Contents lists available at ScienceDirect

Fish and Shellfish Immunology

journal homepage: www.elsevier.com/locate/fsi

Full length article

Trans-cinnamic acid application for rainbow trout (Oncorhynchus mykiss): I.Effects on haematological, serum biochemical, non-specific immune andhead kidney gene expression responses

Sevdan Yılmaz∗, Sebahattin ErgünDepartment of Aquaculture, Faculty of Marine Sciences and Technology, Canakkale Onsekiz Mart University, Canakkale 17100, Turkey

A R T I C L E I N F O

Keywords:Rainbow troutTrans-cinnamic acidInnate immunityCytokine responseYersinia ruckeri

A B S T R A C T

The present study investigated the effects of dietary trans-cinnamic acid (CA) on pre- and post-challenge hae-matological, serum biochemical, non-specific immune and head kidney gene expression responses of rainbowtrout, Oncorhynchus mykiss juveniles. In this regard, fish with an average weight of 17.01 ± 0.05 g were dividedinto five groups, and fed daily with an additive free basal diet (control); 250, 500, 750 or 1500mg kg−1 CA for a60-day period. Fish were sampled every 20 days during the experiment. On days 20, 40 and 60 (the pre-chal-lenge period), the dietary CA especially at 250 and/or 500mg kg−1 significantly increased blood granulocytepercentage, and serum total protein, globulin, lysozyme and total immunoglobulin values. Furthermore, dietaryCA increased activities of phagocytic activity, respiratory burst and potential killing, and increased the ex-pression levels of immune related genes [serum amyloid A (SAA), interleukin 8 (IL-8), interleukin 1, beta (IL-1β),transforming growth factor beta (TGF-β), tumor necrosis factor (TNF-α), and immunoglobulin T (IgT)] in thehead kidney of fish fed with 250 and/or 500mg kg−1 CA. Following 60 days of feeding, fish were challengedwith Yersinia ruckeri and mortality was recorded for 20 days. Highest percentage survival (%) rate was found inthe 250 and/or 500mg kg−1 CA-supplemented feeding groups. During the post-challenge period, red blood cell(RBC) count, hematocrit (%), respiratory burst activity, and total antiprotease activity increased in fish fed withfeed containing 500mg kg−1 content. Moreover, markedly up-regulated the expression of related genes (SAA, IL-8, IL-1β, TGF-β, TNF-α, IFN-γ and IgM) in fish fed 250, 500 and/or 750mg kg−1 CA. Therefore, feeding O. mykissfor 60 days with dietary CA at 250–500mg kg−1 CA incorporation levels can be suggested as optimal to enhancethe immunity and disease resistance against Y. ruckeri.

1. Introduction

The rainbow trout Oncorhynchus mykiss is one of the most eco-nomically important fishes cultured in Europe, North America, Chile,Japan, Australia [1] as well as in Turkey [2]. One of the importantdiseases in O. mykiss is Enteric Redmouth (ERM) caused by Yersiniaruckeri [3,4] and can be controlled by vaccination [5,6] and anti-microbial drugs mainly sulphamethazine, chloramphenicol or oxyte-tracycline [7]. However, vaccination can lead to an increase in laborrequirements and it may cause handling stress. On the other hand, it hasbeen reported that Y. ruckeri strains acquired resistance to various an-timicrobial agents [8,9].

The unconscious use of antibiotics and chemotherapeutics inaquaculture facilities presents residual problems in the surroundingenvironment. Accordingly, farmed terrestrial animals and humanbeings are adversely affected. Furthermore, the excessive use of

antibiotics rises antibiotic resistance of fish pathogens in aquaculturefacilities. For these reasons, studies have been accelerated in order tosearch environment-friendly alternative feed additives to reduce the useof antibiotics or environmentally harmful synthetic chemicals in fishfarming. Accordingly, a great number of studies have supported thatorganic acids could provide alternative contributions in aquaculturesuch as promoting growth and resistance to diseases and boosting im-mune responses [10–18].

Polyphenols, secondary plant metabolites are reported to have an-tioxidative, anti-inflammatory and immunomodulatory effects in ro-dent and human studies [19–22]. Considering that farm animals mightbe exposed to high levels of oxidative stress and inflammation underunfavorable culture environments, polyphenols are believed to be fa-vorable additives in feeding farm animals [23]. Nevertheless, potentialantioxidative, anti-inflammatory and immunomodulatory effects ofpolyphenols have not been widely studied in farm animals unlike many

https://doi.org/10.1016/j.fsi.2018.04.034Received 15 January 2018; Received in revised form 6 April 2018; Accepted 18 April 2018

∗ Corresponding author.E-mail address: sevdanyilmaz@comu.edu.tr (S. Yılmaz).

Fish and Shellfish Immunology 78 (2018) 140–157

Available online 21 April 20181050-4648/ © 2018 Elsevier Ltd. All rights reserved.

T

http://www.sciencedirect.com/science/journal/10504648https://www.elsevier.com/locate/fsihttps://doi.org/10.1016/j.fsi.2018.04.034https://doi.org/10.1016/j.fsi.2018.04.034mailto:sevdanyilmaz@comu.edu.trhttps://doi.org/10.1016/j.fsi.2018.04.034http://crossmark.crossref.org/dialog/?doi=10.1016/j.fsi.2018.04.034&domain=pdf

studies carried out with model animals and humans.Trans-cinnamic acid (CA) is a natural polyphenolic organic acid

derived from plants, and known to have anti-fungal [24], anti-microbial[25], anti-oxidant [26], anti-tumor [27] and anti-inflammatory effects[28]. Further, CA is reported as an effective food additive for functionalhuman food by U.S. Food and Drug Administration [29]. Despite thewidely-presented information regarding the benefits and outstandingprofitability of CA, questions about the immunostimulary effects of CAin finfish diet still remain to be answered. It was reported that CApresented antimicrobial effects under in vitro conditions against bac-teria such as Aeromonas hydrophila, A. salmonicida and Edwardsiellatarda [30] and A. sobria, A. salmonicida ATCC 33658, L. anguillarum andY. ruckeri [31]. These properties show that it can be considered as aproper feed additive. However, information regarding the mechanismon how the dietary incorporated CA affects fish, has not been reportedearlier.

Haematological, serum biochemical and innate immune parametersare important indicators of health status used in determining the effectof feed additives in fish [32–36]. The changes in immune-related geneexpressions have also become an important research topic in recentyears. CA is known to increase serum interleukin 1, beta (IL-1β) levelsin mice [37]. The serum amyloid A (SAA), interleukin 8, interleukin 1,beta (IL-1β), interferon gamma (IFN-γ), tumor necrosis factor (TNF-α),transforming growth factor beta (TGF-β), immunoglobulin M (IgM) andimmunoglobulin T (IgT) investigated in head-kidney tissue in the pre-sent study are important molecules involved in inflammation and reg-ulation of innate and acquired immune response, respectively in teleostfish [38–40]. Because of the availability of resident macrophage po-pulations, it is believed that head-kidney is a significant organ in orderto capture and clear bacteria. Additionally, it is also an important organdue to the key regulatory functions and has the pivotal role in terms ofimmune-endocrine interactions and even neuro-immuno-endocrineconnections [41,42]. Further, previous studies have reported that po-tential immunostimulants tested in diets have stimulating or regulatingeffects on O. mykiss head-kidney cytokines [38,43–45]. Moreover, itwas reported that the expression of IL-1β, TNF-α and IgM from thegenes, which were also tested in our study, were up-regulated by 3,4,5-trimethoxy cinnamic acid, an analog of CA, on the kidney cells ofCtenopharyngodon idella [46]. These observations indicate the sig-nificance of kidney as an organ for the investigation of CA effects infish.

To our knowledge so far, there are no data available regarding theeffective dietary dose of CA in fish feed. However, consumption of5–30mg kg−1 body weight was sufficient to visualize the bioavail-ability of the product in rats [47,48]. Hence, the earlier findings in ratswere used for the determination of feeding rates in the present study. Adaily feeding rate of around 2–3% body weight was considered tocalculate the daily feed amount for rainbow trout (mean weight 17 g),which was equivalent to 5–7.5, 10–15, 15–22.5 and 30–45mg kg−1

body weight, corresponding to a dietary CA incorporation of 250, 500,750 or 1500mg kg−1 feed, respectively.

To date, there are no reports regarding the usage of CA as a sup-plement in fish feed. This study investigated the changes in haemato-logical parameters, blood pH, non-specific immune responses, serumbiochemical variables, head-kidney related genes expressions in the preand post-challenge period (after the fish were infected with Y. ruckeri)in O. mykiss juveniles fed with trans-cinnamic acid (purity ≥99%) indiffering amounts.

2. Materials and methods

2.1. Experimental diet

Trans-cinnamic acid (lot no. #W228826) was obtained from Sigma(Sigma-Aldrich, St. Louis, MO) with a stated purity of ≥99%, in-corporated in the test diets at rates of 250, 500, 750 and 1500mg kg−1,

and designated as 25cin, 50cin, 75cin, and 150cin, respectively.Additionally, a control group was fed on a diet without cinnamic acidsupplementation. Commercial trout feed (Anatolian Sea 50% protein/4% lipid, 4 mm, Ugurlu Balik, Aydin, Turkey) was used as the basaldiet. After heating (40 °C) for 1.5–2 h the 860 g feed was top-dressedwith 140 g anchovy fish oil (final protein/lipid ratio is about 43%/17%)containing different level of cinnamic acid (0–1500mg kg−1) by slowlymixing in a drum mixer.

Proximate analyses of the diets were performed using standardmethods. Moisture was analyzed by drying at 105 °C for 24 h in an ovento a constant weight, crude protein by the Kjeldahl method, and crudeash by incineration at 525 °C in a muffle furnace for 12 h [49]. Crude fatwas analyzed by methanol / chloroform extraction [50].

