently. The gene

expression of these proteins is of particular interest because of CDK2s function as a

phosphorylating agent. Aberrant CDK2 activity may have widespread effects on gene

expression in the mei4 homozygotes because it may phosphorylate transcription factors that

in turn alter gene expression. Second, protein expression could be affected on a

translational level. Western blots will be performed to determine ifmei4/mei4

spermatocytes properly express the protein products of the genes of interest. Finally, the

proper proteins may be present in the cells but fail to localize. Chromosome spreads

probed with antibodies specific for the proteins of interest are particularly informative.

Because of the temporal relationship between these proteins (the early appearance of

H2AX followed by the recruitment of MSH5 and MSH4), knowing whether or not theseproteins are present at recombinatorial foci will yield valuable temporal information

regarding the timing of the effects of CCNB1IP1. The completion of this study will help

further clarify the role of CCNB1IP1 in homologous recombination during

spermatogenesis, lending valuable information to the study of meiotic progression and

infertility.

18


28/65

Chapter 2: Materials and Methods

2.1 Qualitative RT-PCR

2.1.1 RNA ExtractionRNA was extracted from whole testes using a QIAGEN RNA isolation kit (Qiagen

Inc, Valencia, CA). All samples and buffers were kept on ice throughout the procedure to

reduce degradation of the RNA by nucleases. RNase-free water, tubes, and pipette tips

were also used, and all instruments were RNaseZapped (Sigma-Alrich, St. Louis, MO)

before use. Before beginning the RNA extraction, -mercaptethanol was added to Buffer

RLT. Testes were surgically removed from wild type and mei4/mei4 mice and used

directly or stored at -80C in RNase-free centrifuge tubes until use. The testes were

individually homogenized in 600 L of buffer RLT using a motorized pestle. The

homogenized samples were then centrifuged for three minutes at full speed (13,200 rpm) at

room temperature. The supernatant was transferred into a new centrifuge tube, and an

equal volume of 70% ethanol was added and mixed by pipetting. Seven-hundred

microliters of the supernatant-ethanol solution was loaded directly onto the column

supplied in the isolation kit. The column was centrifuged at 10,000 rpm for 15 seconds at

room temperature. The flow-through was discarded. The column was then washed with

700 L of buffer RW1 and centrifuged again for 15 seconds at 10,000 rpm. The flow-

through was again discarded. The column was next washed with 500 L of buffer RPE,

centrifuged for 15 seconds, and the flow-through discarded. One final wash with 500 L

of buffer RPE was performed, with a centrifugation of 2 minutes at 10,000 rpm. The

column was then transferred to a new collection tube, and the old collection tube

(containing the final wash of RPE buffer) was discarded. The column was centrifuged an

additional minute at full speed and placed in a new centrifuge tube. The now clean RNA

was eluted with 30 L of RNase-free water loaded directly onto the center of the column.

The RNA was quantified using a Nanodrop ND-1000 spectrophotometer (Nanodrop

Technologies Inc, Wilmington, DE) and stored at -80C.

19


29/65

The isolated RNAs integrity was checked on a 1.2% formaldehyde agarose gel

(1.2% agarose, 1X FA gel buffer from a 10X stock solution, 0.67% formaldehyde, 0.1

g/mL ethidium bromide, prepared in RNase-free water; formaldehyde and ethidium

bromide were added after the solution was cooled to 65C). The samples were prepared by

combining one part 5X RNA loading buffer with four parts of the RNA sample, with a

total of approximately 2 g of RNA. The gel was run in 1X FA gel running buffer at 80V

for one hour and documented with the KODAK gel logic 440 digital imaging system

(Carestream Molecular Imaging, New Haven, CT).

