EVALUATION OF MYCOBACTERIAL LIPID-II-FLIPPASE VULNERABILITY

THROUGH TARGET KNOCK-DOWN

By

Tanya Jain

A thesis

submitted to the

School of Biological Sciences and Technology

VIT University, Vellore

in partial fulfillment of the requirements for the degree of

Bachelor of Technology

in

Biotechnology

VIT University

May 2014

Declaration by the candidate

I hereby declare that the thesis entitled ‘Evaluation of Mycobacterial lipid-II-flippase

vulnerability through target knock-down’ submitted by me to VIT University, Vellore in

fulfillment of the requirement for the award of the degree of B.Tech Biotechnology is a

record of bonafide research work carried out by me under the guidance of Ms. Sudha

Ravishankar, Senior Research Scientist, AstraZeneca India Pvt. Ltd. I further declare that

the work reported in this thesis has not been submitted, and will not be submitted, either in

part or in full, for the award of any other degree or diploma of this University or of any other

Institute or University.

Place: Bangalore, India

Date: April 30, 2014

Tanya Jain

10BBT0206

B.Tech Biotechnology

VIT University, Vellore

Acknowledgements

First and foremost, I would like to thank VIT University for allowing me to carry out my final

semester project at the R&D facility of AstraZeneca India Pvt. Ltd., set up by the

multinational pharmaceutical company, AstraZeneca. I express my appreciation to my

internal guide Dr. S. Babu, my class coordinators Prof. Ramesh Pathy, and Dr. Suneetha V for

guiding me throughout the duration of my project and clearing my doubts.

I would also like to give my heartfelt thanks to Dr. Sridhar Narayan, head of the iMED

department at AstraZeneca India Pvt., for giving me the opportunity to work in one of

India’s most prestigious laboratories. I am grateful for all his supervision and keen advice

during my stay there.

I extend a very special thanks to my guide, Ms. Sudha Ravishankar (Senior Research

Scientist), for her constant guidance and support. She ensured that I learnt the techniques

the right way and was always ready to help me overcome any difficulties I had. I also thank

her for encouraging me and for allowing me to grow as a scientist.

I would like to thank Ms. Vasanthi Ramachandran for her support and encouragement. I

owe immense thanks to Ms. Anisha Ambady and Ms. Nitha Unnikrishnan, both of who

always encouraged me to learn more.

I would also like to thank the entire iMED team for providing a friendly and supporting

environment. Had it not been for them, my stay at AstraZeneca would not have been as

bright.

Last, but not the least, I would like to thank my parents who have supported me in every

step that I have taken in my life and for encouraging me to go even further.

Working at AstraZeneca India Pvt. Ltd. has been a very fruitful experience and has given me

hands-on exposure to many laboratory techniques that will be of great use to me in the

future.

Table of Contents

List of Figures …………………………………………………………………………………………………………….. 1

List of Tables ………………………………………………………………………………………………………………. 2

List of Abbreviations …………………………………………………………………………………………………… 3

Abstract ……………………………………………………………………………………………………………………… 5

Introduction ……………………………………………………………………………………………………………….. 7

Review of Literature …………………………………………………………………………………………………… 13

Experimental Procedures …………………………………………………………………………………………… 18

Results ………………………………………………………………………………………………………………………. 22

Discussion ………………………………………………………………………………………………………………….. 36

Future Prospects ……………………………………………………………………………………………………….. 37

Appendix ……………………………………………………………………………………………………………………. 38

Bibliography ………………………………………………………………………………………………………………. 46

List of Figures

Figure 1: The synthesis and attachment of a new peptidoglycan strand to the existing

sacculus

Figure 2: Structure of the Mycobacterial cell wall, with the various components

Figure 3: Biogenesis of peptidoglycan in E. coli, and the unknown identity of the lipid-

II-flippase

Figure 4, 5: Evidence of essentiality of the Mycobacterial mviN and ftsW genes

Figure 6: Regions of the mviN knock-down recombinant construct screened by

screening primers in Table 2

Figure 7: Study of mviN KD growth kinetics under conditions of regulated expression

Figure 8: Sequence alignment of Msm MSMEG_4228 with Mtb Rv2154c shows 66%

identity

Figure 9: Sequence alignment of Msm MSMEG_0032 with Mtb Rv0017c shows 79%

identity

Figure 10: Restriction digestion screening of the recombinant antisense constructs

Figure 11: Restriction digestion screening of the recombinant mviN knock-down

construct

Figure 12: Recombination and integration of the antisense construct into the host

genome, using the attP/B sites and integrase

Figure 13: PCR screening of the recombinant antisense Msm strains by amplification

of the kanR region

Figure 14: Homologous recombination and integration of the knock-down construct

into the host genome, leading to promoter-exchange

Figure 15: PCR screening of the recombinant antisense Msm strains by amplification

of the hygR region

Figure 16: PCR screening of the recombinant antisense Msm strains using specific

screening primers

Figures 17, 18: Growth statistics of the mviN KD strains 1, 2

Figure 19: Growth of mviN antisense knock-down strain with and without IPTG

induction on solid media

Figure 20: Growth of ftsW antisense knock-down strain with and without IPTG

induction on solid media

Figure 21: Growth of mviN knock-down strains 1,2 with and without IPTG induction

on solid media (spotting)

Figure 22: Growth of mviN knock-down strains 1,2 with and without IPTG induction

on solid media (plating)

Figure 23: Cell morphology of ftsW AS strain and mviN KD strain with and without

IPTG

List of Tables

Table 1: Primers used in knock-down plasmid construction

Table 2: Screening primers used to screen mviN knock-down recombinant strains

Table 3: RNA screening primers used to estimate mRNA levels in recombinant cells

Table 4: OD values of mviN KD strains 1, 2

Table 5: Preliminary DAP extraction from wild-type Msm cells to optimize the

parameters for LC-MS/MS

Table 6: Checking reproducibility of the DAP extraction protocol

Table 7: DAP levels in Msm cultures exposed to 5X of a potential lipid-II-inhibitor

overnight

Table 8: DAP levels in Msm cultures exposed to 4X of a potential lipid-II-inhibitor for

one generation

Tables 9, 10: MIC analysis of D-Ser on Msm using INH as a reference

Tables 11, 12: Composition of a PCR reaction & Thermocycling conditions

Table 13: Composition of a restriction digestion reaction

Table 14: Composition of a ligation reaction

List of Abbreviations

ADC: Albumin dextrose catalase

Ala: Alanine

AS: Anti-sense

B.subtilis: Bacillus subtilis

BLAST: Basic Local Alignment Search Tool

BODIPY: Boron-dipyrromethene

C: Cytosine

DAP: Diaminopimelic acid

DMSO: Dimethyl sulfoxide

DNA: Deoxyribonucleic acid

E.coli: Escherichia coli

G: Guanine

HF: High fidelity

Hyg: Hygromycin

INH: Isoniazid

IPTG: Isopropyl β-D-1-thiogalactopyranoside

Kan: Kanamycin

KD: Knock-down

LB: Luria-Bertani

LC: Liquid chromatography

M.sm: Mycobacterium smegmatis

M.tb: Mycobacterium tuberculosis

MIC: Minimum inhibitory concentration

MRM: Multiple reaction monitoring

MS: Mass spectrometry

NEB: New England Biolabs

OD: Optical density

PCR: Polymerase chain reaction

PG: Peptidoglycan

ROI: Region of interest

RNA: Ribonucleic acid

RT-PCR: Reverse transcription PCR

S.aureus: Staphylococcus aureus

Ser: Serine

Ta: Annealing temperature

Tm: Melting temperature

TA: Thymine adenine

TB: Tuberculosis

UDP: Uridine diphosphate

V.okutanii: Vesicomyosocious okutanii

Van-FL: Vancomycin (Flourescent)

Abstract

Bacterial cell growth requires synthesis of the peptidoglycan (PG) layer, PG being a

glycopeptide polymer. PG synthesis happens in multiple steps, which involve:

1. Assembly of PG precursors inside the cytoplasm

2. Linking of these precursors to a C55 lipid bound to the cytoplasmic membrane

3. Flipping of the lipid linked precursor (lipid II) to the periplasmic space

4. Polymerization and cross-linking of lipid II moieties to synthesize a mesh like structure

The mesh like architecture provides rigidity to the cell and safeguards cytoplasmic

membrane from osmotic shocks. Several enzymes localized to either cytoplasm or the

cytoplasmic membrane catalyze these various reactions. A lipid-II-flippase localized to the

cytoplamic membrane performs 'flipping' of lipid II. However, the identity of this enzyme in

prokaryotes remains uncertain. mviN and ftsW both genes have been described as lipid-II-

flippase by different groups of researchers. Both of these genes individually are known to be

essential for bacterial survival. Mycobacterium smegmatis (Msm), like most other

organisms, encodes both MviN and FtsW.