2.2. Fish and experimental design

Oncorhynchus mykiss juveniles were obtained from a local trout farm(Keskin Alabalik Co.) in Canakkale, Turkey. Each fish was visually in-spected externally according to United States Environmental ProtectionAgency (EPA) guidelines for qualitatively assessing fish health [51].Fish were fed a commercial diet (“see experimental diet” section) adlibitum for 3 weeks to allow for acclimation prior to initiation of ex-periment. A total of 450 fish were used in the study carried out with 5experimental treatment groups in a triplicate design. Fish weighing17.01 ± 0.05 g (mean ± S.D.) were randomly allotted into 15 ex-perimental fiberglass tanks (30 fish per tank). Each tank with a watervolume of 140 L was provided with re-circulated aerated freshwater at arate of 160 L h−1. All fish were fed ad libitum twice daily (08.00 and17.00 h) for 60 days. Photoperiod was set to a 12L:12D light-dark cyclethroughout the study. Water quality characteristics during the course ofthe experiments were as follows: temperature was 15.8 ± 0.5 °C, pHwas 7.69 ± 0.1, dissolved oxygen was 7.7 ± 0.15mg L−1, con-ductivity was 435 ± 5.2 μS, total ammonia was0.012 ± 0.0011mg L−1, nitrite was 0.025 ± 0.001mg L−1, and ni-trate was 0.8 ± 0.1mg L−1. Temperature was controlled by a heater/chiller (Tuna Mac®, Canakkale, Turkey). Temperature, oxygenation,conductivity and pH were measured daily, and ammonia, nitrite andnitrate were measured weekly.

2.3. Sampling

Blood samples were collected from the experimental fish during thefeeding period at days 20, 40 and 60, and 20 days after infection with Y.ruckeri. Fish were starved for 1 day prior to blood sampling. Three fishfrom each tank (9 fish per group) were used for the sampling. After thefish were randomly caught and quickly removed from the tanks, theywere anesthetized with 20mg L−1 clove oil [52]. Blood was taken fromthe caudal vein through a 2.5 mL plastic syringe as soon as possibleafter the area behind the anus fin was cleaned thoroughly with alcoholto avoid the mixing of the mucous membrane into the blood. For theanalyses of haematological and some immune-related parameters[white blood cell (WBC) count and types, phagocytic index, and pha-gocytic activity, respiratory burst and potential killing activities], a partof the blood samples were transferred into tubes containing K3EDTA(MiniCollect®Tube, Austria), while the remaining part of the bloodsamples were placed into Eppendorf tubes for the measurements ofblood pH values. The rest of the blood was taken into serum tubes (Zserum sep. Tubes MiniCollect® Tube, Austria) and centrifuged at 5000 gfor 10min. Obtained serum samples were stored at −80 °C for furtheranalysis [53]. Fish were euthanized with clove oil overdose(200mg L−1) after blood sampling, and then head kidney tissues wereimmediately collected and placed in RNAlater (Sigma-Aldrich, lot no.#R0901) solution at 4 °C overnight and then stored at −20 °C until thegene expression analysis [54].

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

141

2.4. Haematological parameters

Red blood cell (RBC, 106 mm−3) count, hemoglobin concentration(Hgb, g dL−1) and hematocrit ratio (Hct, %) were conducted with au-tomatic blood count instrument (Mindray BC 3000 plus) previouslyused in O. mykiss [55]. To validate the reliability of the automatic re-sults, a manual haematological analysis was performed according toBlaxhall and Daisley [56] on all blood samples immediately after col-lection in K3EDTA tube.

2.5. Biochemical analysis

Commercial test kits (Bioanalytic Diagnostic Industry, Germany)were used to determine the serum glucose, total protein, albumin andglobulin (subtracting albumin from total protein) levels [32]. Serumbiochemical analysis were carried out on a spectrophotometer (OptizenPOP UV/VIS). The serum cortisol levels were determined using theimmunoenzymatic assay method previously reported in fish [57].Analysis were performed at 450 nm using a microplate reader (ThermoMultiskan Go) using a commercial cortisol kit (Diametra, Italy).

2.6. Blood pH

Blood pH was measured by FC 200 electrode and HANNA (HI 2221)pH meter [58].

2.7. Immune related parameters

2.7.1. White blood cell (WBC) counts and typesFor WBC counts and types, a small amount of blood was spread on

the glass slide and allowed to dry at room temperature. The slides werewashed under running tap water following the May-Grünwald-Giemsastaining procedure. Then, 100% leukocyte cells were counted at1000×magnification using immersion oil and percentage of leukocytecells (lymphocytes, granulocytes and monocytes) were determined. Thenumber of white blood cells (WBC, 104mm−3) was calculated in-directly by the method previously reported in the literature [33]:

Number of leukocytes in the blood smear× erythrocytes quantifiedin the haemocytometer/7000 erythrocytes in the blood smear.

2.7.2. Phagocytic activity and phagocytic indexPhagocytic activity was previously performed according to the mi-

croscopic counting method reported in the literature [59]. Briefly,100 μL of the blood sample and 100 μL of formalin killed Y. ruckeri E42(1.5×108 in PBS) suspension were mixed and left to incubate for30min. Then, a drop of blood was taken on the glass slide and was airdried. The slides were fixed with ethyl alcohol (95%) for 5min andstained with Giemsa solution for 10min.

The slides were observed under the light microscope to count100 cells per slide. The phagocytic activity and phagocytic index werecalculated as follows:

Phagocytic activity (%) = (Number of phagocytic cells with engulfedbacteria/number of phagocytes)× 100

Phagocytic index=Number of engulfed bacteria/phagocytic cells

2.7.3. Respiratory burst activityModified Stasiack and Bauman [60] method was followed for re-

spiratory burst activity of the phagocytes. Fifty microliters of the bloodwas placed into the 96 well plates (Thermo Scientific, Nunc, #167008)which coated 50 μL of PLL (poly-L-lysine) solution (Sigma-Aldrich, lotno. #P4832) and incubated at 25 °C for 1 h to allow adhesion of cells.Then the supernatant was removed and the wells washed three times inHBSS (Sigma-Aldrich, lot no. #H6648). After washing, 100 μL 0.2%NBT (Sigma-Aldrich, lot no. #N5514) in HBSS solution was added and

incubated for a further 1 h. The cells were then fixed with 100% me-thanol for 5min and washed three times with 70% methanol. The plateswere air dried and 60 μL 2M potassium hydroxide (KOH, Sigma-Al-drich, lot no. #P5958) and 70 μL dimethyl sulphoxide (DMSO, Sigma-Aldrich, lot no. #D2650) were added to each well. The absorbance (OD)was recorded in a plate reader (Thermo Multiskan Go) at 620 nm.

2.7.4. Potential killing activityA modification of a technique by Siwicki [61] was used to measure

potential killing activity of blood phagocytic cells. First, 50 μL of theblood sample was added in a microtiter plate well which coated with50 μL of PLL. The plate was incubated for 1 h at 25 °C to allow ad-herence of cells to the plastic surfaces. Then, the supernatant and non-adherent cells were gently removed and the adhered cells were washedthree times with HBSS. After washing, 100 μL of 0.2% NBT in HBSSsolution containing formalin killed 1.5 × l08 cfumL−1 Y. ruckeriE42 cells was added to the wells. Then, plate was centrifuged for5min at 150 g to bring the bacteria into contact with the adherent cells.After incubation for 30min at room temperature, supernatant was re-moved and the cells were fixed with 100% (v/v) methanol for 5min,and then washed three times with 70% (v/v) methanol. The plates wereair-dried before 60 μL of 2M KOH and 70 μL DMSO were added to so-lubilize the formazan. The OD of the resulting solution was read in aplate reader (Thermo Multiskan Go) at 620 nm against a KOH/DMSOblank.

2.7.5. Lysozyme activityLysozyme activity was determined by a microtitre plate method

[62]. Briefly, the serum samples (25 μL) were added to 175 μL of Mi-crococcus luteus (Sigma-Aldrich, lot no. # 4698) aqueous suspension(0.375mg in 500 μL of 0.1M phosphate/citrate buffer with 0.09%NaCl, pH 5.8) in a 96-well plate. The hen egg white lysozyme (Sigma-Aldrich, lot no. #L6876; 0–40 μgmL−1 of 0.1 M phosphate/citratebuffer with 0.09% NaCl, pH 5.8) was used to develop standard curve.The spectrophotometric measurements were carried out with a micro-plate reader (Thermo Multiskan Go) set at 25 °C and followed for30min at 450 nm with a time interval of 60 s. As a result, 15min waschosen as the optimal incubation time. The rate of lysis was determinedagainst M. luteus blank at 450 nm. The rate of reduction in absorbanceof samples was converted to lysozyme concentration (μg mL−1) using astandard curve.

2.7.6. Myeloperoxidase activityTotal myeloperoxidase (MPO) content was measured according to

Sahoo et al. [63] with slight modification. 10 μL serum was diluted with90 μL of HBSS without Ca2+ or Mg2+ in 96 well plate. Then, 35 μL of asubstrate buffer (0.05M phosphate-citrate buffer, pH 5.0) containing0.1 mgmL−1 3,3′,5,5′-tetramethylbenzidine dihydrochloride (Sigma-Aldrich, lot no. #T3405) and 0.006% hydrogen peroxide was added toeach well. The reaction was followed kinetically by measuring the in-crease of absorbance. Reaction velocities were determined as IU, de-fined as the amount of enzyme required to produce a 0.001 increase inabsorbance per minute 0.135mL of reaction mixture (ΔA450min−1 mL−1).

2.7.7. Total antiprotease activityTotal antiproteases activity in serum was determined according to

Magnadottir et al. [64] with partial modification. 10 μL of serum wereincubated with 100 μL trypsin (Sigma-Aldrich, lot no. #T8003, bovinepancreas Type I, 200 μgmL−1of PBS). All tubes were incubated at 22 °Cfor 30min. Then, 1mL of azocasein (Sigma-Aldrich, lot no. # A2765)dissolved in PBS (2.5 mgmL−1) was added to all tubes and incubatedfurther for 15min at 22 °C. The reaction was terminated with the ad-dition of 500mL of 10% tricholoroacetic acid. The sample was cen-trifuged at 10 000× g for 5min to remove protein precipitates. 100 μLof the supernatant was transferred to a 96 well plate containing 100 μL

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

142

of 1 N NaOH per well. The OD was read at 450 nm in a microplatereader (Thermo multiscan Go, Thermo Fisher Scientific, Waltham, MA,USA). The blank was PBS in place of serum and trypsin and the re-ference sample was PBS in place of serum.