2.1.2 cDNA Synthesis

From the purified RNA, cDNA was synthesized using the Protoscipt First Strand

cDNA synthesis kit (New England Biolabs, Ipswich, MA). One microgram of RNA wascombined with 2 L of random primers, 4 L of dNTP mix, and 9 L of nuclease-free

water. This mixture was heated for 5 minutes in a 70C water bath, centrifuged briefly,

and put on ice. Two microliters of 10X reverse transcriptase buffer, 1 L of RNase

inhibitor, and 100 Units of reverse transcriptase (RT) were added and incubated for one

hour in a 42C water bath. One reaction was performed substituting 1 L of water for the

reverse transcriptase as a RT (-) negative control. The enzymes were deactivated by

incubating the samples at 95C for 5 minutes. The cDNA was then treated with 1 L ofRNase H, incubated for 20 minutes in a 37C water bath, and the enzyme deactivated by

incubation at 95C for 5 minutes. The sample was then diluted to 50 L with nuclease-free

water and stored at -20C.

2.1.3 Primer Design

Primers for PCR amplification were designed forcdk2, h2ax, msh4, msh5, mlh1,

and mlh3. Primer design was based on the cDNA sequences found from mRNA transcripts

of the appropriate gene, as documented in the GenBank database through the NationalCenter for Biotechnology Information website (http://www.ncbi.nlm.nih.gov). Primers

200 mM MOPS, 50 mM sodium acetate, 10 mM EDTA, ph 7.0 with NaOH 16 L saturated bromophenol blue, 80 L 500 mM EDTA, pH 8.0, 720 L 37%formaldehyde, 2 mL 100% glycerol, 3.084 mL formamide, 4 mL 10X FA gel buffer,

RNase free water to 10 mL 100 mL 10X FA gel buffer, 20 mL 37% formaldehyde, and 880 mL RNase-free water

20


30/65

were designed so that, when possible, the primers spanned exons and so that the expected

amplicon would be between 700 and 900 base pairs. All primers met these criteria, except

for the h2ax primer, which does not span exons because the h2ax transcript is composed of

only one exon (Table 2.1)

2.1.4 PCR

PCR amplification was performed in a final reaction volume of 50 L. Reactions

contained 67 M dNTP mix, 1X Taq DNA Polymerase buffer with MgCl2 (New England

Biolabs, Ipswich, MA), 0.005 Units Taq DNA Polymerase (New England Biolabs,

Ipswich, MA), 20 M forward primer, 20 M reverse primer, and 1 L of template cDNA.

Gapdh primers were used as a positive control. No template negative controls, containing

1 L of nuclease-free water instead of cDNA, were performed. The RT(-) cDNA synthesiscontrol was also used as a template to control for genomic DNA contamination of the RNA

sample. Amplifications were performed in MJR PTC-200 thermal cyclers (Global Medical

Instrumentation, Ramsey, MN). The samples were denatured at 95C for 5 minutes, then

amplified for 36 cycles of 95C denaturation for one minute, 62C annealing for 30

seconds, and 72C elongation for 2 minutes, followed by a 10-minute 72C finishing

elongation step. After amplification, the products were electrophoresed on a 1% agarose

gel containing 0.5 g/mL ethidium bromide. The gel was visualized under UV light and

documented using the KODAK gel logic 440 digital imaging system (Carestream

Molecular Imaging, New Haven, CT).

2.2 Western Blotting

2.2.1 Protein Extraction

Whole testes were surgically removed from 19 day old mice and frozen and stored

at -80C. For protein extraction, the tissues were thawed on ice in microfuge tubes. Four

hundred microliters of RIPA buffer (50 mM Tris-Cl pH7.6, 150 mM NaCl, 1% NP-40, 1%

Na Deoxycholate, 0.1% SDS, 2 mM EDTA, 50 mM NaF, 0.2 mM Na vanadate, 100 U/mL

protease inhibitor) were added to each tissue sample. The testes were chopped into small

pieces using scissors. The tissue/RIPA mixture was transferred to a homogenizer and

plunged five times to homogenize the tissue sample. The homogenate was transferred to a

clean microfuge tube and left on ice for 30 minutes with occasional mixing. After the 30-

21


31/65

minute incubation, the mixture was centrifuged at maximum speed at 4C for 30 minutes.

The supernatant was then transferred to another clean microfuge tube and stored at -20C

until assayed for protein concentration.