Here we report an attempt made to identify which of these genes really functions as lipid-II-

flippase. While mviN was reported to be essential, there are no such reports available for

Msm ftsW. Here we describe the results of this attempt to confirm the essentiality and

assess the vulnerability of these enzymes for the survival of Msm through generation and

assessment knock-down strains. Knock-down strains of mviN and ftsW genes were

generated by either RNA silencing through expression of an anti-sense strand or through a

promoter-exchange strategy to replace the wild-type promoter with an inducible one.

Knock-down of both these genes led to a reduced and slower growth of the colonies in both

broth and solid media. We attempted to see which of the knock-down strains contributed to

altered morphology, as it is known that perturbation of peptidoglycan leads to changes in

the cellular morphology.

Additionally, an inhibitor of MviN was used to draw parallels between the effects brought

about by reduced MviN levels in the cell either using an inhibitor or shifting down the levels

through knock-down of expression.

We conclude that both these genes are essential for the growth of Mycobacterium

smegmatis. Since Msm and Mycobacterium tuberculosis (Mtb) genes share a high degree of

homology, these results can be extrapolated to Mycobacterium tuberculosis, and thus

establish these genes as novel drug targets to design for the treatment of tuberculosis.

Introduction

Bacteria come in a range of shapes (such as cocci and rods), and their internal volume is

close to ~10–12 μm3. Importantly, however, cells of any given species are rather uniform in

shape and size during vegetative growth. Therefore, growing bacteria must have robust

mechanisms to maintain their shape and pass it on to their progeny. How bacteria achieve

this remains a fundamental question in microbiology. (1)

Peptidoglycan or murein, is a polymer consisting of sugars (N-acetyl muramic acid and N-

acetyl glucosamine) and amino acids (in the form of a penta-peptide). It is substantially

thicker in Gram-positive bacteria (20 to 80 nanometers) than in Gram-negative bacteria (7

to 8 nanometers). The PG layer (sacculus) maintains cell shape and provides mechanical

strength to resist osmotic challenges. It is also involved in binary fission during bacterial cell

reproduction. The mesh-like layer surrounds the cytoplasmic or inner membrane and is

composed of glycan chains cross-linked by short peptides. Growth of this layer is a dynamic

process requiring various enzymes to make PG and attach it to the existing layer, and

hydrolases to cleave the layer to allow insertion of the newly synthesized material. (1)

Inhibition of cell wall synthesis by penicillin or other antibiotics leads to rapid cell lysis,

making cell wall homeostasis a proven target for antimicrobials, the most successful class

being β-lactams. (2)

Peptidoglycan is an essential component of the growing bacterium and hence the enzymes

involved in its biosynthesis are expected to be essential. As mentioned above, it is

synthesized in 2 phases, in a compartmentalized manner:

1. A cytoplasmic phase where in the precursor lipid II is synthesized

2. An extra-cytoplasmic phase where in polymerization and cross linking of lipid II

happens

The synthesis of peptidoglycan itself occurs in three overall stages. First, soluble, activated

nucleotide precursors (UDP‑N-acetylglucosamine and UDP‑N-acetylmuramyl pentapeptide)

are synthesized in the cytoplasm. Though they are synthesized in the cytosol, they are used

by extracellular enzymes to build the PG polymer. Second, at the inner leaflet of the inner

membrane, the nucleotide linked precursors are assembled with a membrane-embedded

isoprenoid (lipid) carrier, which is subsequently modified to form the lipid-anchored

disaccharide-pentapeptide monomer subunit (lipid II), and are physically flipped across the

membrane to expose the disaccharide-pentapeptide monomer to the extracellular space.

Third, lipid II is polymerized, releasing isoprenoid pyrophosphate, and the resulting glycan

chains are inserted into the peptidoglycan layer. (1) After addition of the monomer to the

growing PG chain, the isoprenoid carrier is recycled (Figure 1).

The genus Mycobacteria falls under the category of acid fast bacteria. It is known to cause

serious diseases in mammals, like tuberculosis (TB) and leprosy. All Mycobacterium species

share a characteristic cell wall, thicker than in many other bacteria. Mycobacterial cell wall is

hydrophobic, waxy, and rich in mycolic acids (mycolates). The mycolate layer and the PG

layer are held together by arabinogalactan (Figure 2). The proteins involved in the

biosynthetic pathways of cell wall components are potential targets for new drugs for TB.

Figure 1: The synthesis and attachment of a new peptidoglycan strand to the existing sacculus, with particular emphasis on the different synthetic and degrading enzymes

It remains unclear which of these diverse PG biosynthetic activities are controlled to govern

cell wall metabolism, and few regulatory proteins have been described. To understand this

process in Mycobacteria, we searched for possible gene targets that would inhibit PG

synthesis. Several integral membrane proteins are required for this process, and these

proteins likely form complexes specific to each sub-cellular site of PG synthesis. MraY and

MurG synthesize the mature precursor. SEDS (shape, elongation, division, and sporulation)

proteins such as ftsW, which has been proposed to have lipid-II-flippase activity, may

catalyze inversion. The integral membrane protein mviN has also been proposed to invert

lipid II. (2)

Given the alarming rise of resistance to TB drugs worldwide, the identification of novel drug

targets is critical for the future of TB control. Identification of new drug targets is vital for

the advancement of drug discovery against Mycobacterium tuberculosis, especially given the

increase of resistance worldwide to first and second-line drugs. Many attempts to develop

new drugs for infectious diseases have employed a target-based strategy, for example,

conducting high-throughput assays of large compound libraries for inhibition of a critical

enzyme/protein. (3) Testing the essentiality is a common first step in validating a target, but

there is an increasing interest in identifying vulnerable targets for which incomplete

inhibition affects a lethal phenotype. (4) Based on these assays, several inhibitors of

peptidoglycan biosynthesis have been identified which inhibit different steps.

Figure 2: Structure of the Mycobacterial cell wall, with the various components

Lipid-II-flippase belongs to translocase family of proteins. It catalyses flipping of lipid II

precursor from the cytoplasmic space to periplasmic space, enabling polymerization and

cross linking. Its activity is very important to build the PG layer in the periplasmic space

(Figure 3).

We hypothesize that the knock-down of lipid-II-flippase will inhibit the formation of PG

resulting in growth inhibition. Inhibition of flippase, therefore should lead to accumulation

of lipid II and hence diaminopimelic acid (DAP). We emphasize on DAP, as it is an unusual

amino acid which represents an epsilon-carboxy derivative of lysine. It is a characteristic of

most bacterial cell walls. DAP estimation will provide an easy and specific assay method to

study the effects of lipid-II-flippase knock-down.

The proposed project work enables identification of yet another target in the PG

biosynthesis pathway for the discovery of an anti-TB agent. It aims to evaluate the

essentiality and vulnerability of lipid-II-flippase which catalyses the translocation of lipid II,

the PG precursor, across the cytoplasmic membrane. During the study, the project also aims

to determine if reduced expression (through target knockdown by genetic means) or

inhibition (through an inhibitor) of lipid-II-flippase leads to bacteriostatic or bacteriocidal

effect. We utilize the IPTG-inducible system to generate knockdown strains of the mviN and

Figure 3: Biogenesis of peptidoglycan in E. coli, and the unknown identity of the lipid-II-flippase

ftsW genes in Mycobacterium smegmatis (which are the two potential lipid-II-flippases) to

determine essentiality and vulnerability simultaneously.

Reduced expression or inhibition of lipid-II-flippase will inhibit the formation of

peptidoglycan, should therefore result in intracellular accumulation of lipid II and DAP.

The proposed project focuses on achieving the following:

1. Generation of target knock-down strain

2. Growth kinetics under target knock-down condition

3. Measurement of DAP to see if it accumulates in cells post exposure to a lipid-II-

flippase inhibitor and in parallel in a KD strain grown under optimal and sub-optimal

conditions

Although we aim at validating gene targets for Mycobacterium tuberculosis, we will be

carrying knock-down studies in Mycobacterium smegmatis, which is a saprophytic fast

grower. Use of M. smegmatis does not require special training and special lab facilities and

the experiments can be completed in a short period of time.