2.7.8. ɑ1-antiproteaseThe method was applied according to Newaj‐Fyzul et al. [65] with

some modifications. Briefly, 10 μL of serum was mixed with 100 μL oftrypsin (100 μgmL−1) and 90 μL of 50mM Tris-HCl (pH 8.2), and in-cubated at 22 °C for 1 h. Then, 2mL of 2mM Nabenzoyl-DL-arginine-p-nitroanilide HCl (lot no. #B4875, Aldrich, St. Louis, MO) was addedand incubated for a further 15min. The reaction was stopped by adding500 μL of 30% acetic acid and the OD read at 450 nm in a spectro-photometer (Optizen POP UV/VIS Spectrophotometer, Seoul, Republicof Korea). The serum blank contained 100 μL of Tris instead of trypsin,and the positive control contained trypsin but no serum.

2.7.9. Total immunoglobulinThe total immunoglobulin concentration was measured according to

the method described by Siwicki and Anderson [59]. The total proteinconcentration of the serum was determined by a colorimetric assaybased on the Biuret reaction, using a protein diagnostic reagent kit(Bioanalytic Diagnostic Industry, Co.). After, 100 μL of each serumsample was mixed with equal volume of polyethylene glycol solution(lot no. #P1458, Aldrich, St. Louis, MO) and the mixture was incubatedfor 2 h (under constant mixing) to bring down the immunoglobulinmolecules. After centrifuged at 1000× g for 10min, the protein contentof the supernatant was determined by the assay described above. Thetotal immunoglobulin value was calculated according to the followingformula:

Total immunoglobulin level (mg mL−1)= Total protein in serum/Totalprotein in supernatant

2.7.10. Natural hemolytic complement activitySerum natural hemolytic complement activity was determined by

the method of Lim et al. [66]. This assay is based on the hemolysis ofsheep erythrocytes (GBL, Istanbul/Turkey) by complement present infish serum. Sheep erythrocytes were washed five times with coldPBS + solution (0.85% PBS, 0.1% gelatin, 0.15 mM CaCl2 and 0.5mMMgCl2) followed by centrifugation at 300g at 4 °C for 10min andstandardized to 5×107 cells mL−1 in PBS + prior to use. Starting with40 μL of serum, twofold serial dilutions were made in 96-well microtiterplates by transferring 40 μL of serially diluted serum into each wellplated with 40 μL PBS+. Diluted serum volume in each well wasbrought up to 200 μL by adding 160 μL of buffer. Thereafter, 40 μL ofsheep erythrocyte suspension was added to each well. Positive controls(100% lysis) of distilled water plus sheep erythrocytes and negativecontrols (spontaneous lysis) of buffer and sheep erythrocytes were alsoprocessed in each plate. Samples were incubated at 22 °C for 1 h. Thereaction was stopped by placing plates on ice. The plates were cen-trifuged at 800 g for 10 min at 4 °C and supernatants (200 μL) weretransferred to flat-bottom 96-well microtiter plates and the absorbancewas measured at 415 nm using microplate reader. The 50% lysis point(CH50) was calculated by logarithmic regression of each serum sampleand expressed as the log dilution.

2.8. Bacteria and challenge experiment

The Y. ruckeri E42 (GenBank accession no. KX388238) used in thisstudy was previously isolated from diseased O. mykiss and obtainedfrom Dr. Ertan Emek ONUK (Ondokuz Mayis University, Faculty ofVeterinary Medicine, Samsun - Turkey). Bacterial culture was generatedovernight in TSB (Tryptic Soy Broth) at 22 °C, and then washed twicewith PBS to adjust the density to 3× 108 CFUmL−1. The density of the

pathogen was determined according to the previously calculated LD50value for the O. mykiss.

At the end of the 60-day feeding trial, 100 μL bacterial suspension(3×108 CFUmL−1 in PBS) were intraperitoneally injected into fish (75fish/group) with an insulin syringe. Dead O. mykiss were removed fromthe tank daily and mortality was recorded daily for 20 days. The post-challenge time was determined to be 20 days, considering that total Igand specific antibody-secreting cells reached the highest levels on days18 and 21 after O. mykiss were infected with Y. ruckeri [67]. Y. ruckeriwas re-isolated to confirm the mortality due to the bacterial infection.Conventional microbiological tests [68] and 16S rDNA analysis havebeen used to identify isolates.

2.9. Agglutination antibody titer assay

A modification of the method described by Yildirim et al. [69] wasused. Y. ruckeri E42 was grown in tryptic soy broth for 24 h and killedwith formalin 3 h before the assay. The bacterial cell suspension wascentrifuged at 2100× g for 10min and supernatant was discarded. Theresulting pellets were washed twice with PBS solution and pellets werere-suspended in PBS. Then, two-fold serial serum dilutions were madein 96-well round bottom microtiter plates by adding 50 μL of dilutedserum into the remaining wells plated with 50 μL of PBS. Thereafter,50 μL of bacterial cell suspension (McFarland # 1.5) was added to eachwell. The plates were covered with plastic film and incubated at 16 °Cfor 16–18 h. Titers were recorded as the log2 of the reciprocal of the lastdilution that had caused agglutination. Agglutination antibody titerassay was also performed for 2 fish from each tank (6 fish/group) be-fore fish were infected with pathogen.

2.10. RT-qPCR analyses of gene expression

Total RNA was extracted from the head kidney using GeneMATRIXKit (Cat. no. E3598, Poland) according to the manufacturer's instruc-tions. The quality and purity of the extracted RNA were determined viaspectrophotometry using a Nanodrop 2000c with absorption at 260 and280 nm. After one DNAse treatments (DNA-free, Eurx Poland) for theremoval of possible contaminated genomic DNA, first-strand cDNA wasgenerated in a 15 μL reaction consisting of 2 μg RNA and 4 μL oligo dT18primer (50 pmol). This mix was heated at 70 °C for 8min and chilled onice, and then 4 μL reaction master mix containing 10 μL 5X RT Buffer,0.30 μL RNase inhibitor, 1 μL reverse transcriptase, 4 μL DTT (100mM),1 μL dNTP Mix (20mM) and 18.7 μL RNase-free water were added.After incubation at 37 °C for 60min, the reaction was stopped heatingat 90 °C for 10min. The synthesized cDNA was immediately stored at−20 °C for further analysis.

The expression level of the genes SAA, IL-8, IL-1β, IFN-γ, TNF-α,TGF-β, IgM and IgT (Table 1) was determined with an Applied Biosys-tems 7500 Sequence Detection system (USA). β-actin was used as theinternal control. The real time PCR cocktail consisted of 3 μL cDNAtemplate, 0.5 μL each of the primers (0.4 μM), 5 μL HOT FIREPol®EvaGreen® qPCR Mix Plus (ROX) (Solis BioDyne, Estonia), and 11 μLPCR grade water. RT-PCR was performed in two replicates of eachsample and repeated at least with two independent experiments in 96-well plates using the following thermocycling conditions: an initial 1cycles at 95 °C for 12min, followed by 40 cycles at 95 °C for 15 s, 60 °Cfor 60 s. Data analyses were performed on 7500 System SDS softwareversion 1.3.1 (Applied Biosystems). Gene expression levels were ana-lyzed using 2− ΔΔCt, and β-actin was used as reference to normalize theRNA input [70].

2.12. Statistical analysis

Data were analyzed by analysis of one way analysis of variance(ANOVA). Values were expressed as Means ± Standard Error of Mean(SEM). Tukey's multiple comparison test was used when there was

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

143

homogeneity of variances; otherwise, a Tamhane post hoc test wasapplied. When normality variances were not assumed, Kruskal-Wallistest followed by Dunn's post hoc test was performed. To validate thereliability of haematological results which was determined with theautomatic method, a paired t-test was applied between the values ob-tained by the manual and automated method [71]. Univariate PERM-ANOVA analyses [72] using PAST 2.17 (Hammer and Harper®, Oslo,Norway; https://folk.uio.no/ohammer/past/index_old.html) were per-formed to identify how each parameter was individually influenced bycinnamic acid dose and/or time of exposure in experiment. The survivalof fish in each challenge treatment group was estimated using Kaplan-Meier analysis, whilst the differences amongst the groups were assessedusing the log-rank (Mantel-Cox) test for pairwise comparisons. Theanalysis was performed using SPSS 19.0 (SPSS Statistics) and the sig-nificance level was considered to be 0.05.

3. Results

A univariate PERMANOVA test results are given in Table 2. TheRBC, Hct, phagocytic index and total Ig were significantly affected bydose or time interval. The Hgb, cortisol and ɑ1-antiprotease were onlysignificantly affected by time interval. The interaction between doseand time interval, and time interval significantly affected the albumin.The other parameters were significantly affected by both dose and timeinterval, and significant interaction was found between dose and timeinterval.

3.1. Haematological variables

No statistical differences were observed between haematologicalparameters evaluated with manual and automatic methods. There wasno statistically significant change in the RBC, Hb and Hct values untilthe 60th day of the experiment (Table 3). However, RBC and Hct valuesof 50cin group were found to be statistically higher than the controlgroup at 21 dpi (P < 0.05).

3.2. Blood pH results

The blood pH level (Fig. 1) was lower in the 150cin group than thecontrol and 50cin groups on the 20th day (P < 0.05). However, therewas no significant change in blood pH levels on the 40th and 60th daysof the experiment (P > 0.05). On the 21 dpi, the pH levels were lowerin the 25cin and 50cin groups than the control and 75cin groups(P > 0.05).

3.3. Biochemical variables

The serum glucose levels (Fig. 2A) were similar between all groupsuntil day 60 (P > 0.05). However, on the 20 dpi, it was lower in the75cin and 150cin groups than the other experimental groups(P < 0.05).

It was determined that the serum total protein levels (Fig. 2B) werenot statistically different between the experimental groups on day 20(P > 0.05), while it was higher in the 25cin group compared to the

Table 1Primers used for relative quantitative real-time PCR.