2.2.2 Protein QuantificationThe concentration of protein extracted was determined through a BioRad assay.

Four concentrations of BSA ranging from 0.2 mg/mL to 0.8 mg/mL were used to generate

a standard curve. Three different dilutions (1:10, 1:50, 1:100) of the protein sample of

unknown concentration were prepared, again to a final volume of 40 L. Into different

wells of a microtiter plate, 10 L of each BSA dilution and 10 L of each protein sample

dilution were loaded, in triplicate. Separately, a 1:4 dilution of BioRad dye was prepared.

Two hundred microliters of diluted dye was added to each well containing a sample or

standard, as well as three wells that served as blanks. Dye was added as quickly as

possible for the most accurate reading. Using a Synergy HT spectrometer (Biotek

Instruments Inc, Winooski, VT), the light absorbance at 595 nm for each well was

measured. The readings were corrected for the absorbance of the blanks. A standard curve

was generated using the corrected readings of the BSA standards. The absorbence of the

sample protein dilutions were fitted to the standard curve, and the concentration

determined. This calculated concentration was then multiplied by the dilution factor to

yield the correct final concentration of the protein sample. For each sample, the final

concentrations were averaged to determine the best estimation of the actual concentration

of protein in the sample.

2.2.3 SDS-PAGE

Proteins were separated on NuPAGE 4-12% Novex Bis-Tris polyacrylamide gels

(Invitrogen Molecular Probes, Carlsbad, CA). Prior to loading, samples containing

approximately 20 g of protein were prepared to a final volume of 10L per lane with 4X

NuPAGE LDS sample buffer and 10X NuPAGE reducing agent (Invitrogen Molecular

Probes). Samples were heated for 10 minutes at 70C to denature the proteins prior to

loading onto the gel. The samples were loaded onto the gel and electrophoresed at 200

volts for one hour in 1X NuPAGE MOPS SDS buffer (Invitrogen Molecular Probes). The

22


32/65

GENE PRIMER NAME SEQUENCE (53) PRODUCTSIZE (base pairs)

cdk2 CDK2 Forward GGCTCGACACTGAGACTGAA 835

CDK2 Reverse GCATTTGCGATAACAAGCTC

h2ax H2AX Forward GRACCTCACTGCCGAGATCC 868H2AX Reverse GCCGGGAGGTATTCCTAGTG

msh4 MSH4 Forward GGAGGTGCAGTCCAGGTATT 744

MSH4 Reverse CATTCCTGCTATGTCGTCCA

msh5 MSH5 Forward GAGATCCATCTGTGCGTGC 780

MSH5 Reverse GTCGGTGCAGCATCTGG

mlh1 MLH1 Forward CAGTTTGGAAATCAGCCCTC 869

MLH1 Reverse GCTGGTTCCGATAACCTCAG

mlh3 MLH3 Forward CGATACCCAGAGGTTGCTGT 791

MLH3 Reverse AACCTGTTTTTCCTGCTCCATable 2.2 Primers used for RT-PCR of cDNA from total testes RNA. The sequences for each of the

primers, forward and reverse, is provided, as well as the expected product size in base pairs of the specificamplicon of each gene.

23


33/65

upper chamber of the gel apparatus was filled with 1X running buffer containing

antioxidant (Invitrogen Molecular Probes). Precision Plus colored protein molecular weight

markers were electrophoresed alongside the protein samples (BioRad Laboratories,

Hercules, CA).