Msm is useful for the research analysis of other Mycobacteria species in laboratory

experiments. The ease with which it can be genetically manipulated, combined with the

relatively low risk it poses to laboratory workers, have made it an attractive model for the

study of a number of aspects of tuberculosis biology. One example of this is the hypoxia

response of M. smegmatis which exhibits similarities to that found in M. tuberculosis. It is a

simple model that is easy to work with, i.e., with a fast doubling time and only requires a

bio-safety level 1 laboratory (as it is non-pathogenic). The time and heavy infrastructure

needed to work with pathogenic species prompted researchers to use Msm as a model for

Mycobacterial species. This species shares more than 2000 homologues with Mtb and

shares the same unusual cell wall structure of Mtb and other Mycobacterial species.

Also, the discovery of plasmids, phages, and mobile genetic elements has enabled the

construction of dedicated gene-inactivation and gene reporter systems. The Msm MC2155

strain is hyper-transformable, and is now the work-horse of mycobacterial genetics.

Furthermore, it is readily cultivatable in most synthetic or complex laboratory media, where

it can form visible colonies in 3–5 days. These properties make it a very attractive model

organism for Mtb and other Mycobacterial pathogens. (5)

Review of Literature

Existing literature shows that there are two potential candidates for the lipid-II-flippase in

bacteria- FtsW, the cell division protein, and MviN, the membrane protein.

There is bioinformatics evidence that MviN is the PG lipid-II-flippase in E.coli. Dr. Ruiz has

used a reductionist bioinformatics approach to identify MviN as the lipid-II-flippase, and has

given genetic and biochemical data to support his claim. mviN inhibition blocks PG

polymerization and causes an accumulation of mature lipid-linked PG precursors in

Escherichia coli, indicating an essential role in either the export of precursors or their

addition to the growing PG meshwork. Dr. Ruiz has also argued in favour of MviN (and

against FtsW) as the potential lipid-II-flippase as ‘the peptidoglycan producer

Vesicomyosocious okutanii lacks FtsW and the PG-less Mollicute Eubacterium dolichum DSM

3991 has two FtsW homologs, therefore MviN must be the essential lipid-II-flippase’, and

mviN is seen to be conserved among the PG-producing endosymbionts. (6)

Also, Gee et al have described an MviN dependant process of PG synthesis, which they

conclude by saying that the mviN domain of the Rv3910 gene in Mtb is an essential domain.

They show that MviN depletion alters cell morphology and decreases the cell count in a

culture, while increasing intra-cellular DAP pools. Conditional degradation of proteins in the

phosphorylation-dependent regulatory complex Mycobacteria demonstrated that mviN was

essential for growth and PG biosynthesis. A test of essentiality was done by determining

whether transposon insertion mutations could be tolerated in different regions of the mviN

gene. In the mviN locus, transposon insertions were not observed in any of the 28 potential

TA insertion sites in the mviN domain. This distribution suggested that the mviN domain was

essential for in vitro growth. (2)

On the other hand, there is biochemical evidence that FtsW is the transporter of lipid-linked

PG precursors across a bacterial cell membrane. T. Mohammadi et al show that purified

FtsW (from E. coli) induces the trans-bilayer movement of lipid II in model membranes, and

mviN may be involved in a less important, supporting role. On the basis of fluorescence

studies to assay the transport of labeled lipid II across bacterial inner membrane vesicles

and on biochemical evidence accumulated from the reconstituted system, this work

revealed that FtsW is a lipid II transporter. Moreover, these findings argued against Dr.

Ruiz's reports that proposed MviN (MurJ) as the putative lipid-II-flippase. The membrane

study results are consistent with the finding that was very recently reported by Fay and

Dworkin, describing that mviN homologues in B. subtilis are not essential for growth and do

not seem to have a role as the flippase of lipid II.

Furthermore, FtsW was encountered among the preserved proteins, previously revealed by

the bioinformatics search for candidates for lipid-II-flippase by Dr. Ruiz himself. In spite of

this, a role of this protein as a lipid-II-flippase was not considered, as FtsW was absent in the

PG-bearing V. okutanii (that does possess RodA), and two of its homologues were present in

the PG-less Mollicute Eubacterium dolichum DSM 3991. Yet, there are several examples of

proteins specifically required for a defined process such as PG biosynthesis in bacteria

possessing a cell wall, that are also encountered in bacteria lacking this biosynthetic route.

Adding to this, in contrast to over expression of FtsW, over expression of MviN did not result

in enhanced transport of labeled lipid II. (7)

The Online Gene Essentiality database (OGEE) lists the MviN (Rv3910) gene as essential, and

the TubercuList database lists the FtsW (Rv2154c) gene as essential (Figures 4, 5).

Figure 4, 5: Evidence of essentiality of the Mycobacterial mviN and ftsW genes

The evidence for this mviN (Rv3910) essentiality is a study conducted by Dr. Sassetti, in

which a total of 194 genes that are specifically required for Mycobacterial growth in vivo

were identified by creating a mutant library. The behavior of these mutants provides a

detailed view of the changing environment that the bacterium encounters as infection

proceeds. A surprisingly large fraction of these genes are unique to Mycobacteria and

closely related species, indicating that many of the strategies used by this unusual group of

organisms are fundamentally different from other pathogens. (8)

Griffin et al employed a new method of global phenotypic profiling to directly define the

genes required for the growth of Mycobacterium tuberculosis. A combination of high-

density mutagenesis and deep-sequencing was used to characterize the composition of

complex mutant libraries exposed to different conditions. This allowed the unambiguous

identification of the genes that are essential for Mtb to grow in vitro, and proved to be a

significant improvement over previous approaches. ftsW (Rv2154c) essentiality was

confirmed by this study. (9)

We conclude that there are still varying opinions about the potential candidates of the

essential Mycobacterial lipid-II-flippase. By our knock-down studies, we aim to validate the

essentiality of mviN and ftsW, and their role as the translocase under discussion.

Alongside, to confirm the identity of the lipid-II-flippase with the generated knock-down

strains, we carry out a fluorescence staining experiment. We also use a potential flippase

inhibiting compound to test the effects on growth of the cells.

For this purpose, we develop an optimized method for the estimation of DAP levels in

Mycobacterium smegmatis cells, to directly assess the role of lipid-II-flippase (MviN/FtsW) in

PG synthesis. DAP is an unusual amino acid exclusively used in PG synthesis.

AstraZeneca provided us with a potential lipid-II-flippase inhibitor AZ13692414, which has

been known to have a bacteriocidal effect on Msm. We quantified the accumulation of

solvent-extractable PG precursors containing DAP. These precursors represent both

nucleotide-linked muropeptides and more mature lipid-linked compounds, all of which are

extractable only before their polymerization into the mature cell wall. (2)

To visualize the effects of gene knock-down in Mycobacterium smegmatis, we use BODIPY

Vancomycin-FL to label nascent PG in the cell wall of the recombinants/ compound-exposed

cells as described by Huber et al, and compare it to that of wild-type cells. (10) Vancomycin

binds the D-alanyl-D-alanine residues present in the carboxyl terminal of the PG precursor.

When peptidoglycan precursors are incorporated in the cell wall they become cross-linked

via a transpeptidation reaction, in which the D-Ala-D-Ala bond is cleaved and the terminal D-

Ala is released to allow formation of the cross bridge to occur. Additionally,

carboxypeptidases are able to hydrolyse the D-Ala-D-Ala peptide bond to control the extent

of PG cross-linking. For these reasons, D-Ala-D-Ala residues are more abundant in newly

synthesized cell wall and a fluorescein conjugate of vancomycin (Van-FL) preferentially

labels nascent cell wall in various Gram-positive bacteria. However, in the case of S. aureus

the cell wall has a high number of D-Ala-D-Ala residues even in the mature peptidoglycan,

possibly due to low carboxypeptidase activity and being a Gram-positive organism it also has

a very huge peptidoglycan layer. Therefore, when exponentially growing cells of S. aureus

are labeled with Van-FL, the entire cell wall and septum is labeled. To distinguish between

newly synthesized and older cell wall in S. aureus, Pinho and Errington developed a method

in which the bacteria was first grown in the presence of an excess of D-Serine: this led to the

replacement of the carboxyl-terminal D-Alanine residue of the PG precursor by a D-Serine

residue without additional significant changes in the muropeptide composition of the PG.