Gene FWD or REV Sequence (5′–3′) Product size (bp) References

SAA Forward GGAGATGATTCAGGGTTCCA 78 Evenhuis and Cleveland [40]Reverse TTACGTCCCCAGTGGTTAGC

IL-8 Forward CTCGCAACTGGACTGACAAA 148 Evenhuis and Cleveland [40]Reverse TGGCTGACATTCTGATGCTC

IL-1β Forward ACCGAGTTCAAGGACAAGGA 181 Awad et al [38].Reverse CATTCATCAGGACCCAGCAC

TGF-β Forward AGATAAATCGGAGAGTTGCTGTG 275 Awad et al [38].Reverse CCTGCTCCACCTTGTGTTGT

IFN-γ Forward CTGTTCAACGGAAACCCTGT 62 Evenhuis and Cleveland [40]Reverse AACACCCTCCGATCACTGTC

TNF-α Forward TCTTACCGCTGACACAGTGC 130 Evenhuis and Cleveland [40]Reverse AGAAGCCTGGCTGTAAACGA

IgM-(heavy chain)

Forward CAAACCGGTGGAAGCTACAT 150 Evenhuis and Cleveland [40]Reverse AGACGGCTGCTGCAGATATT

IgT Forward AACATCACCTGGCACATCAA 80 Evenhuis and Cleveland [40]Reverse TTCAGGTTGCCCTTTGATTC

β-Actin Forward GGACTTTGAGCAGGAGATGG 186 Awad et al [38].Reverse ATGATGGAGTTGTAGGTGGTCT

Table 2The effect of dose and time interval (fixed factors) on individual parameter(univariate PERMAONVA).

Univariate PERMAONVA1

Dose Time interval Dose×Time interval

RBC *** *** NSHgb NS *** NSHct ** *** NSBlood pH *** *** ***Glucose * ** ***Total protein *** *** *Albumin NS *** *Globulin *** *** **Cortisol NS * NSWBC NS NS NSLymphocyte percentage *** *** ***Granulocyte percentage *** *** ***Monocyte percentage NS NS NSPhagocytic activity *** *** ***Phagocytic index *** * NSRespiratory burst activity *** *** ***Potential killing activity *** *** ***Lysozyme * *** ***Myeloperoxidase *** *** ***Total antiprotease activity *** *** ***ɑ1-antiprotease NS *** NSTotal Ig *** *** NSNatural hemolytic complement *** *** ***Serum amyloid A *** *** ***Interleukin 8 *** *** ***Interleukin 1, beta *** *** ***Transforming growth factor beta *** *** ***Interferon gamma *** *** ***Tumor necrosis factor *** *** ***Immunoglobulin M *** *** ***Immunoglobulin T *** *** ***

1 Significance levels are.***P < 0.001, **P < 0.01, *P < 0.05 and NS P > 0.05.

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

144

https://folk.uio.no/ohammer/past/index_old.html

control, 75cin and 150cin groups on the 40th day (P < 0.05). On day60, it was higher in the 25cin and 50cin groups over the control group(P < 0.05).

The serum albumin levels (Fig. 2C) were not statistically differentbetween experimental groups during the feeding experiment(P > 0.05). However, on the 20 dpi, there was a significant differencebetween the groups of 50cin and 75cin (P < 0.05).

The serum globulin levels (Fig. 2D) of the experimental groups werefound to be similar on 20th day (P > 0.05). However, it was higher inthe 25cin group than the control, 75cin and 150cin groups on the 40thday (P < 0.05). On 60 day, it was higher in the 25cin and 50cin groupscompared to the control group (P < 0.05).

The serum cortisol levels were (Fig. 2E) found to be similar amongthe groups during the experiment (P > 0.05).

Table 3Effects of dietary supplementation of trans-cinnamic acid (CA) on haematological parameters of rainbow trout during pre- and post-challenge periods.

Parameters Days Experimental Groups

Control 25cin 50cin 75cin 150cin

RBC(x106mm−3)

Initial A: 2.04 ± 0.06M: 2.03 ± 0.05

2.04 ± 0.062.03 ± 0.05

2.04 ± 0.062.03 ± 0.05

2.04 ± 0.062.03 ± 0.05

2.04 ± 0.062.03 ± 0.05

20 A: 2.23 ± 0.03M: 2.25 ± 0.04

2.30 ± 0.032.30 ± 0.02

2.34 ± 0.022.35 ± 0.03

2.31 ± 0.032.31 ± 0.02

2.28 ± 0.022.28 ± 0.03

40 A: 2.53 ± 0.09M: 2.53 ± 0.07

2.78 ± 0.072.79 ± 0.05

2.80 ± 0.062.80 ± 0.03

2.72 ± 0.042.70 ± 0.06

2.76 ± 0.102.78 ± 0.05

60 A: 2.20 ± 0.04M: 2.20 ± 0.05

2.06 ± 0.072.06 ± 0.06

2.01 ± 0.052.03 ± 0.05

2.07 ± 0.082.07 ± 0.10

2.12 ± 0.072.11 ± 0.05

20 dpi A: 2.35 ± 0.07b

M: 2.36 ± 0.05b2.52 ± 0.06ab

2.51 ± 0.09ab2.64 ± 0.06a

2.64 ± 0.03a2.37 ± 0.07ab

2.38 ± 0.04ab2.40 ± 0.09ab

2.40 ± 0.05ab

Hgb(g dL−1)

Initial A: 7.33 ± 0.64M: 7.35 ± 0.48

7.33 ± 0.647.35 ± 0.48

7.33 ± 0.647.35 ± 0.48

7.33 ± 0.647.35 ± 0.48

7.33 ± 0.647.35 ± 0.48

20 A: 8.65 ± 0.49M: 8.64 ± 0.26

8.53 ± 0.588.50 ± 0.36

10.19 ± 0.5010.06 ± 0.22

8.92 ± 0.218.91 ± 0.10

9.45 ± 0.349.47 ± 0.16

40 A: 9.82 ± 1.03M: 9.79 ± 0.58

10.04 ± 0.2310.08 ± 0.11

9.18 ± 0.379.15 ± 0.24

9.44 ± 0.279.24 ± 0.17

8.99 ± 0.589.01 ± 0.33

60 A: 9.87 ± 0.34M: 9.89 ± 0.10

9.25 ± 0.299.25 ± 0.20

9.18 ± 0.339.18 ± 0.11

9.91 ± 0.449.89 ± 0.21

10.29 ± 0.3610.27 ± 0.31

20 dpi A: 8.13 ± 0.34M: 8.13 ± 0.11

8.31 ± 0.338.29 ± 0.16

8.56 ± 0.608.55 ± 0.41

7.73 ± 0.237.75 ± 0.09

7.50 ± 0.367.49 ± 0.11

Hct (%) Initial A: 25.79 ± 1.11M: 25.78 ± 0.96

25.79 ± 1.1125.78 ± 0.96

25.79 ± 1.1125.78 ± 0.96

25.79 ± 1.1125.78 ± 0.96

25.79 ± 1.1125.78 ± 0.96

20 A: 28.58 ± 0.78M: 28.58 ± 0.42

29.70 ± 0.6629.72 ± 0.10

30.64 ± 0.4030.61 ± 0.51

30.04 ± 0.5030.09 ± 0.16

29.79 ± 0.3829.81 ± 0.21

40 A: 34.80 ± 0.95M: 34.78 ± 0.16

36.63 ± 0.6836.63 ± 0.21

36.09 ± 0.7836.11 ± 0.14

35.52 ± 0.5835.51 ± 0.31

34.84 ± 1.4334.80 ± 0.96

60 A: 37.94 ± 0.55M: 37.91 ± 0.13

35.62 ± 1.1035.62 ± 0.99

34.33 ± 0.8734.31 ± 0.19

35.86 ± 1.2835.88 ± 1.01

36.31 ± 0.9936.30 ± 0.51

20 dpi A: 30.22 ± 0.98b

M: 30.23 ± 0.57b33.23 ± 0.89ab

33.20 ± 0.18ab35.12 ± 0.97a

35.08 ± 0.25a31.22 ± 1.05ab

31.24 ± 0.96ab31.17 ± 1.29ab

31.20 ± 1.12ab

Mean ± SEM, n=9. The mean values denoted with different letters within same experimental days are statistically significant (P< 0.05).A: automatic analysis results, M: manual analysis results.

Fig. 1. Blood pH of rainbow trout, O. mykiss (mean ± SEM, n=9) fed diets supplemented with different concentrations (0, 250, 500, 750 or 1500mg cinnamic acidkg−1) of trans-cinnamic acid. The mean values denoted with different letters within same experimental days are statistically significant (P< 0.05).

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

145

3.4. Immune related variables

The immune related variables of O. mykiss after dietary CA treat-ments are shown in Figs. 3–5. During the experiment, the white bloodcell count (Fig. 3A), monocyte percentage (Fig. 3D) and ɑ1-antiproteaseactivity (Fig. 5D) was found to be similar between the experimentalgroups (P > 0.05).

On the 20th day of experiment, lymphocyte percentage (Fig. 3B)was lower in the 25cin, 50cin, and 150cin groups compared to thecontrol. It was also lower on the 40th and 60th days in the 25cin and50cin groups than the other experimental groups (P < 0.05).

Granulocyte percentage (Fig. 3C) was higher in all CA supplementedgroups compared to the control on the 20th day (P < 0.05). On day 40,it was found to be higher in the 25cin and 50cin groups compared to theother groups (P < 0.05). It was also higher in 50cin group compared tothe other groups on the 60th day (P < 0.05). At 20 dpi, lymphocyteand granulocyte percentages were similar between the experimentalgroups (P > 0.05).

Relative to the value for the control group, phagocytic activity(Fig. 4A), phagocytic index (Fig. 4B) and potential killing activity(Fig. 4D) were higher in the 25cin and 150cin groups on the 20th day(P < 0.05). They were also higher in the 25cin and 50cin groups thanthe control group on the 40th day (P < 0.05). The phagocytic indexand potential killing activity were higher in the 25cin group than thecontrol group on day 60 (P < 0.05). On the 20 dpi, there was only asignificant change in the potential killing activity among the experi-mental groups and it was lower in the 75cin and 150cin groups com-pared to the other treatment groups (P < 0.05).

On the 20th day, the respiratory burst activity (Fig. 4C) was higherin the 150cin group than the control (P < 0.05). It was also higher inthe 25cin, 50cin and 150cin groups, and all CA supplemented groupsthan the control group on the 40th and 60th days, respectively(P < 0.05). However, on the 20 dpi, it was lower in the 75cin groupthan the other experimental groups (P < 0.05).

Lysozyme activity (Fig. 5A) was statistically different betweengroups of 150cin and 75cin at 20th day (P < 0.05), but there was si-milarity between the control group and other experimental groups(P > 0.05). However, on the 60th day, it was higher in all CA sup-plemented groups than the control group (P < 0.05).