2.2.4 Transfer

After electrophoresis, the proteins were transferred and immobilized on a

nitrocellulose membrane. The membrane, along with transfer pads and Whatman filter

paper, were pre-soaked in transfer buffer (25mM Tris base, 190mM glycine, 20%

methanol). The gel was removed from its case with a gel knife, and the wells and foot

were removed. The gel was placed against the nitrocellulose membrane (Whatman,

Dassel, Germany) and all air bubbles were removed. Whatman filter paper was placed on

either side of the gel and membrane. Fiber pads were placed outside of the filter paper, and

the entire sandwich was placed in a BioRad western blot cassette with the membrane

closest to the white side of the cassette and the gel closest to the black side. The locked

cassette was placed in the BioRad electrophoresis module, along with a Bio-Ice cooling

unit and spin bar. The transfer was electrophoresed for 1 hour at 100V at 4C. The

membrane was stained with Ponceau stain to check for protein transfer. The membrane

was blocked overnight at 4C with TNT (10mM Tris-Cl pH8, 150mM NaCl, 0.05%

Tween-20) containing 5% (w/v) milk. After blocking, the membrane was rinsed twice with

TNT and then probed.

2.2.5 Probing for Specific Proteins

Antibodies purchased from Abcam, Inc (Cambridge, MA) were used to probe the

membrane for the presence of specific proteins (Table 2.2). Primary antibodies were

diluted in TNT with 3% milk (w/v). The membrane was incubated overnight at 4C with

agitation in the diluted primary antibody. The membrane was then rinsed twice with TNT

and further washed in TNT three times for 10 minutes each. During the last 10 minute

wash, the secondary antibody was diluted in TNT with 3% milk. The membrane was

incubated in the secondary antibody for 1 hour at room temperature with agitation. The

membrane was rinsed twice with TNT and washed three times for 10 minutes each with

TNT.

24


34/65

2.2.6 Visualization of Protein

Directly following treatment with the secondary antibody, the presence of the

protein of interest was visualized utilizing chemilluminescence. Equal amounts of

detection solution 1 and detection solution 2 (Invitrogen Molecular Probes) were mixed.

Extra wash buffer was drained from the membrane by dabbing the edge of the membrane

against paper towel. The membrane was placed protein-side up on Saran Wrap. The

detection solution was pipetted directly onto the membrane and incubated for one minute at

room temperature. Extra solution was drained as before, and the membrane was placed

protein-side down on fresh SaranWrap. The membrane was wrapped in SaranWrap,

removing air bubbles as it was wrapped. In the dark room, the wrapped membrane was

exposed to autoradiography film (KODAK BioMax MR film, Sigma-Alrich), adjusting the

exposure time for optimal band visualization.

2.2.7 Stripping and Re-Probing the Membrane

In order to perform positive loading controls, the western blot membranes were

stripped and re-probed with anti--tubulin rabbit polyclonal antibodies (Abcam, Inc). The

membranes were incubated in stripping buffer (140L -mercaptethanol, 4g SDS, 12.5 mL

1M Tris-Cl pH 6.7, H2O to 200mL) for 30 minutes at 50C with occasional mixing. The

membranes were then washed in TNT for 10 minutes three times. Membranes were then

re-blocked overnight at 4C, re-probed, and visualized, as previously described using the -

tubulin antibody.

2.3 Chromosome Spreads

2.3.1 Microspreading Meiotic Nuclei

Nuclear microspreads were prepared from mouse testes as previously described by

Reinholdt et al. . A border was drawn on charged slides (Fisherbrand Superfrost Plus,

Thermo Fisher Scientific, Waltham, MA) with a hydrophobic pen. The large border wasseparated into three smaller rectangles with the hydrophobic pen, and the slides were

allowed to dry. A humid chamber was created by placing damp paper towels in the bottom

of a large rectangular glass casserole dish. The paper towel was smoothed and leveled by

rolling a serological pipet along the paper towels. Two serological pipets were placed