The D-serine was then removed from the medium, resulting in normal incorporation of D-

Ala. As vancomycin has a greater affinity for the precursor containing D-Ala-D-Ala than for

D-Ala-D-Ser, Van-FL labeling at this stage specifically labeled new PG. (11) We extended the

same strategy to label Msm cells, and first grew the wild type and recombinant/ compound

exposed cells in the presence of D-Serine. The Van-FL concentration used was 1 μg/ml, as

used by Carlsson et al. (12)

Yabu and Huempfner have discovered that D-Serine inhibited the growth of Mycobacterium

smegmatis and induced the morphological alteration of the bacilli. In cells cultured in the

presence of D-Serine, the amounts of alanine, diaminopimelic acid, and glycine inserted into

the cell wall were reduced, and serine was increased. They showed that there was a 90%

growth inhibition in the presence of 10mM D-Ser, and 70% inhibition with 5mM D-Ser for

the Msm strain ATCC 607 in modified Dubos liquid-medium. (13) Since Van-FL labeling

required us to grow M.sm strain MC2155 in the presence of D-Ser, we had to determine the

MIC of D-Ser for Msm to find a sub-inhibitory concentration of D-Ser that we could use.

Experimental Procedures

(Refer to Appendix for detailed protocols)

Bacterial strains and culture conditions

E. coli strain DH5α was used for generating the mviN/ftsW anti-sense plasmids, as well as

the mviN knock-down plasmid. These cells were grown in Luria-Bertani (LB) medium/agar at

37°C, with appropriate antibiotics.

M. smegmatis strain MC2155 was used as the target host for the anti-sense and knockdown

plasmids. These cells were handled and grown in sterile conditions in 7H9 media (with ADC

supplement)/agar at 37°C, with the appropriate antibiotics and inducers.

Antibiotics were added at the following concentrations: kanamycin (Kan), 50μg/ml for E. coli

and 20 μg/ml for M. smegmatis; hygromycin (Hyg), 150 μg/ml for E. coli and 50 μg/ml for M.

smegmatis.

The inducer IPTG was used at concentrations varying from 10 μM to 1000 μM.

Sequence alignment of Rv2154c with MSMEG_4228, and Rv0017c with MSMEG_0032

There is no data on the essentiality of the FtsW cell division protein (MSMEG_4228) or the

FtsW family cell cycle protein (MSMEG_0032) in M. smegmatis. The amino acid sequences

of both these proteins were aligned with their respective homologues in M. tuberculosis

using Protein BLAST online tool.

(http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LINK_L

OC=blasthome)

Plasmid construction

The PCR primers used in plasmid construction are listed in Table 1.

Plasmid pAZI0301 was used for anti-sense fragment expression of the mviN/ftsW genes.

This plasmid contains an origin of replication site for E. coli, an IPTG inducible promoter, an

attP site with an integrase for integration into the M. smegmatis genome, and a kanamycin

selectable marker. Plasmid pAZI9452 was used for knock-down of the mviN gene. This

plasmid contains an inducible IPTG promoter (which needs to be exchanged with the wild-

type Msm promoter), an origin of replication site for E. coli, and a hygromycin selectable

marker.

The mviN/ftsW anti-sense fragments (1.6/1.7kb) and the truncated mviN knock-down

fragment (0.76 kb) were PCR amplified from genomic Msm DNA with Phusion polymerase

(Thermo). The anti-sense fragments were cloned into pAZI0301 using vector and PCR primer

KpnI and NheI sites. The knock-down truncated fragment was cloned into pAZI9452 NdeI

and HindIII sites. The resulting recombinant plasmids were transformed into DH5α

competent cells, and screened by colony PCR & confirmed by restriction digestion analysis.

Positive recombinant plasmids were extracted and purified.

Gene

Forward primer

Reverse primer

Annealing temp with Phusion

Amplicon length

mviN AS

CAAAGCTAGCATGAACGCAACCCAG (NheI)

AAAAGGTACCCGGGAGCATGATCAG (KpnI)

72 °C 1.6 kb

ftsW AS

AAAAGCTAGCGTGGGCAGCATCCTC (NheI)

CAAAGGTACCTCACCCGTAACGCTG (KpnI)

72 °C 1.7 kb

mviN KD

ATCGAACATATGAACGCAACCCAGCC (NdeI)

TTATAAGCTTCCGCAGGCTGATGCG (HindIII)

72 °C 0.7 kb

Msm knock-down strain generation

Purified recombinant plasmids were electroporated into the Msm MC2155 strain. Colony

PCR was done to identify colonies as expected recombinants using Phusion polymerase.

Transformants containing the mviN and ftsW anti-sense constructs were selected on 7H9

agar supplemented with 20 μg/ml kanamycin. Colonies were screened by PCR using primers

of kanR conferring gene.

Transformants containing the mviN knock-down construct were selected on 7H9 agar

supplemented with 50 μg/ml hygromycin, and different concentrations of the inducer IPTG-

0 μM, 50 μM, 500 μM. Colonies were screened using hygR primers, and specific screening

primers listed in Table 2 (Figure 6).

Table 1: Primers used in knock-down plasmid construction

Figure 6: Regions of the mviN knock-down recombinant construct screened by screening primers in Table 2

Primer set

Forward primer Reverse primer Annealing temp with

Phusion Amplicon length

1 CCAAGCCGACACGTCGAACACC GCCAACTCAGCTTCCTTTCGGG 50 °C 0.85 kb 2 GTGAGCGCTCACAATTCCTCTAG CAGCACGTAGAGCACCATCGC 53 °C 0.96 kb

3 GTGAGCGCTCACAATTCCTCTAG AAATCCTAGGCGGCTCAGGAGGCG 50 °C 3.7 kb

Inducer dose-response assay

Recombinant strains were grown in 384-well micro-titer plates at different IPTG

concentrations- 0 μM, 30 μM, 100 μM and 300 μM, at 37°C. OD at 600nm was taken at 24

hrs and 72 hrs.

Anti-sense strains showing best dose-response (less growth at higher IPTG concentrations)

were selected and grown in 0uM IPTG media. Knock-down strains showing best dose-

response (significantly more growth in the presence of IPTG (Figure 7)) were selected and

grown at their optimal inducer concentrations. The growth was monitored, and best

growing strains were inoculated into a larger culture volume, with and without inducer.

The growing recombinant cultures were also spotted/ plated onto + and – IPTG agar plates,

to visualize the effects of the inducer on growth.

The strains with and without IPTG were then mounted on slides, stained, and visualized

under a microscope to observe changes in cell morphology.

Intracellular DAP estimation

A wild type M.sm culture was grown to reach an OD of 0.2. Two sets of 100 ml triplicates

were taken. One set was exposed to 5X of a potential inhibitor compound overnight, and

the other set was kept as a control. DAP was extracted from each of the samples and sent

for LC-MS/MS analysis. Propranolol (similar properties to DAP) was used as an internal

Table 2: Screening primers used to screen mviN knock-down recombinant strains

Figure 7: Study of mviN KD growth kinetics under conditions of regulated expression

standard to account for loss in DAP levels during the extraction and estimation procedure.

The experiment was also repeated with a 4X exposure period of one generation (4 hrs).

D-Ser MIC analysis

We performed a minimum inhibitory concentration (MIC) analysis for D-Ser on M.sm in a

96-well plate, since it has been known to inhibit growth. We use a starting concentration of

20 mM, and follow a subsequent 2-fold dilution. INH is used as a control, with a starting

concentration of 32 μg/ml. Cell numbers of 105 and 106 cells/ml were used to see the drop

in MIC at lower cell counts. These cultures were grown in Luria-Bertani broth. An OD

measurement was taken after 2 days of incubation, at 600 nm. The D-Ser dilution was done

in Milli-Q water, and the INH dilution was done in DMSO.

% activity = (OD of treated culture/OD of untreated culture) * 100

% inhibition = 100 – (% activity)

Fluorescent vancomycin staining

Bacterial cultures were grown in the presence of 20 mM D-Ser till they reached mid-log

phase, so that D-Ser can replace all the D-Ala in the PG layer. They were then washed,

resuspended, and grown for one generation (2 hrs) without D-Ser (with 5X inhibitor as

needed) at 30°C, so that D-Ala can incorporate into the nascent PG layer. Nascent PG was

labeled on the cell surface by adding a mixture of 1 μg/ml of BODIPY- vancomycin to wild-

type or recombinant cells for 90 min at 37°C, with agitation. This van-FL binds to the D-Ala

residues in the PG layer. Bacterial cells were washed with PBS, concentrated, placed on a

sterile glass slide, mounted with Vectashield, and visualized on a laser scanning microscope.

Fluorescence was measured (excitation 485 nm and emission 530 nm). Images were

captured and fluorescence was quantified in regions of interest (ROIs). An equal area

proximal to the ROIs provided corrections for background intensity. The fluorescence values

were normalized to the OD of the same samples.