On the 20th day, the myeloperoxidase activity (Fig. 5B) was higherin the 50cin group than the control group. It was also higher in the50cin, 75cin and 150cin groups, and 50cin group than the controlgroup on the 40th and 60th days, respectively (P < 0.05). Further-more, it was statistically higher in the 75cin and 150cin groups than the25cin group on the 40th day (P < 0.05). MPO activity was found to besimilar to all groups on the 20 dpi of the experiment (P > 0.05).

It was found that the total antiprotease activity (Fig. 5C) did notchange significantly between 20th and 40th days (P > 0.05), whereasat day 60, it was lower in the 150cin group than the control, 25cin and50cin groups (P < 0.05). On the 20 dpi, it was higher in the 25cin and50cin groups than the control and 150cin groups (P < 0.05).

The total immunoglobulin (Fig. 5E) was higher in all CA supple-mented groups than the control group on the 20th day. It was alsohigher in the 25cin, 50cin and 150cin groups, and 25cin and 50cingroups than the control group on days 40 and 60, respectively(P < 0.05). Moreover, it was higher in the 25cin group than the 75cinand 150 cin groups on the 40th day (P < 0.05). At 20 dpi, it was foundto be similar between the groups.

The hemolytic complement (Fig. 5F) was higher in the 25cin groupthan the control, 50cin and 75cin groups on the 20th day (P < 0.05). Itwas determined that there was no change on day 40 among the ex-perimental groups. However, it was higher in the 50cin, 75cin and150cin groups compared to the control group on the 60th day(P < 0.05). On the 20 dpi, it was higher in the 150cin group than thecontrol and 75cin groups (P < 0.05).

Fig. 2. Serum glucose (A), total protein (B), albumin (C), globulin (D) andcortisol (E) of rainbow trout, O. mykiss (mean ± SEM, n= 9) fed diets sup-plemented with different concentrations (0, 250, 500, 750 or 1500mg cinnamicacid kg−1) of trans-cinnamic acid. The mean values denoted with differentletters within same experimental days are statistically significant (P< 0.05).

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

146

Fig. 3. White blood cell counts (A), lymphocyte percentage (B), granulocyte percentage (C) and monocyte percentage (D) of rainbow trout, O. mykiss (mean ± SEM,n= 9) fed diets supplemented with different concentrations (0, 250, 500, 750 or 1500mg cinnamic acid kg−1) of trans-cinnamic acid. The mean values denoted withdifferent letters within same experimental days are statistically significant (P< 0.05).

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

147

Fig. 4. Phagocytic activity (A), phagocytic index (B), respiratory burst activity (C) and potential killing activity (D) of rainbow trout, O. mykiss (mean ± SEM, n= 9)fed diets supplemented with different concentrations (0, 250, 500, 750 or 1500mg cinnamic acid kg−1) of trans-cinnamic acid. The mean values denoted withdifferent letters within same experimental days are statistically significant (P< 0.05).

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

148

3.5. Expression of investigated immune genes in the head kidney of rainbowtrout

The expression profiles of the eight immune related genes in headkidney of O. mykiss after dietary CA treatments are shown in Fig. 6A–H.The SAA gene expression level (Fig. 6A) was higher in the 50cin, 75cin,150cin groups than the control and 25cin groups, on the 20th day(P < 0.05). On 40 day, it was higher in the 25cin and 150cin groupsthan the control group (P < 0.05). It was also higher in the 50cingroup than the other experimental groups on the 40th day and 60th day(P < 0.05). Moreover, it was higher in the 25cin and 50cin groups thanthe control group, while lower in the 150cin group than the other ex-perimental groups on the 60th day (P < 0.05). At 20 dpi, it was higherin the 50cin group than the control, 75cin and 150cin groups(P < 0.05).

Higher IL-8 gene expression level was found (Fig. 6B) in the 75cinand 150cin groups compared to the other experimental groups on the20th day (P < 0.05). It was also higher in the 25cin, 50cin and 75cingroups than the control and 150cin groups on the 40th day and 60thday (P < 0.05). However, lower level of IL-8 gene expression wasfound in the 150cin group compared to the other treatment groups onday 60 (P < 0.05). On the 20 dpi, it was higher in the 25cin and 50cingroups than the control, 75cin and 150cin groups (P < 0.05).

During the course of the study, the IL-1β (Fig. 6C) and TGF-β

(Fig. 6D) gene expression levels were higher in all CA supplementedgroups (except 150cin group on day 60) compared to the control group(P < 0.05). They were statistically higher in the 150cin group than thecontrol on the 20th day and 40th day (P < 0.05). However, IL-1β andTGF-β gene expression levels in the 150cin group returned to the samelevel on day 60 and 20 dpi as the control group.

The IFN-γ gene expression level (Fig. 6E) was higher in the 50cin,75cin and 150cin groups than the control and 25cin groups on the 20-40th days (P < 0.05). Moreover, it was also higher in the 50cin and75cin groups than the 150cin group on the 40th day and 60th day(P < 0.05). At 20 dpi, it was higher in the 50cin and 75cin groupscompared to the control group (P < 0.05).

During 20-40th days, the TNF-α gene expression level (Fig. 6F) washigher in all CA supplemented groups than the control group(P < 0.05). It was also higher in the 25cin, 50cin and 75cin groupscompared to the control group on the 60th day and 20 dpi (P < 0.05).However, it was lower in the 150cin group than the other experimentalgroups on the 20 dpi (P < 0.05).

The IgM gene expression level (Fig. 6G) was higher in all CA sup-plemented groups compared to the control group on the 20-40th days(P < 0.05). It was also higher in the 50cin and 75cin groups than theother experimental groups on the 60th day (P < 0.05). At 20 dpi, itwas higher in the 25cin, 50cin and 75cin groups compared to thecontrol and 150cin groups (P < 0.05).

Fig. 5. Lysozyme (A), myeloperoxidase (B), total antiprotease activity (C), ɑ1-antiprotease (D), total Ig (E) and natural hemolytic complement (F) in the serum ofrainbow trout, O. mykiss (mean ± SEM, n= 9) fed diets supplemented with different concentrations (0, 250, 500, 750 or 1500mg cinnamic acid kg−1) of trans-cinnamic acid. The mean values denoted with different letters within same experimental days are statistically significant (P< 0.05).

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

149

Higher IgT gene expression level was found (Fig. 6H) in all CAsupplemented groups (except 150cin group on day 40) on the 20-40thdays (P < 0.05). It was also higher in the 25cin and 50cin groups(P < 0.05), but lower in the 75cin and 150cin groups than the otherexperimental groups on the 60th day (P < 0.05). However, the IgTgene expression level was not significantly different among the fiveexperimental groups on the 20 dpi (P > 0.05).

3.6. Disease resistance and antibody titer results

After 60 d of feeding, the fish were challenged with Y. ruckeri.Clinically infected fish displayed erratic swimming, darkened in color,and redness around the mouth. Internally, petechial hemorrhages on

the surfaces of the liver and pyloric ceca, expanded spleen and inflamedintestine were present. Mortality in the disease-exposed fish was ob-served between day 3 and 9 post infection (Fig. 7). The fish startedaccepting experimental diets, 7 days after challenge. The highest sur-vival rates (P < 0.05) and RPS (Table 4) were found in the 25cin and50cin groups compared to other experimental groups. The antibodytiter (Table 4) was higher in the 50cin and 75cin groups than thecontrol group.

4. Discussion

Haematological parameters are important criteria used for the as-sessment of stress conditions, disease and health status of fish [33]. In

Fig. 6. Gene expression profiles in head kidney of serum amyloid A (A), interleukin 8 (B), interleukin 1, beta (C), transforming growth factor beta (D), interferongamma (E), tumor necrosis factor (F), immunoglobulin M (G) and immunoglobulin tau (H) of rainbow trout, O. mykiss (mean ± SEM, n=9) fed diets supplementedwith different concentrations (0, 250, 500, 750 or 1500mg cinnamic acid kg−1) of trans-cinnamic acid. The mean values denoted with different letters within sameexperimental days are statistically significant (P< 0.05).

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

150

the present study, reference values of haematological parameters de-termined for rainbow trout were similar to the values reported in earlierstudies [73–75]; RBC: 0.74–4.45× 106mm−3, Hgb: 6.2–11.5 g dL−1

and Hct: 22.2–45%. Furthermore, no change was detected in the hae-matological parameters of the fish fed with CA incorporated test diets inthe pre-challenge period. Similarly, BioAcid Ultra® was added to fishfeeds at a rate of 0.1% and 0.2% in a different study with O. mykiss andno change in haematological parameters (RBC, Hct and Hgb) were re-ported at the end of 60 days feeding trial [76]. However, in this study,increased levels of RBC and Hct were recorded in the 50cin groupduring the post-challenge period. This may support the fact that fish fedwith a 500mg kg−1 CA supplemented feed were healthier similar to thefish fed with the same probiotic and herbal additives [77–79].

Besides haematological parameters, the blood pH values are alsoreported as specific blood pathology indicator that might be considered,in fish studies, and is noted to show species-specific values [73]. Normalblood pH values for O. mykiss were reported to be in 7.28–7.6 range

[73,80]. In this study, pH was found in the range of 7.04–7.38 in thepre- and post-challenge periods, and low pH values compared to thefindings in earlier reports were found in the experimental groups fedwith especially CA containing diets. It was observed that during theongoing sampling periods, the fish body buffered the decreasing pHvalues, which returned to normal, while the fish fed diets containing750 and 1500mg kg−1 CA were found to have decreased blood pHvalue on the 20th day of the pre-challenge period. However, during thepost-challenge period, the blood pH values showed a decrease espe-cially in fish with a high survival rate, which were fed diets containing250 and 500mg kg−1 of CA. This might be attributed to the organicacids that might inhibit or slow the growth of bacteria by decreasing theambient pH value and/or cytoplasmic pH value after the bacteria passthrough cell membranes [13]. In an earlier study [81], an increase ofthe amount of Yersinia ruckeri in the blood was reported two days afterY. ruckeri infection in O. mykiss. According to the findings in the presentstudy, it is likely that CA addition to the feed might have reduced theamount or pathogenicity of Y. ruckeri in the blood, but further in-vestigations are encouraged to clearly justify this hypothesis.