length-wise along the bottom of the dish on which the dry

25


35/65

USE TARGET,

CONJUGATES

HOST BAND

SIZE

SUPPLIER,

CATALOG

NUMBER

Western Blot primary

antibody

CDK2 rabbit

polyclonal

35kDa Abcam,

ab7954


antibody

MLH1 rabbit

polyclonal

85kDa Abcam,

ab9144

Western Blot primaryantibody

H2AX rabbitpolyclonal

17kDa Abcam,ab2893


antibody-tubulin rabbit

polyclonal

50kDa Abcam,

ab4074

Western Blot

secondary antibody

Rabbit IgG, HRP

conjugate

goat

polyclonal

N/A Invitrogen

Molecular

Probes, G-21234

Immunofluorescenceprimary antibody

H2AX mousemonoclonal

N/A Abcam,ab22551

Immunofluorescence

primary antibody

SCP3 rabbit

polyclonal

N/A Abcam,

ab15092Immunofluorescence

secondary antibody

Mouse IgG, AlexaFluor

488 conjugate

goat

polyclonal

N/A Invitrogen

MolecularProbes, A-

11029

Immunofluorescence

secondary antibody

Rabbit IgG, AlexaFluor

594 conjugate

goat

polyclonal

N/A Invitrogen

Molecular

Probes, A-11037

Table 2.3 Antibodies used in western blotting and fluorescent labeling of chromosome spreads. Allantibodies were stored as per manufacturers instructions.

26


36/65

slides were placed. The chamber was then covered with SaranWrap to retain the

humidity. Testes were surgically removed from mice and placed in a 35 mm Petri dish

containing 1X PBS. The testes were rinsed in the PBS and all excess fat was removed.

They were then transferred to a Petri dish containing 3 mL of Eagles MEM-high glucose

containing 1X protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN). The

tunicae of the testes were removed and the tubules released into the MEM solution. The

tubules were separated with watchmakers forceps and then by repeated gentle pipetting.

The suspension was transferred into a 15 mL conical tube containing 7 mL of MEM with

1X protease inhibitor cocktail, leaving behind the tubules and any large fragments of tissue.

The suspension was allowed to settle in the conical for 2 minutes. One milliliter of the

suspension was pipetted into each of six 1.5 mL microfuge tubes. The suspension was then

centrifuged for 5 minutes at 7900 rpm at room temperature. During centrifugation, three

drops of T-PFA with PI fixative (1% paraformaldehyde, 0.1% Triton X 100, 1X protease

inhibitor cocktail) was added to each square on the slides in the humid chamber. The slides

were tilted to ensure even distribution of the fixative, and the chamber was re-covered.

The supernatant was removed from the pellets, and the cells were resuspended in 40 L of

0.1 M sucrose with 1X protease inhibitor cocktail. The cells were allowed to swell in the

sucrose for two minutes. Ten microliters of the cell suspension was pipetted onto the

fixative of each square in 5 drops (about 2 L per drop) across the entire square. This wasrepeated for each of the tubes containing cell pellets. The slides were left undisturbed for

three hours in the covered humid chamber. The slides were then rinsed with KODAK

PhotoFlo 200 diluted 1:250 in water by slowly dripping the solution down the slides at an

angle. The slides were then allowed to air-dry and were immunolabeled or stored at -20C.

2.3.2 Immunolabeling

Slides were washed three times for ten minutes in coplin jars with 10% ADB with

1X PBS. Ten percent ADB was prepared from ADB stock (3% BSA, 10% serum, 0.05%

Triton-X 100, 1X PBS). After the three washes, the slides were drained of extra 10% ADB

and placed back in the humid chamber. The primary antibodies were diluted in ADB stock

solution, and 20 L of primary antibody was added to each square. In the case of slides

that were double labeled, 10 L of each primary antibody was added to the squares. The

27


37/65

slides were incubated with the primary antibodies for 2 hours at 37C. The slides were

washed for 10 minutes three times with 10% ADB stock in coplin jars. Excess wash was

drained from the slides and they were placed in a dark humid chamber (covered in

aluminum foil or a chamber constructed from opaque boxes). Working in the dark and

with amber tubes, the secondary antibody was diluted in ADB stock. Twenty microliters of

secondary antibody was added to each square, and the slides were incubated for 1 hour at

37C. The slides were washed in aluminum foil-covered coplin jars for 10 minutes in 0.02

g/mL DAPI in 1X PBS. The slides were washed twice more for 10 minutes in 1X PBS,

still covered with aluminum foil. A final wash in dH2O for 5 minutes was performed, and

the slides were allowed to air dry. Once dry, the slides were mounted with a drop of

Slowfade Component A (Invitrogen Molecular Probes) on each square and covered with a

long coverslip, and sealed around the edges of the coverslip with nail polish. The slides

were either immediately visualized or stored at 4C. The fluorescently labeled slides were

visualized and images captured using a Zeiss Axioskop 2plus microscope with a Zeiss

Axiocam mRm digital camera. AxioVision 4.4 software was used to obtain the

computerized images of the chromosome spreads. The microscope was fitted with the

appropriate filters and the AxioVision software was used to artificially colorize the images

obtained.