Results

Msm MSMEG_4228 and MSMEG_0032 were homologous to Mtb Rv2154c and Rv0017c

respectively

The bioinformatics analysis showed that MSMEG_4228 has 66% identity with Rv2154c (FtsW

like protein), which is an essential gene, and MSMEG_0032 has 79% identity with Rv0017c

(probable cell division protein RodA), which is a non-essential gene (Figures 8, 9). The results

led us to hypothesize that MSMEG_4228 is the essential ftsW in Msm as well.

We chose MSMEG_4228 as the probable ftsW gene as our knock-down target, along with

MSMEG_6929, the putative integral membrane protein gene mviN.

Figure 8: Sequence alignment of Msm MSMEG_4228 with Mtb Rv2154c shows 66% identity

Recombinant plasmids for RNA silencing (pAZI0301) and for gene knock-down (pAZI9452)

were constructed

The recombinant anti-sense constructs for mviN and ftsW were screened using PCR with the

respective anti-sense primers used for plasmid construction. Two positive plasmids for each

were further screened by digestion with SalI. (M1, 2 from recombinant E. coli colonies 6, 8;

F1, 2 from recombinant E. coli colonies 11, 12) (Figure 10).

The recombinant knock-down construct for mviN was screened using PCR with the primers

used for the knock-down plasmid construction. Two positive plasmids were further

screened by digestion with SalI (Figure 11).

These positive recombinant plasmids were used for electroporation into Msm.

Figure 9: Sequence alignment of Msm MSMEG_0032 with Mtb Rv0017c shows 79% identity

Msm MSMEG_4228 and MSMEG_6929 gene knock-down strains FAS, MAS and MKD were

constructed

The anti-sense and knock-down plasmid constructs (2 purified constructs of each) were

electroporated into Msm MC2155.

The mviN and ftsW anti-sense constructs get integrated into the attB site of the wild-type

Msm, by recombination with the vector attP site, in the presence of a kanamycin pressure,

giving the MAS and FAS strains respectively (Figure 12). The anti-sense fragments are

controlled by the inducible pLac promoter, and are only transcribed in the presence of the

inducer IPTG. This resulted in the silencing of the mviN/ftsW genes, respectively, and affect

the growth of the recombinant strains depending on the essentiality and vulnerability of the

genes. These strains were screened by kanR primers (Figure 13).

Figure 10: Restriction digestion screening of the recombinant antisense constructs: VC- pAZI0301 undigested control (Size- 6.5kb), FC1,2- Undigested recombinant ftsW AS vectors (Expected size- 8.2 kb), MC1,2- Undigested recombinant mviN AS vectors (Expected size- 8.1 kb); V- Digested pAZI0301(SalI digestion, expected bands- 1.5, 5 kb), F1,2- Digested recombinant ftsW AS vectors (SalI digestion, expected bands-1.1, 2.1, 5 kb), M1,2- Digested recombinant mviN AS vectors (SalI digestion, expected bands- 0.5, 0.6, 1.9, 5 kb) Figure 11: Restriction digestion screening of the recombinant mviN knock-down construct: VC- pAZI0301 undigested control (Size- 5.5kb), V1,2- Undigested recombinant vectors (Expected size- 6.3kb); VD- Digested pAZI9452 (SalI digestion, expected bands- 1.1, 4.4 kb), VD1,2- Digested recombinant vectors (SalI digestion, expected bands- 1.1, 1.9, 3.2 kb)

The mviN knock-down construct gets integrated into the Msm host genome by homologous

recombination between the truncated mviN gene in the recombinant vector, and the wild-

type mviN gene, in the presence of a hygromycin pressure, giving the MKD strain (Figure

14). This also gives rise to a promoter-exchange which causes the wild-type full-length mviN

gene to be controlled by the inducible pLac promoter. This recombinant strain will only

grow in the presence of an appropriate concentration of IPTG, as the wild-type promoter

only allows transcription of the truncated (redundant) mviN gene, depending on the

essentiality and vulnerability of the mviN gene. These strains were screened by hygR

Figure 12: Recombination and integration of the antisense construct into the host genome, using the attP/B sites and integrase

Figure 13: PCR screening of the recombinant antisense Msm strains by amplification of the kanR region: Col 11,12- Purified constructs from initial E. coli ftsW AS clones 11,12; Col 6,8- Purified constructs from initial E.coli mviN AS clones 6,8); Three colonies from each of the electroporations are screened

primers (Figure 15), as well as specific screening primers (as described in Table 2) (Figure

16). The screening primers used here gave non-specific amplicons/no amplicons, and hence

this method of screening was inconclusive.

Figure 14: Homologous recombination and integration of the knock-down construct into the host genome, leading to promoter-exchange

Figure 15: PCR screening of the recombinant antisense Msm strains by amplification of the hygR region: A total of 14 colonies from the two electroporations were screened

Recombinant strains show differential growth in the presence of inducer IPTG

After electroporation and plating, 32 recombinants of each type were selected and grown at

0, 30, 100 and 300 μM IPTG in 40 μl cultures. Growth was monitored for 72 hrs, and cultures

showing desired dose-response were selected and grown at optimal IPTG in a 24-well plate

in a 200 μl culture.

10/32 mviN AS strains showing reduced growth in the presence of IPTG were selected and

grown at 0 IPTG. Finally, a single best-growing culture was selected and expanded, and

grown at 0, 10, 100 μM IPTG in a broth. Growth was monitored and cultures were spotted

on + and - IPTG plates. Similarly, a single best-growing ftsW AS culture was selected of the

8/32 selected, and expanded, and growth was monitored. These cultures were grown in

agitated Corning tubes, in 5 ml volumes.

The anti-sense cultures showed similar growth with and without IPTG induction, but

compared to the wild-type Msm, the growth was slow & reduced and the colony

morphology on agar was seen to be different- It was more smooth, round shiny and waxy

(Figures 17, 18) as compared to the wild-type morphology (similar to that shown in Figures

19, 20).

7/32 mviN KD strains showing increased growth in the presence of IPTG were selected and

grown at the optimal IPTG concentrations. Finally, two best-growing cultures were selected

and expanded, and grown at 0, 10, 100 μM IPTG in a broth. Growth was monitored and

cultures were spotted on + and – IPTG plates. These knock-down strains showed

Figure 16: PCR screening of the recombinant antisense Msm strains using specific screening primers (as mentioned in Figure 6 and Table 2): Non-specific amplicons

significantly higher growth with IPTG induction. On agar, growth with induction was faster

than that without induction. Colony morphology was seen to be similar to wild-type.

Two dilutions were also plated on + and - IPTG plates at 0 hrs to obtain a difference in cell

numbers. The – IPTG plates after 48 hrs of incubation showed no colonies, whereas the +

IPTG plates showed colonies. After 96 hrs of incubation, small colonies came up on the –

IPTG plates, while the colonies on the + IPTG plates grew considerably larger, even though

the colony count on both plates was similar. Based on these results, we could infer that

mviN knock-down causes inhibition of cell growth, and the knock-down strains have longer

lag periods. But this knock-down did not cause cell lysis, as the cell numbers with and

without induction remained the same (Figures 19, 20).

The cell density of the mviN KD 1, 2 cultures growing with and without IPTG is given in

Figures 17, 18 and the OD values are given in Tables 4.

Difference in cell morphology was observed under a microscope after acid-fast staining of

the Msm cells. No morphological difference was observed in the ftsW AS cells grown with

and without IPTG, but there was more background cell debris in the samples with IPTG,

which may imply cell lysis due to ftsW knock-down to a certain extent.

The mviN KD cells grown with IPTG looked healthier, with more cells seen to be in the

dividing stage (attached to each other, not separated), as compared to the cells grown

without IPTG. This may be because mviN synthesis is essential for cell-division.