Cortisol is primarily a stress indicator in fish [82]. No study on theeffects of organic acids on fish cortisol levels has been found in theliterature so far. However, some herbal immunostimulants have beenreported to reduce blood cortisol levels in Labeo victorianus [83] and O.mykiss [84]. In this study, no difference between the serum cortisollevels in the fish fed with the experimental diets were found. Similarresults were obtained in Tilapia (GIFT) fingerlings fed with Aloe vera-containing feed during pre and post-challenge periods [79]. In ourstudy, it can be noted that the addition of CA into the diet did not causestress in fish.

Serum glucose is used as a non-specific stress indicator in fish stu-dies [85]. In this study, CA did not show an effect on serum glucoselevels in the pre-challenge period. Similar results were obtained with O.mykiss [76] and Oreochromis sp [86]. fed with different organic acids.

Fig. 7. Kaplan–Meier survivorship curves (cumulative sur-vival [%] over time [Days 0, 5, 10, 15, 20]) for rainbowtrout after challenge with Yersinia ruckeri; the fish were fedwith trans-cinnamic acid supplemented diets (0, 250, 500,750 or 1500mg cinnamic acid kg−1 feed; control diets,25cin, 50cin, 75cin and 150cin, respectively) prior to bac-terial challenge.

Table 4Mortality rate, survival, relative percentage survival (RPS) and antibody titer ofinfected rainbow trout fed with cinnamic acid (CA) at different ratios.

Mortality Rate(%)

Survival Rate(%)

RPS Antibody Titer (Log2)1

Control 50.67 49.33 – 2.35 ± 0.16b

25cin 25.33 74.67 50.00 2.93 ± 0.05ab

50cin 25.33 74.67 50.00 3.02 ± 0.08a

75cin 50.67 49.33 0 3.10 ± 0.06a

150cin 57.33 42.67 −13.16 2.95 ± 0.07ab

n= 75 for each group.1Nine fish per group (3 fish/tank) randomly selected from surviving fish at day21 dpi. Agglutination antibody titer assay was also performed for 2 fish fromeach tank (6 fish/group) before fish were infected with pathogen. No aggluti-nation titer against Y. ruckeri was detected in non-infected fish.

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

151

However, CA decreased blood glucose level by increasing insulin re-lease in diabetic mice [47]. The hypoglycaemic effect of CA was seen toemerge in the first 3 h of the time period when diabetic mice consumed5 and 10mg per kg body weight. However the postprandial effect of CAon glucose is still not known for fish. In this study, decreased levels ofserum glucose in fish fed with diets containing 750 and1500mg kg−1 CA were observed in the post-challenge period. There-fore, further studies are needed in order to shed better light on thehypoglycaemic effect of CA on fish.

White blood cells are the main components of the innate immuneresponse, which regulate immune function in teleost fish and play amajor role in combating diseases [17]. No exact information has beenobtained regarding how organic acids stimulate blood cells to this day[87]. In this study, white blood cell (WBC) levels in fish did not changesignificantly during the experiment. Similar results were also obtainedin Cirrhinus mrigala juveniles fed with 0.5% organic acid mixture sup-plemented feeds [88]. However, in different studies, WBC counts in-creased in pre-challenge and/or post-challenge periods in line with theincreased organic acid dose (1% and over) [17,88]. On the other hand,the addition of BioAcid Ultra® to O. mykiss feeds at 0.1% and 0.2%increased the WBC counts of fish [76]. These results indicate that theorganic acid type and dose may show different effects on WBC counts.For instance, WBC counts of Oreochromis sp. hybrids fed at a rate of 2%with different kinds of organic acids (butyrate, acetate, propionate andformate) were reduced by the addition of the formate, whereas otherorganic acid additives did not affect the WBC counts [86].

The immune cells which are found in the blood are basophils,neutrophils, eosinophils, monocytes, and lymphocytes [89]. Lympho-cytes are important cells that can affect immune responses in fish byproducing antibodies and also boosting macrophages activity [90]. Onthe other hand, fish are endowed with an innate complex defensesystem. It is anticipated that this system becomes more significantagainst bacteria compared to specific immunity [91]. Granulocytes areinvolved with non-specific cellular defense responses of teleost fish[92], by deactivating pathogen microorganisms in the body. During thepre-challenge period of the present study, a decrease was observed inthe lymphocyte ratio and an increase in the granulocyte ratio was ob-served in fish when fed diets supplemented with CA, especially in the250 and 500mg kg−1 CA incorporated diet group. The decreasing levelsof lymphocytes here might be attributed to the induced transfer oflymphocytes from the blood into lymphoid organs in fish, as has beenreported earlier in mammals [101]. On the other hand, an increasednumber of circulating neutrophils could be expected since some im-munostimulants inhibit neutrophil migration through capillary en-dothelial barrier, via increasing TNF-α and IL-8 gen expressions [102].In the present study, TNF-α and IL-8 gen expressions in the kidney in-creased when fish was given CA supplemented diets, especially at levelsof 250 and 500mg kg−1. It might be possible that dietary CA also couldhave triggering effect on TNF-α and IL-8 gen expressions in the neu-trophils, since similar findings were reported in the renal cells (in vitro)of Ctenopharyngodon idella after exposure to 3,4,5-trimethoxy cinnamicacid, an analog of CA, in terms of increased TNF-α gene expression inthe cells [46]. However, it seems that information on the exact me-chanism of CA is still lacking, thus needs further investigations.

Our results in terms of decreasing lymphocyte and increasinggranulocyte ratio are in full agreement with findings of earlier studiesin Oreochromis sp. hybrids fed diets incorporated with 2% formate [86]and Dicentrarchus labrax fed with 1% herb-supplemented diets such asthyme (Thymus vulgaris), rosemary (Rosmarinus officinalis) and fenu-greek seed (Trigonella foenum graecum) [33,93].

Among the serum proteins, albumin and globulin are the majorproteins, which play a significant role in the immune response [94]. Inthe present study, the dietary CA especially at 250 and/or 500mg kg−1

levels significantly increased serum protein and globulin than thecontrol group without any change in the albumins. Since the globulinwas calculated by subtracting albumin from total protein in the present

study, it can be assumed that the remainders were globulins. Hence, thesimultaneous increase of both blood protein and globulin might be dueto the stable level of albumins. Increases in serum protein and globulinlevels are usually thought to be associated with a stronger innate im-mune response in fish [33]. It is known that nearly all serum proteinsare produced and secreted by hepatocytes [95], and some globulins areproduced in the liver while others produced by the immune system[96]. A close correlation was reported between the levels of proteinsynthesized in liver tissue and serum protein levels [97]. Hence, in thepresent study, the elevated total serum protein levels might be attrib-uted to the increased levels of protein synthesis in liver tissue of fish fedwith CA incorporated diets. This results is in agreement with a previousstudy in fish treated with organic acid [87].

Parallel with our study, innate immune parameters have also beendeveloped in fish and/or shrimp species fed with organic acid-con-taining feeds. For instance, Epinephelus fuscoguttatus fed with a dietcontaining 1.0 or 2.0 g kg−1 sodium alginate (sodium salt of alginicacid) showed an increase in non-specific immune response by in-creasing respiratory burst, phagocytic activity and ACH50 [98]. Redaet al. [17] added 1.0 and/or 2.0 g kg−1 formic and propionic acid/saltmixture to the feeds of O. niloticus and reported that innate immunitydeveloped with increasing serum killing percentage, serum lysozymeactivity and serum nitric oxide. Feeding Litopenaeus vannamei with2.0 g kg−1 of acidic calcium sulphate resulted in increased haemolymphprotein concentration, haemocyte phagocytic capacity, phenoloxidaseactivity and respiratory burst [99].

In a different study, a mixture of organic acids was added to the feedof C. mrigala juveniles at different rates (0.5%, 1% and 1.5%), pre-challenge (60 days after feeding) and post-challenge (15 days afterbeing infected with Aeromonas hydrophilla) lysozyme activities of allorganic acid supplemented groups were increased [88]. However, re-spiratory burst activity increased only with the addition of high-doseorganic acid (1.5%) during the pre-challenge period [88]. In the presentstudy, lysozyme and respiratory burst activities increased in fish feddiets supplemented with CA during the pre-challenge period, while thelysozyme activities of fish demonstrated similarities and respiratoryburst activity increased only in fish when fed diets containing500mg kg−1 CA during the post-challenge period. Additionally, amongall of the immunity-related parameters (excluding respiratory burstactivity and albumin) tested in our study in the post-challenge period,only antiprotease activity was found to be high in fish fed with 250 and500mg kg−1 CA supplemented feeds. These different results might beassociated with differences in experimental conditions, post-challengeperiods, organic acid types, and fish and/or pathogen types. Moreover,this study also revealed that increases or decreases occurred in theimmune parameters tested with CA addition was time-depend. To ourknowledge, immunological memory is not present in the fish innateimmune system. Also, fish innate immune system response duration isshorter in comparison with the specific system [100]. Moreover, severalhumoral and cellular factors constitute the innate defenses in combi-nation and they may show differential specificity in the presence of agiven immunomodulatory substance [101]. As a result of these specificfeatures, each activity reached the maximum value, which disappeareddepending on time and dose. The peaks of different activities presentedin earlier reports might not be completely similar in terms of magnitudeand time [102,103].

According to our knowledge, no previous study is available so far onthe relationship between polyphenolic organic acid supplementationand immune-related genes in aquatic organisms. For this reason, dis-cussion section compared SAA, IL-8, IL-1β, TGF-β, IFN-γ, TNF-α, IgM andIgT gene expression changes obtained in the head-kidney for O. mykisswith the effects of different immunostimulants, organic acids and/orsalts on the same genes obtained by different studies. In this study,immune relevant genes tested in the head-kidney of the rainbow troutbecame significantly up-regulated by the CA addition to the feed. It isreported that SAA, an acute phase protein that we also investigated

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

152

regarding its efficiency, plays a role for detoxification of endotoxin,mediation of inflammatory responses, proliferation of endothelial celland induce leukocyte extravasation [104]. In the present study, in-creases were observed in the levels of SAA expression in the head-kidneys at different sampling periods with the addition of 250, 500and/or 750mg kg−1 CA to fish diets. The most significant increasescompared to the control were detected in the 500mg kg−1 CA supple-mented group at the 20th, 40th, 60th and 20dpi, 4.1, 7.9, 5.6 and 2.1-fold, respectively. Besides, it is fair to say that there is a positive cor-relation between the innate immune parameters (such as phagocyticactivity, respiratory burst activity, etc.) that we tested in our study withSAA expression levels and resistance to the Y. ruckeri. As is known, SAAis believed to have a significant role for Gram-negative bacteria as aninnate immune recognition protein [105]. In parallel with the resultswe obtained, it is shown that SAA binds Gram-negative bacteria,functions as an opsonin and accordingly enhances phagocytosis, re-spiratory burst activity and secretion of inflammatory molecule such asTNF-α [105].