2.3 Mice

The mice used in this study were from Jackson Laboratory in Bar Harbor, ME.

They were kept at the Middlebury College Research Animal Facility, following the

Middlebury College IACUC protocol. They were maintained with a 12-hour light cycle at

70C with 30-50% average humidity. Their diet consisted 9% fat (Mouse Diet 9F 5020,

Lab Diet, Richmond, IN) ad libitum.

28


38/65

Chapter 3: Results

3.1 Expression of Genes Encoding Recombinatorial Proteins

RNA was successfully isolated from the testes ofmei4/mei4 (-/-) mouse 182-5 and

WT (+/+) mouse 1548-6. The ratio of the 260 nm absorbance to the 280 nm absorbance of

the RNA from the mei4/mei4 mouse was 2.15 and had a concentration of 1.19 g/L.

Electrophoresis on a formaldehyde gel revealed that the RNA was not degraded. The RNA

gel revealed a smear of mRNA with two strong bands corresponding to the 28S rRNA and

18S rRNA (data not shown). The isolated WT RNA had a concentration of 1.011g/L

and a 260/280 ratio of 2.17. PCR amplification of transcribed cDNA revealed that cdk2,

h2ax, msh4, msh5, mlh1, and mlh3 are expressed in mutant and WT mice (Figure 3.1). The

cdk2 primers amplify a doublet due to the presence of multiple cdk2 transcripts. Of note is

that amplification was qualitative and was not performed in real time.

3.2 Expression of Recombinatorial Proteins

Western blots against CDK2 in WT protein extracts showed four distinct bands:

58kDa, 35kDa, and a doublet at 31kDa. The mei4/mei4 western blots for CDK2 showed

only two bands: 35kDa and the upper band of the doublet at 31kDa (Figure 3.2A). CDK2

has two isoforms of predicted sizes 39 and 34kDa. Because of its size, the largest band is

most likely not CDK2 and is non-specific binding, though it is absent in the mutant. The

other bands, however, are approximately the correct size, though they are shifted down

several kiloDaltons. Additionally, prior western blots with the same antibody but different

protein samples and protein marker detected bands at the correct molecular weight (data

not shown). This indicates that, although the bands are smaller than expected, they are

specific for CDK2. Interestingly, a doublet is seen at 31 kDa instead of a single band in

WT extracts. The bottom band of the doublet is absent in the mei4/mei4 protein sample.

MLH1 has a projected size of 84kDa. The western blot probing for MLH1 in WTand mei4/mei4 testis protein extracts showed a clear band at approximately 81kDa (Figure

3.2B). There were several non-specific bands in addition; however, the 81kDa band was

the brightest band present. The antibodies claim to be MLH1-specific, so this 81kDa band

is attributed to MLH1 presence in the cellular extracts.

29


39/65

Antibodies specific for the phosphorylated form of H2AX were used to detect the

presence ofH2AX in testis protein extracts. Gamma-H2AX is expressed in both WT and

mei4/mei4 testes, as evidenced by the presence of the 17kDa band (Figure 3.2C).