0 IPTG 100 IPTG 0 IPTG 100 IPTG

0 hrs 0.002 0.002 0.002 0.002

24 hrs 0.14 0.101 0.039 0.108

48 hrs 0.473 0.938 0.639 1.179

mviN 1 mviN 2

Table 4:OD values of mviN KD strains 1, 2: Grown in 0 and 100 μM IPTG

Figure 19: Growth of mviN antisense knock-down strain with and without IPTG induction on solid media: Different dilutions of cultures were spotted onto +/- IPTG plates at 0, 24, 48 hrs and incubated; Growth is slow and morphology differs from a wild-type strain

Figures 17, 18: Growth statistics of the mviN KD strains 1, 2: Based on data in Table 4

Figure 20: Growth of ftsW antisense knock-down strain with and without IPTG induction on solid media: Different dilutions of cultures were spotted onto +/- IPTG plates at 0, 24, 48 hrs and incubated; Growth is slow and morphology differs from a wild-type strain

Figure 21: Growth of mviN knock-down strains 1,2 with and without IPTG induction on solid media (spotting): Different dilutions of cultures were spotted onto +/- IPTG plates at 0, 24, 48 hrs and incubated; Growth is slow without IPTG induction; Cultures initially grown in a broth without IPTG grow slower when plated on IPTG plates, than those grown in a broth containing IPTG

Figure 22: Growth of mviN knock-down strains 1,2 with and without IPTG induction on solid media (plating): Different dilutions of cultures (10-5 and 10-6) were plated onto +/- IPTG plates at 24 hrs and incubated; Cell count is similar with and without induction; Growth is slow without IPTG induction and fast with induction

Figure 23: Cell morphology of ftsW AS strain and mviN KD strain with and without IPTG: ftsW AS- 1 shows cells grown without IPTG, 2 shows cells grown with IPTG- Both morphologies are similar, but picture 2 shows more cell debris in the background, which may imply cell lysis; mviN KD- 3 shows cells grown without IPTG- The cells look unhealthy and isolated,and dividing cells are not seen , 4 shows cells grown with IPTG- The cells look healthy, and some cells appear to have divided and attached at the dividing point, which may imply essentiality of the MviN protein for proper cell division

DAP estimation protocol was optimized and basal DAP levels in wild-type

untreated/treated Msm cells were estimated

Basal DAP levels in wild-type Msm at mid-log phase (OD 0.2) ranged from 40-120 nM. It was

predicted that exposing a wild-type Msm culture to a potential mviN inhibitor would lead to

an accumulation of DAP inside the cells, and subsequently higher DAP levels than untreated

cells. Exposure to 5X of the inhibitor overnight and for one generation, both resulted in DAP

levels 3-4 folds lower than those of the untreated cells. This was consistent with the known

cidal effect of the compound which led to a drastic reduction in the cell-count, thus leading

to much lower DAP levels. These results were inconclusive, as they proved wrong our initial

hypothesis that DAP would accumulate if the lipid-II-flippase was inhibited.

D-Ser shows an MIC higher than 20 mM for MC2155 in LB broth

The OD of the cultures in the 96-well plate exposed to D-Ser and INH was taken at 600 nm

after 2 days of exposure. The % inhibition for the INH control was found to be >80% within

an INH concentration range of 2-4 μg/ml. This is the expected and established MIC of INH

for Msm, and it can be concluded that the control worked fine.

Table 5: Preliminary DAP extraction from wild-type Msm cells to optimize the parameters for LC-MS/MS: Basal DAP in a 100 ml culture of 0.2 OD was found to be 44nM using 6 replicates; % CV < 15%; Matrix effect is high (45%) but may not be limitation Table 6: Checking reproducibility of the DAP extraction protocol: Basal DAP in a 100 ml culture of 0.2 OD was found to be 113nM using 6 replicates; % CV < 20% Table 7: DAP levels in Msm cultures exposed to 5X of a potential lipid-II-inhibitor overnight: Basal DAP in a 100 ml culture of untreated cells (2 OD) was found to be 6641 nM using 3 replicates; Basal DAP in a 100 ml culture of treated cells (0.05 OD) was found to be 26 nM using 3 replicates, which is 4 folds lower than basal concentrations observed in previous experiments Table 8: DAP levels in Msm cultures exposed to 4X of a potential lipid-II-inhibitor for one generation: Basal DAP in a 100 ml culture of untreated cells (1 OD) was found to be 502 nM using duplicates; Basal DAP in a 100 ml culture of treated cells (0.25 OD) was found to be 50 nM using duplicates, which is 2 folds higher than basal concentrations observed in previous experiments

D-Ser did not show an MIC even at a concentration of 20 mM, which is more than the 10

mM MIC previously reported. 80% inhibition will take place at a concentration higher than

20 mM. This may be due to the difference in the strain used for the experiment (MC2155

used here, vs. ATCC 607 used by Yabu and Huempfner). Thus, for subsequent Van-FL

staining experiments, cultures can be grown at a D-Ser concentration of 20 mM.

It was also evident that a higher concentration of the compound is required to inhibit

growth of cultures with a higher cell density.

Msm cells do not take up the Van-FL stain

The slides mounted with the stained cell populations were visualized by fluorescence

microscopy. The wild-type cells and the recombinant cells did not show uptake of the dye,

though the background fluorescence was high. The cells treated with the potential inhibitor

(AZI3692414) showed appreciable amount of fluorescence within the cells, but this was still

not enough to be counted as a positive signal (For a positive signal, the sample fluorescence

should be 1.8 times more than the background fluorescence). There was also a lot of debris

seen around the cells.

We thus concluded that the 2 hour incubation in the absence of D-Ser was not enough for

D-Ala to incorporate, and hence the cells did not take up the Van-FL stain which is specific to

the D-Ala-D-Ala residue. We also made an inference that the inhibitor AZI3692414

Tables 9, 10: MIC analysis of D-Ser on M.sm using INH as a reference: The MIC value for D-Ser lies above 20mM

perforated the cells (as it is known to have a cidal effect) and the Van-FL dye then entered

the cell interior.

Discussion

The enzymes involved in the assembly of cell wall peptidoglycan have been known for

decades. However, the protein that transports the lipid-linked (PG) precursors across the

cytoplasmic membrane was the last key step in this fundamental process that remained to

be identified. Attempts to unravel this route have been hampered by the unavailability of

convenient assays, allowing for studying the flippase activity and the biochemical events of

transport experimentally.

We developed recombinant strains in which both potential lipid-II-flippase candidates, mviN

and ftsW were knocked-down.

The growth phenotypes of our recombinant strains demonstrated that knock-down of both

the genes involved in cell wall biosynthesis had an appreciable effect on growth and

viability. The recombinant strains were characterized in more detail.

Recombinant strains expressing lower levels of the mviN or ftsW by RNA anti-sense silencing

gave rise to colonies with a distinct morphology. Growth was slower than wild type Msm on

solid media. Both the anti-sense knock-down strains were severely compromised for growth

in culture.

The mviN knock-down strain in which promoter replacement is achieved by recombination,

showed much higher and faster growth in the presence of the IPTG inducer, as expected.

Targeting cell wall biosynthesis had a considerable level of phenotypic effect, but growth

even in the absence of inducer (promoter-exchange knock-down) or in the presence of

inducer (anti sense knock-down) continued, albeit at slower rates. This suggests that a level

of expression from a non-induced promoter occurs.

Future Prospects

Till now, we have been successful in constructing recombinant strains, in which both

potential lipid-II-flippase candidates, namely mviN and ftsW, have been knocked-down.

Preliminary characterization studies like growth kinetics and inducer dose-response have

been carried out. These experiments can be carried out on a larger scale, and exposed to a

wider range of inducer concentrations. Growth curves can be plotted and compared to that

of the wild-type Msm culture.

RNA levels of the recombinant strains can be estimated at any given point in time, and can

be compared with wild-type RNA levels.

DAP levels can be estimated for recombinant knock-down strains grown with and without

the inducer, as described in this project. This may give us a clear picture of the differential

levels of DAP in cultures with and without inhibition (induction with IPTG).

The fluorescence staining experiment can be optimized to work effectively and give us

valuable results.

Levels of protein expression differ from the mRNA levels in a cell at any given point in time.

To go to the level of protein expression, western blots can be performed to estimate the

amounts of protein synthesized in these recombinant strains, compared to the wild-type

strains.

The two proteins can also be individually isolated and used in synthetic membrane studies,

to check which one performs the role of a lipid-II-flippase, in the presence of PG precursors

in the vesicle lumen. This protocol has been described by Mohammadi et al. (7)

Also, we can study the ability of each of these recombinant strains to grow in human THP-1

monocyte cells, using the method described by Parish and Stoker in their book

‘Mycobacterium tuberculosis Protocols’, under ‘Macrophage Virulence Assays’.

These studies will confirm the identity of the lipid-II-flippase in Mycobacteria, while

establishing a novel drug target for treatment of tuberculosis.