In support of our study, liver SAA levels increased significantly inPerca flavescens fed with 1% Astragalus membranaceus and Glycyrrhizaglabra mixture (1: 1) added feeds for 4 weeks [106]. Moreover, 30-dayfeeding with prebiotic (mannan-oligosaccharides) and probiotics (Sac-charomyces cerevisiae) addition in O. mykiss feeds significantly increasedliver SAA expression levels in the presence of chronic stress (High stockdensity) or in its absence (only for probiotic group) and when the fishwere infected with Vibrio anguillarum [39].

Unlike our study, Skov et al. [45] added 1% β-1,3-glucan to O.mykiss feeds, and fish were fed with test feeds for 13 days prior to beingvaccinated with Y. ruckeri and 55 days prior to being infected with Y.ruckeri and no change was observed in the head-kidney SAA expressionlevels and plasma lysozyme activity. In addition, researchers reportedthat in the post-challenge period (3, 14 and 28 dpi), β−1,3-glucan didnot have a significant impact on the SAA expression levels of the un-vaccinated fish head kidneys [45]. The liver SAA expression levels of O.mykiss fish fed with 0.2%, 2% and 5% β-1,3-glucan-supplemented feedsfor 13 days were found to be similar to that of the control, only 14 daysafter the fish were infected with Ichthyophthirius multifiliis (28th day ofthe test) SAA levels increased in the high-dose glucan-supplementedgroup [107]. Again O. mykiss was fed with feeds supplemented withmannan-oligosaccharides (MOS), probiotic bacteria, plant extracts, β-glucan and nucleotides mixtures for 30 and 60 days before being in-fected with I. multifiliis, and the fin SAA expression levels showed si-milarities in both the pre- and post-challenge periods [108]. Not allinternal organ SAA expression levels showed changes in O. mykiss frybathed with β-1,3-glucan [109]. It can be said that differences betweenstudies may be devoted to the duration use and dose of im-munostimulants.

Cytokines have a pivotal role in the immune system binding tospecific receptors at the cell membrane, setting off a cascade that leadsto induction, enhancement or inhibition of a number of cytokine-regulated genes in the nucleus [110]. IL-1β, IFN-γ and TNF-α, proin-flammatory cytokines motivate immune cells, enhancing phagocytosis,respiratory burst activity and nitric oxide production [17,111]. The IL-8chemokine takes part in the early inflammatory reaction with itcreating chemoattractive effect on neutrophils in O. mykiss [112]. Inthis study, head-kidney pro-inflammatory cytokines (IL-1β, IFN-γ andTNF-α) and chemokine (IL-8) were mostly up-regulated depending onthe CA dosage (except for 1500mg kg−1 CA addition) and time.

The most significant increases at the end of the pre-challenge period(60th day) were obtained as 28.8-fold for IL-1β, 6.2-fold for IL-8, and4.7-fold for TNF-α for fish fed with 250mg kg−1. In fish fed with 500and 750mg kg−1 CA containing feed, significant increases were ob-tained as 82.8 and 81.3-fold for IL-1β, 34.5 and 45-fold for IFN-γ, 4.7and 9.4 fold for TNF-α, and 6.7 and 10.6-fold for IL-8. Ivanovska et al.[37] indicated that the level of serum IL−1β of mice increased, whichmeans that CA could activate macrophages and the initial events of the

immune response are effected [113]. 3,4,5-trimethoxy cinnamic acid,an analog of CA, has also been reported to up-regulate IL-1β and TNF-αexpressions in Ctenopharyngodon idella renal cells in vitro [46]. CA up-regulates the immunological gene expressions at cellular dimension andthus it supports the results obtained in our study.

Similar to this study, the addition of organic acids and/or salts tofish feeds increased immune-related gene expression levels in differentorgans. For instance, Reda et al. [17] reported that the up-regulation ofIL-1β and TNF-α expression in liver and kidney by the mixture of formicacid, propionic acid and calcium propionate O. niloticus occurred after60 days of feeding. The addition of 10 or 20 g kg−1 propionic acid so-dium salt to Danio rerio feeds remarkably regulated the intestine TNF-αand IL-1β genes at the end of 60 days feeding [114]. Furthermore,foregut IL-1β (11.3-fold) and TNF-α (9.04-fold) gene expressions weresignificantly up-regulated in MSB3·0 type of Cyprinus carpio fed for 8weeks with two different types of butyric acid sodium salt micro-encapsulated at 300mg kg−1 compared to MSB1·5 type, however dif-ferent changes were observed in gene expressions in comparison withdifferent regions of the gut (fore, mid or distal gut) [115]. On the otherhand, addition of 0.2% sodium butyrate to D. labrax feeds did not leadto any changes in liver and intestinal IL-1β, TNF-α and IL-8 gene ex-pressions after 8 weeks feeding [116]. Tian et al. [117] added500–2000mg kg−1 sodium butyrate to the feeds of C. idella and re-ported that microencapsulated butyrate was more effective (3.5-fold)on the intestinal immune function than the powdery sodium butyrate.

The most remarkable increases in the post-challenge period of ourstudy were obtained as 3.40-fold for IL-1β and IL-8, 2.6-fold for IFN-γand 4.8-fold for TNF-α for fish fed the 250mg kg−1 CA supplementeddiet. They were also determined as 3.2 and 3.5-fold for IL-1β, 5.9 and3.9-fold for IFN-γ and 4.4 and 4.5 fold for TNF-α, respectively in fish fedwith 500 and 750 kg−1 CA. Besides, IL-8 gene expression increased 4.5-fold in fish fed with 500mg kg−1 CA. In the post-challenge period,compared to the control, head-kidney TNF-α gene expression was de-creased only in fish fed with 1500mg kg−1 CA containing feed.Likewise, the addition of 1000, 1500 and 2000mg kg−1 sodium buty-rate to feeds of C. idella reduced TNF-α gene expressions in the proximalintestine during the post-challenge period (14 days after infection withA. hydrophila) compared to the control [117]. However, in the samestudy, fluctuations were observed in the TNF-α, IL-1β, IFN-γ and IL-8gene expression levels in different regions of the intestine (proximal,middle or distal) of the fish fed with 1000mg kg−1 or higher levels ofsodium butyrate. Contrary to the findings in our study, these genesnever showed an increase compared to the control.

TGF-β plays a vital role in the immune system by promoting toler-ance by means of regulation of lymphocyte proliferation, differentia-tion, and survival [118]. Moreover, initiation and resolution of in-flammatory responses are controlled by TGF-β by means of regulation ofchemotaxis, activation, and survival of lymphocytes, dendritic cells,natural killer cells, mast cells, macrophages, and granulocytes [119]. Inthe present study, head-kidney TGF-β gene expressions were sig-nificantly up-regulated (3.53-fold and over) in the CA supplementedgroups (except 60th day and 20 dpi in the 150cin group). At the end ofthe 60-day feeding period, the head-kidney TGF-β gene expression le-vels were increased by 23.2, 21 and 11.8-fold in fish fed with 250, 500and 750mg kg−1 CA, respectively. Similar to our study, particularlyforegut TGF-β gene expressions in C. carpio fed for 8 weeks with sodiumbutyrate were significantly up-regulated (7.9-fold) [115]. In the post-challenge period of our study, head-kidney TGF-β gene expression le-vels of fish fed with 250, 500 and 750mg kg−1 CA increased 3.5, 4 and4-fold, respectively. Similarly, the middle or distal intestinal TGF-β1and -β2 gene expression levels in the post-challenge period were sig-nificantly increased in C. idella fed with 1000mg kg−1 sodium butyrate,however no changes were recorded in the increasing and/or decreasingdoses [117].

In teleost fish, three different immunoglobulin (Ig) isotypes can beidentified, namely, IgM, IgD, and teleost-specific IgT [120].

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

153

Immunoglobulin M (IgM), known as the primary antibody of fish, andthe main constituent of the humoral immune system in teleost may helpto determine and neutralize foreign antigens such as bacteria andviruses [121]. The most recent immunoglobulin class distinguished invertebrate species is IgT [122], and in various teleost their genomicorganization, protein structure and biochemical functions have beenrevealed [123]. The mucosal immune function of IgT is very evident inO. mykiss gut [124], skin [125] and gill [126]. Furthermore, IgT- andIgM-positive cells are reported to disperse widely in the liver, heart andhead kidney of O. mykiss [127].

In this study, head-kidney IgM expression levels increased in fish fedwith 500 and 750mg kg−1 CA addition in time, and it was observedthat these increases were 10.5 and 13.6-fold, respectively at the end ofthe pre-challenge period compared to the control. A similar trend wasnot observed in the IgT expression levels. In all CA supplementedgroups, 4.1 and 10.6-fold increases were observed with the highestexpression levels recorded on day 20, and day 60 only in the 250 and500mg kg−1 supplemented groups, respectively. Similar to our study,Lactobacillus rhamnosus addition to O. mykiss feeds increased im-munoglobulin gene expression levels in kidney and spleen [128]. Lac-tobacillus sakei and L. sakei + inulin supplemented diet up-regulatedexpression of IgM at weeks 4 and 8 in intestine and head kidney ofMycteroperca rosacea [129]. However, unlike our study, head-kidneyIgM gene expression levels in S. aurata fed with feed containing pro-biotic (Shewanella putrefaciens Pdp11) for 4 weeks remained unchanged[130].