3.3 Localization of H2AX on Meiotic Chromosomes

The phase of each cell was determined by the structure of the synaptonemal

complex. Antibodies specific for synaptonemal complex protein 3 (SCP3) allowed the

visualization of SCP3. SCP3 assists in chromosome pairing during meiosis, as it is an axial

element in the synaptonemal complex (SC). As cells progress through prophase I of

meiosis, the exact stage can be determined based on the staining pattern of SCP3 along

chromosomes. In leptotene cells, SCP3 begins to localize to the uncondensed

chromosomes. As cells progress into the zygotene stage, the entire chromosome is stained,

and individual chromosomes begin to be seen. During pachynema, the entire synaptonemal

complex is formed and homologous chromosomes pair. With SCP3 staining in

chromosome spreads from mice, 19 chromosome pairs are clearly distinguishable, as well

as the XY body. During diplonema, chromosome pairs repel each other but are left

connected at crossover sites. SCP3 staining remains along the entire chromosome, so the

connected chromosome pairs can be seen .

In both the WT and mei4/mei4 spreads in leptonema, H2AX was present in small

amounts throughout the cell (Figure 3.3A, B, respectively). This is consistent with the

early formation of DSBs on chromosomes. As meiosis proceeds into zygonema, profuse

H2AX staining is present in both WT and mutant spreads. SPO11s peak activity creates

DSBs across the genome, which leads to the abundant phosphorylation of H2AX that is

seen in the spreads (Figure 3.3C, D).

WT and mutant pachytene chromosome spreads showed differing H2AX patterns.

In WT spreads, H2AX is present in the XY body but not along chromosome pairs (Figure

3.3E). However, in mutant spreads, H2AX foci are present along the homologous

chromosome pairs, in addition to the XY body (Figure 3.3F). Because the spreads were

double labeled with SCP3 and H2AX antibodies, the composite image

30


40/65

Figure 3.5 Meiotic Genes Are Expressed in WT and mei4/mei4 Testes. Qualitative RT-PCR using

primers designed specifically for the cDNA transcripts ofcdk2, h2ax, msh4, msh5, mlh1, and mlh3 reveals

that all of these genes are expressed in adult WT (+/+) and mutant (-/-) testes. The two products amplifiedby the cdk2 primers were expected and represent two different transcripts forcdk2 that have been

characterized in mice. (MW=molecular weight marker. The band shown represents a DNA fragment ofapproximately 1018 base pairs).

31


41/65

Figure 3.6 Recombinatorial Proteins Are Expressed in WT andmei4/mei4 Testes. Western blots were

performed using antibodies against CDK2, MLH1, and H2AX to determine protein expression in WT (+/+) and mei4/mei4 (-/-) testes. Bands with an asterisk (*) represent specific antibody binding. All other

bands are believed to be non-specific. (A) CDK2 protein expression: One non-specific band appears in WT

extracts and no non-specific bands appear in mei4/mei4 extracts. The WT 30 kDa CDK2 band is a doublet

and the mei4/mei4 30 kDa CDK2 is a single band. The bottom band of the WT doublet is not present inmei4/mei4 extracts. (B) MLH1 protein expression: The band at approximately 81kDa is considered to be

specific for MLH1. It is expressed in equal amounts in both WT and mutant testes. Several non-specific

bands appear both in WT and mei4/mei4 extracts. (C) H2AX expression is equal in WT and mei4/mei4testes. The antibody binds a 17kDa protein, the size of H2AX. Alpha-tubulin was used as a loading

control and shows even protein loading.

32


42/65

clearly shows the presence ofH2AX along the chromosomes. The SCP3 staining allows

each individual pair of homologous chromosomes to be visualized in red, and the H2AX

is visualized in green. The chromosome pairs can be clearly seen with the H2AX staining

in the mutant pachytene cells, and the composite image shows that within individual cells,

H2AX is phosphorylated precisely along the chromosomes. Figure 3.3F shows two

pachytene mutant spermatocytes. The XY body is the strong round green staining. Not all

mutant pachytene cells showed H2AX staining along the chromosomes. Furthermore, a

small number of WT cells showed faint staining ofH2AX in pachytene. Nevertheless, the

difference was apparent. Far more mutant cells had H2AX present on the pachytene

chromosomes, and the staining was much stronger. The resolution of the camera did not

allow for the documentation of any WT spreads with H2AX staining on the paired

chromosomes.