Appendix

Materials and Methods

Primer Designing- To design primers to amplify the mviN gene (complement copy),

sequences upstream and downstream of mviN (knockout construct), and the mviN domain of

the gene (for the anti-sense construct)

1. PCR primers are generally 15-30 nucleotides long

2. Optimal GC content of the primer is 50-55%, distributed uniformly along the primer

3. Prefer one or two G or C at the 3’-end of the primer, but avoid placing more than

three G or C nucleotides at the 3’-end to lower the risk of nonspecific priming

4. Differences in melting temperatures (Tm) of the two primers should not exceed 5°C

for conventional PCR

5. Avoid continuous GC stretches of more than 4 nucleotides

6. Insert the desired restriction sequences at the ends of the primer, to facilitate

ligation of the amplified gene into a vector

7. Add 4-6 extra nucleotides before each restriction site for proper scanning of the

sequence by the restriction enzyme

PCR Optimization and Scale up- To optimize PCR conditions for the specific primer pairs to

obtain minimal non-specific bands and desired intensity of the required amplicon.

1. Set up the following reaction mixtures and thermocycling conditions:

Tables 10, 11: Composition of a PCR reaction & Thermocycling conditions

2. Optimize PCR conditions by varying the reagent concentrations

3. Reduce primer-dimers

4. Calculate the annealing temperature based on the Tm of the primer pair

5. Use gradient PCR to optimize the annealing temperature

6. Using the optimum conditions, scale-up the reaction mixture to a volume of 100 µl

and purify the resulting amplicons

Restriction Digestion- To digest the genes of interest and the vectors by compatible

restriction enzymes, to facilitate ligation (sticky/blunt) and subsequent cloning of the genes

into the vectors

1. Select restriction enzymes to digest your plasmid (Use Restriction Mapper 3 to list

out possible digestion sites in the DNA sequence)

2. For a double digest, determine the best buffer that works for both enzymes, or carry

out a sequential digestion

3. In a 1.5 ml tube combine the following:

4. Mix gently by pipetting

5. Incubate tube at 37°C for 2 hours

6. PCR/gel purify the digested fragments/Drop dialyze reaction mixture

Dephosphorylation- To prevent self-ligation of the vector, the 5' phosphate is removed prior

to ligation. Dephosphorylation of the 5’ end prohibits self-ligation, and reduces the

background activity of the cloning process.

1. Add 1/10 volume of 10X Antarctic Phosphatase Reaction Buffer to 1-5 µg of DNA cut

with any restriction endonuclease in any buffer

2. Add 1 µl of Antarctic Phosphatase (5 units) and mix

Table 12: Composition of a restriction digestion reaction

3. Incubate for 15 minutes at 37°C

4. Heat inactivate for 5 minutes at 70°C

5. Drop dialyze the reaction mixture

6. Proceed with ligation

Drop Dialysis- To desalt the reaction mixture by using a Millipore membrane (0.025 µm), to

remove any components that might interfere with further processing steps

1. Fill the bottom of the Petri dish with Milli-Q water

2. Using stainless steel forceps, float the membrane filter disc (glossy side up) on the

surface of the water

3. Deposit the sample (5-100 µl) on the center of the membrane with a micropipette

(Most samples are dialyzed in less than 30 minutes)

4. Recover the desalted sample with a micropipette

5. Wash the membrane with Milli-Q water for maximum recovery

Ligation- To covalently link the ends of the target gene to those of the specific vector i.e. To

clone the gene into a vector

1. Set up the following reaction in a microcentrifuge tube on ice

2. Thaw and resuspend the T4 Ligase buffer at room temperature

3. Gently mix the reaction by pipetting up and down and microfuge briefly

4. Incubate at 16°C overnight

5. Chill on ice and transform mixture into competent cells

Table 13: Composition of a ligation reaction

Plate Preparation- To grow and screen recombinant colonies/ To perform a cell count

1. Melt 250 ml of autoclaved agar

2. Bring to 55°C and add 250 µL of an appropriate antibiotic stock

3. Pour the agar to just cover the bottom of the Petri plate while minimizing the

introduction of bubbles

4. Label the top plate and allow to cool

5. Let the plates harden for 15 minutes before moving them

6. Store the plates upside down

Transformation & Plating- To introduce foreign DNA into bacterial cells (DH5a E. coli) for

cloning and screening of recombinant vectors

1. Take competent cells out of -70°C and thaw on ice

2. Mix 20/50 μl of DNA (ligation mix) 50μL of competent cells in a microcentrifuge tube

3. GENTLY mix by flicking the bottom of the tube with your finger a few times

4. Place the competent cell/DNA mixture on ice for 15 min

5. Heat shock each transformation tube by placing the tube into a 42°C water bath for

90 seconds

6. Put the tubes back on ice for 2-3 min

7. Add 1 ml LB media (without antibiotic) and grow in 37°C shaking incubator for 45

min (outgrowth)

8. Plate 200 μl of the transformation mix onto each LB agar plate containing the

appropriate antibiotic

9. Incubate plates at 37°C overnight

Colony PCR- To quickly screen for plasmid inserts directly from bacterial colonies

1. Make a note of the colony count on the sample & control plates, and number the

colonies

2. Pool 2-3 colonies together into 30 μl of Milli-Q water using a micropipette tip, and

lyse cells by boiling the mixture at 98°C for 10 min for E.coli/ 30 min for M.sm

3. Set up the following PCR reaction, using Taq polymerase

4. Primers designed to specifically target the insert DNA can be used to determine if

the construct contains the DNA fragment of interest. Alternatively, primers targeting

vector DNA flanking the insert can be used to determine whether or not the insert is

the correct molecular size.

5. Run reaction on appropriate percentage agarose gel

6. Repeat process for positive pools, to screen for individual colonies

7. Screen positive colonies by restriction digestion of the prepped plasmids

Plasmid Mini-Prep- To isolate plasmid DNA from recombinant E.coli cultures for immediate

use in downstream applications such as screening, restriction digestion, ligation, sequencing

& PCR (Using a SIGMA kit)

1. Pellet 5-10 ml of an overnight recombinant E.coli culture

2. by centrifugation, discard the supernatant

3. Completely resuspend the bacterial pellet with 250 µl of the Resuspension Solution

by vortexing or pipetting up and down until homogeneous

4. Lyse the resuspended cells by adding 300 µl of the Lysis Solution; Immediately mix

the contents by gentle inversion (6–8 times) until the mixture becomes clear and

viscous (Do not vortex)

5. Precipitate the cell debris by adding 300 µl of the Neutralization/Binding Solution;

Gently invert the tube 4–6 times

6. Pellet the cell debris by centrifuging at 13,000 rpm for 12-15 min.

7. Insert a GenElute Miniprep Binding Column into a provided microcentrifuge tube,

and prepare the column by adding 500 µl of the Column Preparation Solution and

centrifuging at 13,000 rpm for 1 min; Discard the flow-through liquid

8. Transfer the cleared lysate from step 3 to the column prepared in step 4 and

centrifuge at 13,000 rpm for 1 min; Discard the flow-through liquid

9. Add 500 µl of the Wash Solution 1 to the column; Centrifuge & discard the flow-

through liquid

10. Add 750 µl of the diluted Wash Solution 2 to the column; Centrifuge & discard the

flow-through liquid

11. Centrifuge again at maximum speed for 1 to 2 minutes to remove excess ethanol

12. Transfer the column to a fresh collection tube & add 30-50 µl of Elution Solution

13. Centrifuge at 13,000 rpm for 1 min

14. Quantify & store the DNA at –20 °C

Digestion Screening- To confirm presence of the correct recombinant plasmid in the positive

colonies obtained from colony PCR

1. Identify a restriction enzyme that gives different (and explainable) digestion profiles

for non-recombinant and recombinant vectors

2. Make a digestion master mix with the specific enzyme (minus the DNA)

3. Divide the mix into different tubes containing 500 ng of DNA and incubate

4. Compare and analyze digestion profiles after an agarose gel run

5. Identify positive recombinants

Electroporation- To transform Mycobacteria with purified recombinant DNA, at a high

efficiency, using an electric pulse

1. Inoculate a 2 ml culture of Msm MC2155 in 7H9 broth (containing ADC) and grow

overnight

2. Subculture into 100 ml of the same media to a final OD of 0.6-0.8

3. Cool the culture on ice and transfer the cells to 50 ml conical tubes

4. Centrifuge the cells at 7000 rpm for 5 min and discard the supernatant

5. Wash the cells in 50 ml 10% glycerol and centrifuge as above

6. Wash the cells in 10 ml 10% glycerol and centrifuge as above

7. Wash the cells in 10 ml 10% glycerol and centrifuge as above

8. Suspend the cells in 1 ml 10% glycerol

9. Drop dialyze 1 μg of DNA to be transformed into the cells, along with 50 ng of a

control plasmid

10. Transfer 200 μl cells and DNA to each pre-chilled GenePulser electroporation cuvette

and tap to mix

11. Fill in 2.5 kV (to use high voltage), 25 µF (capacitance), 1000 Ω (resistance), 1 mm

(electrode gap size) in the GenePulser electroporator

12. Cap the cuvette and wipe all moisture from the outside of the cuvette (Any

remaining moisture could cause the machine to arc)

13. Place the cuvette into the safety chamber of the electroporator; Orient the cuvette

so that the metal plates are aligned with the electrodes

14. Press and hold the “Pulse” button until the machine beeps and the screen changes

to show your time constant.

15. Immediately transfer the cuvette to ice and gently resuspend the cells in 1 ml of

sterile 7H9

16. Place the tubes in the 37°C shaking incubator for 3-4 hours

17. Plate 200 μl of resuspension on each antibiotic containing 7H9 plate (prepared

previously)

18. Incubate at 37°C for 3-4 days

DAP Estimation- To detect and estimate DAP levels in wild type cells, mutant strains, as well

as cells exposed to a potential mviN inhibitory compound

1. Grow a 100 ml M.sm culture to 0.2 OD

2. Pellet down the culture at 8500 rpm for 10 min at 4°C, and discard the supernatant

3. Resuspend the cells in 2 ml cold 5% TCA, and all 20 µl propranolol as a process

control

4. Incubate the resuspension on ice for 30 min for protein precipitation

5. Pellet down the cell debris, and separate the supernatant into a fresh tube

6. Add 2 ml of diethyl ether for lipid extraction, and centrifuge at 8500 rpm for 5 min

7. Collect the aqueous phase (bottom), and repeat ether extraction two more times

8. Lyophilize the aqueous phase

9. Send for LC-MS/MS analysis for DAP estimation

[LC-Conditions (Shimadzu, prominence UPLC XR): Column- Phenomenex, Luna HILIC, 100 X

2.1 mm, 5 µ; Mobile Phase- A : 0.1% Acetic acid in 5 mM Ammonium Acetate, B :

Acetonitrile; Elution- Isocratic (80% A and 20% B); Flow Rate- 0.60 ml/min; Column oven

temp.- Ambient; Injection vol.- 10 µL; Autosampler temp.- 10 °C

MS Conditions (Applied Biosystems, API3000): Detection mode- MRM; Ion polarity-

Positive]

MIC analysis- Applied to microorganisms to get an estimate of the concentration of the

compound under consideration that inhibits 80% (MIC80) of growth and can indicate the

susceptibility of microbial populations to the compound

1. Grow a pure culture of M.sm in 7H9 broth to obtain a cell density of 105 or 106

cells/ml

2. Keep the first column of a 96-well plate for the media control (without culture), and

the last well for the culture control (without compound)

3. Dilute the test compound and the control compound a number of times in the 96-

well plate, in a 1:1 ratio, to get a final volume of 4 µl in each well (This is done such

that the estimated MIC falls in the central column well)

4. Add 200 µl of the inoculum to each well and mix thoroughly

5. Incubate the plate at 37°C for 48-72 hrs

6. Read the OD at 600 nm, and make the blank correction

7. Calculate the % inhibition, and select the concentration showing an inhibition of

>80% as the minimum inhibitory concentration of the compound

8. Repeat with a narrower concentration range if necessary

Fluorescent staining- To visualize the D-Ala incorporated into the nascent PG layer of

recombinant strain, and compare it with the wild type cells

1. Grow a 5 ml starter culture of the recombinant/wild-type cells in the presence of 20

mM D-Ser

2. Inoculate a secondary culture with 20 mM D-Ser and let it grow till mid-log phase

(OD 0.5)

3. Divide into 1 ml duplicates and pellet down

4. Resuspend in 1 ml fresh media, without D-Ser, and incubate for one generation

period (3-4 hrs) at 30°C

5. Pellet down and resuspend in 1 ml fresh media

6. Add 1 µg/ml Van-FL dye, and incubate in the dark at 30°C for 90 min

7. Wash the cells with PCR and mount the concentrated cell suspension on a sterile

glass slide, using VECTASHIELD

8. Subject to fluorescence microscopy at λab- 485 nm, λem-530 nm

Bibliography

1. Athanasios Typas, Manuel Banzhaf, Carol A. Gross and Waldemar Vollmer: From the

Regulation of Peptidoglycan Synthesis to Bacterial Growth and Morphology.

Nature Reviews- Microbiology 2012, 10:123-136

2. Christine L. Gee, Kadamba G. Papavinasasundaram, Sloane R. Blair, Christina E. Baer,

Arnold M. Falick, David S. King, Jennifer E. Griffin, Harene Venghatakrishnan, Andrew

Zukauskas, Jun-Rong Wei, Rakesh K. Dhiman, Dean C. Crick, Eric J. Rubin, Christopher

M. Sassetti and Tom Alber: A Phosphorylated Pseudokinase Complex Controls Cell

Wall Synthesis in Mycobacteria. Sci Signal 2013, 5(208)

3. Thomas R. Ioerger, Theresa O’Malley, Reiling Liao, Kristine M. Guinn, Mark J. Hickey,

Nilofar Mohaideen, Kenan C. Murphy, Helena I. M. Boshoff, Valerie Mizrahi, Eric J.

Rubin, Christopher M. Sassetti, Clifton E. Barry III, David R. Sherman, Tanya Parish

and James C. Sacchettini: Identification of New Drug Targets and Resistance

Mechanisms in Mycobacterium tuberculosis. Plos One 2013, 8(9)

4. Paul Carroll, Marie-Claire Faray-Kele and Tanya Parish: Identifying Vulnerable

Pathways in Mycobacterium tuberculosis by Using a Knockdown Approach. Applied

and Environmental Microbiology 2011, 77:5040-5043

5. Mudassar Altaf, Christopher H. Miller, David S. Bellows and Ronan O’Toole:

Evaluation of the Mycobacterium smegmatis and BCG models for the discovery of

Mycobacterium tuberculosis inhibitors. Tuberculosis 2010, 90:333-337

6. Natividad Ruiz: Bioinformatics Identification of MurJ (MviN) as the peptidoglycan

Lipid-II-Flippase in Escherichia coli. PNAS 2008, 105:15553–15557

7. Tamimount Mohammadi, Vincent van Dam, Robert Sijbrandi, Thierry Vernet, Andre´

Zapun, Ahmed Bouhss, Marlies Diepeveen-de Bruin, Martine Nguyen-Disteche, Ben

de Kruijff and Eefjan Breukink: Identification of FtsW as a Transporter of Lipid

Linked Cell Wall Precursors Across the Membrane. The EMBO Journal 2011,

30:1425–1432

8. Christopher M. Sassetti and Eric J. Rubin: Genetic Requirements for Mycobacterial

Survival During Infection. PNAS 2003, 100:12989–12994

9. Jennifer E. Griffin, Jeffrey D. Gawronski, Michael A. DeJesus, Thomas R. Ioerger, Brian

J. Akerley and Christopher M. Sassetti: High-Resolution Phenotypic Profiling Defines

Genes Essential for Mycobacterial Growth and Cholesterol Catabolism. Plos

Pathogens 2011, 7(9)

10. Joann Huber, Robert G.K. Donald, Sang Ho Lee, Lisa Wang Jarantow, Michael J.

Salvatore, Xin Meng, Ronald Painter, Russell H. Onishi, James Occi, Karen Dorso,

Katherine Young, Young Whan Park, Stephen Skwish, Michael J. Szymonifka, Tim S.

Waddell, Lynn Miesel, John W. Phillips and Terry Roemer: Chemical Genetic

Identification of Peptidoglycan Inhibitors Potentiating Carbapenem Activity Against

Methicillin-Resistant Staphylococcus aureus. Cell Press 2009, 16:837-848

11. Mariana G. Pinho and Jeff Errington: Dispersed Mode of Staphylococcus aureus Cell

Wall Synthesis in the Absence of the Division Machinery. Molecular Microbiology

2003, 50(3):871-881

12. Fredric Carlsson, Shilpa A. Joshi, Linda Rangell and Eric J. Brown: Polar Localization of

Virulence-Related Esx-1 Secretion in Mycobacteria. Plos Pathogens 2009, 5(1)

13. Kunihiko Yabu and Herman R. Huempfner: Inhibition of Growth of Mycobacterium

smegmatis and of Cell Wall Synthesis by D-Serine. Antimicrobial Agents and

Chemotherapy 1974, 6:1-10