By diplonema, the presence ofH2AX in mutants returned to being equivalent to

the WT staining (Figure 3.3 G, H). The H2AX in the XY body remains phosphorylated in

diplotene spermatocytes, but the H2AX along homologous chromosome pairs is no longer

present. By diplonema, DSBs have been repaired, and cells progress toward metaphase I

with the homologous pairs still joined at chiasmata. Importantly, most homologous pairs in

mutant diplotene spermatocytes do no remain joined at chiasmata (Figure 3.3H), as first

reported by Ward et al(2007).

________________________________________________________________________

Figure 3.7 H2AX Is Initially Phosphorylated Normally But Remains Chromatin Bound Into

Pachynema. (A and B) Phosphorylated H2AX staining (green) is present throughout the cell on leptotene

chromosome spreads counter-labeled with SCP3 (red) in both WT (+/+) and mei4/mei4 (-/-) spermatocytes.

(C and D) H2AX staining is profuse during zygonema in both WT and mei4/mei4 spermatocytes. (E)

Pachytene WT spermatocytes show H2AX only at the XY body. No H2AX is bound to synapsedhomologous chromosomes. (F) Two mei4/mei4 pachytene spermatocytes both disply chromatin bound

H2AX staining. Distinct H2AX foci are present along the paired chromosomes. XY body H2AXstaining is comparable to that of the WT spermatocytes. (G and H) By diplonema, mei4/mei4 H2AXstaining has returned to that of WT cells. Phosphorylated H2AX is only present at the XY body. No

H2AX staining is seen along the now de-synpased chromosomes, and it is not present at sites ofcrossover.

33


43/65

34


44/65

3.4 Quantification ofH2AX Presence in Pachytene SpermatocytesBecause of the observed H2AX staining in pachytene spermatocytes, the

phenotype was further characterized. Pachytene cells were counted, and the number of

cells that had H2AX present along the chromosomes was recorded for both WT and

mei4/mei4 spermatocytes. During initial counts of pachytene cells, it was observed that

cells with condensation of the telomeres might have H2AX staining on the chromosomes

less frequently than spermatocytes without condensation of the telomeres. This led to

further parameters being used when performing the counts. As spermatocytes transition

from mid-pachynema to late pachynema, the telomeres begin to condense, which can be

microscopically observed as bulbous regions at the ends of chromosomes. For the

purposes of the quantification ofH2AX presence in pachytene spermatocytes, the

presence of bulbous telomeres classified the cells as being in late pachynema. Cells that

did not show condensation of the telomeres were grouped as mid-pachytene spermatocytes

(Figure 3.4A).

In mei4/mei4 chromosome spreads, 179 spermatocytes were in pachynema. Of

these, 106 were in early to mid-pachynema and 73 were in late pachynema. 77.4% of mid-

pachytene mei4/mei4 spermatocytes had H2AX on chromosomes. This percentage was

reduced to 27.4% by late pachynema. In wild type spermatocytes, 108 pachytene cells

were counted. Of these, 54 were in early to mid-pachynema and 54 were in late

pachynema. The proportion of WT early to mid-pachytene spermatocytes that showed

H2AX staining on chromosomes was significantly lower than the proportion of

mei4/mei4 pachytene spermatocytes with similar staining patterns. Only 48.2% of early to

mid-pachytene WT cells and 11.1% of late pachytene spermatocytes had chromatin-bound

H2AX (Figure 3.4B). As noted previously, the staining in mei4/mei4 spermatocytes was

much more prominent than in WT spermatocytes, indicating greater H2AX

phosphorylation within the cells that showed phosphorylation. Binomial distribution

analysis was performed on the proportion of cells that showed H2AX phosphorylation in

each of the pachytene sub-stages to determine significance. For cells in early to mid-

pachynema, the null hypothesis (the percentage ofmei4/mei4 cells that do not show

chromatine-bound H2AX staining is equal to the percentage of WT cells that do not show

35


45/65

H2AX staining) was rejected (p


46/65

Figure 3.8 Mei4/mei4 Spermatocytes H

Documents

Final Formatted Thesis(1)