In the present study, no difference occurred in the head-kidney IgTexpression levels in experimental groups at 20 dpi. Conversely, theintestinal IgT expression levels of O. mykiss fed with L. plantarum for 21days remained unchanged, however fish were fed for another 15 daysafter being infected with Lactococcus garvieae and probiotic additionsignificantly up-regulated IgT expressions [131]. In our study, IgM ex-pression levels at 20 dpi were increased by 2.5, 4.8 and 2.9-fold in the250, 500 and 750mg kg−1 CA supplemented groups, respectively. It isevident that the duration of feeding with different immunostimulantadditions in the pre- or post-challenge periods result in fluctuations onlevels of gene expressions with different tissues in fish. For example, itwas seen that dietary incorporation of probiotic (Bacillus sp.), im-munostimulant (palm fruit extract) or a mixture of the two + probiotic(S. putrefaciens Pdp11) to S. aurata feeds did not show any effect on skinIgT gene expression levels, while; increased skin IgM gene expressionlevels were observed if fish at week two [132]. However, in the 4thweek, opposite results were obtained [132]. It was reported that 3,4,5-trimethoxy cinnamic acid, an analog of CA, did not affect the IgM ex-pression levels of kidney cells of C. idella at 2, 8 and 24th hour ex-posure, however it up-regulated at 10mg L−1 concentration on the 48thhour and no changes were recorded in the increasing and/or decreasingdoses [46]. This can explain the impacts created by the different im-munostimulants and CA on immunoglobulin and/or other gene ex-pressions depending on time and dose.

Additionally, it is not surprising that CA up-regulates the cytokinegene expression levels of fish tissues. Earlier studies reported that or-ganic acid may improve gram-positive and gram-negative bacteria po-pulations, which can stimulate the production of cytokine through gut-associated lymphoid tissue due to their selective promoter effects onintestinal microbiota [17,118,140]. This was supported in a recentstudy, where malic acid (an organic acid) and probiotics (B. subtilis)mixture enhances both growth and health through its positive impacton the gastrointestinal tract, liver function, blood parameters and non-specific immune responses in O. niloticus [87]. In a similar way, it isfound that other dietary additives, including lupin, mango and stingingnettle [38], probiotic [131], caper [133], mannan-oligosaccharides andS. cerevisiae [39] also increased the pro-inflammatory (IL-1β, TNF-α andIL-8) and/or anti-inflammatory (TGF-β) gene expression levels of O.mykiss tissues.

In this study, SAA, IL-8 and IgT expression levels in the head-kidney

of fish fed with high dose (1500mg kg−1) CA containing feeds weregenerally at the highest level on day 20, whereas gradual decreaseswere observed on the 40th and 60th days and they became significantlydown-regulated on day 60. This suggests that addition of high doses ofCA in O. mykiss feeds and overfeeding for more than 40 days negativelyaffect fish. However, it was not easy to determine whether the effectseen at gene expression levels had immunostimulatory or im-munosuppressive characteristics since it was not recorded in the sur-vival curve.

There is a growing interest in the prophylactic abilities of organicacids on bacterial challenge to aquatic animals in recent years [13]. Ithas been reported that different organic acid additives provide re-sistance to pathogenic bacteria Edwardsiella tarda in olive flounder[134] and to Aeromonas sobria in O. niloticus fingerlings [17]. However,in the literature, there is only one study on the resistance developmentsof the organic acid-fed O. mykiss to Y. ruckeri. Jaafar et al. [12] fed O.mykiss with a mixture of propionic acid and formic acid, but the fish didnot gain resistance to the Y. ruckeri pathogen. Only few reports havebeen published on the use and effects of various dietary additives for O.mykiss exposed to Y. ruckeri pathogen. Among these addititives garlicpowder, mannanoligosaccharide and poly-β-hydroxybutyrate are themost salient ones [135,136], with reference to resistance of fish againstY. ruckeri. However, different than the present study, none of theseearlier reports presented information on gen expressions at molecularlevel.

According to the findings in the present study, feeding O. mykissjuveniles with 250 and 500mg kg−1 CA for 60 days decreased mortalityrate against Y. ruckeri, but similar mortality rates were found in thegroups with increasing doses when compared to the control. It has beenreported that the addition of 0.001% of Ducrosia anethifolia essence oilto O. mykiss feed slightly increases survival rate of fish against Y.ruckeri, but negative effects were noted on the survival rate at in-creasing concentrations of 0.01% and 0.1% [137]. Similarly, in Or-eochromis sp. fingerlings fed diets with 0.5% incorporation of a mixtureof organic acids increased survival rate against Streptococcus agalactiae,however, survival was not affected when dietary inclusion of the or-ganic acid mixture increased to 1.0% [138]. Improved resistanceagainst Y. ruckeri in O. mykiss by CA additives could be due to im-munomodulatory effects which was determined by different assays inthis study, and antimicrobial effect of CA against this pathogen [31].

In infected O. mykiss a significant and a positive corresponding re-lationship was obtained between antibody titers and protection againstlive Y. ruckeri [139,140]. Siwicki and Dunier [141] presented a max-imum of antibody secreting cells in the O. mykiss on the 21th post-vaccination day. In this study, the antibody titer analyzed on day 20was found to be high particularly in fish with high survival rate, whichwere fed with feeds containing 500mg kg−1 of CA, however no corre-lation was seen between the survival rate and antibody titers in theother treatment groups. This suggests that the impact of CA on thesurvival rate can be explained by changes in the innate immune para-meters, rather than specific antibody production level, as is the casewith fish fed on different immunostimulant supplemented feeds[69,142,143].

5. Conclusion

In today's fish farming, natural feed additives alternative to anti-biotics are of significant importance, due to their effects on specificdiseases with different durations of action or effects, similar to che-motherapeutic drugs. The present study is the first attempt to in-vestigate the effects of CA on the immunity parameters of Oncorhynchusmykiss and its resistance to Yersinia ruckeri. Findings of our studyespecially showed that (1) dietary CA improved the immunity by in-creasing granulocyte (%), phagocytic activity, phagocytic index, re-spiratory burst activity, potential killing activity in the blood of fish,and lysozyme, myeloperoxidase, total Ig and CH50 in the serum of fish;

S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018) 140–157

154

(2) dietary CA orchestrated the inflammatory response by up-regulatingthe SAA, IL-8, IL-1β, TGF-β, IFN-γ, TNF-α, IgM and IgT in the headkidney of fish; (3) dietary CA increased the survival rate of the fishinfected with Y. ruckeri. Therefore, feeding O. mykiss with diets con-taining 250–500mg kg−1 CA for a period of 60 days might be suggestedas optimal to enhance the immunity and disease resistance against Y.ruckeri. However, this study is a single experimental model, and furtherinvestigations on the use of different concentrations of trans-cinnamicacid (CA) in different fish species and different fish pathogens are en-couraged in terms of the evaluation of various blood parameters, sinceit is likely that the responses of fish seem to be subject to change inrelation to different doses.

Ethics statement

Fish experiments were performed in accordance with the guidelinesfor fish research from the animal ethics committee at CanakkaleOnsekiz Mart University (Protocol Number: 2013/03-22).

Conflicts of interest

No potential conflict of interest.

Acknowledgments

This study is summarized from a part of the PhD thesis of the firstauthor, supported by TUBITAK (Scientific and Technological ResearchCouncil of Turkey) under the Project No: 113O364. We also thank Prof.Dr. Murat Yigit and Prof. Dr. Yesim Buyukates for reviewing themanuscript.

References

[1] I.G. Cowx, Cultured Aquatic Species Information Programme-Oncorhynchus mykiss,(2006) http://www.fao.org/fishery/culturedspecies/Oncorhynchus_mykiss.

[2] TÜİK, Fishery Statistic, Turkish Statistical Institute, Türkiye, 2015.[3] B. Austin, D.A. Austin, Bacterial Fish Pathogens, Springer, 2012.[4] D.A. Austin, P.A.W. Robertson, B. Austin, Recovery of a new biogroup of Yersinia

ruckeri from diseased rainbow trout (Oncorhynchus mykiss, Walbaum), Syst. Appl.Microbiol. 26 (1) (2003) 127–131.

[5] J.K. Chettri, R.M. Jaafar, J. Skov, P.W. Kania, I. Dalsgaard, K. Buchmann, Boosterimmersion vaccination using diluted Yersinia ruckeri bacterin confers protectionagainst ERM in rainbow trout, Aquaculture 440 (2015) 1–5.

[6] U. Ispir, M. Dorucu, Effect of immersion booster vaccination with Yersinia ruckeriextracellular products (ECP) on rainbow trout Oncorhynchus mykiss, Int. Aquat.Res. 2 (2) (2010) 127–130.

[7] E. Tobback, A. Decostere, K. Hermans, F. Haesebrouck, K. Chiers, Yersinia ruckeriinfections in salmonid fish, J. Fish Dis. 30 (5) (2007) 257–268.

[8] Y.D. Huang, G.B. Michael, R. Becker, H. Kaspar, J. Mankertz, S. Schwarz,M. Runge, D. Steinhagen, Pheno- and genotypic analysis of antimicrobial re-sistance properties of Yersinia ruckeri from fish, Vet. Microbiol. 171 (3–4) (2014)406–412.

[9] S.Q.A. Shah, S. Karatas, H. Nilsen, T.M. Steinum, D.J. Colquhoun, H. Sorum,Characterization and expression of the gyrA gene from quinolone resistant Yersiniaruckeri strains isolated from Atlantic salmon (Salmo salar L.) in Norway,Aquaculture 350 (2012) 37–41.

[10] C. Chi, S.S. Giri, J.W. Jun, S. Yun, H.J. Kim, S.G. Kim, S.C. Park, Immune responseof the bay scallop, Argopecten irradians, after exposure to the algicide palmitoleicacid, Fish Shellfish Immunol. 57 (2016) 371–378.

[11] Y. Gao, J. He, Z. He, Z. Li, B. Zhao, Y. Mu, J.Y. Lee, Z. Chu, Effects of fulvic acid ongrowth performance and intestinal health of juvenile loach Paramisgurnus dab-ryanus (Sauvage), Fish Shellfish Immunol. 62 (2017) 47–56.

[12] R.M. Jaafar, P.W. Kania, A.H. Larsen, D.S. Nielsen, B. Fouz, C. Browdy,K. Buchmann, Gut microbiota changes in rainbow trout, Oncorhynchus mykiss(Walbaum), during organic acid feed supplementation and Yersinia ruckeri in-fection, J. Fish. Dis. 36 (6) (2013) 599–606.

[13] W.K. Ng, C.B. Koh, The utilization and mode of action of organic acids in the feedsof cultured aquatic animals, Rev. Aquacult. 9 (4) (2017) 342–368.

[14] W.K. Ng, C.B. Koh, K. Sudesh, A. Siti-Zahrah, Effects of dietary organic acids ongrowth, nutrient digestibility and gut microflora of red hybrid tilapia, Oreochromissp., and subsequent survival during a challenge test with Streptococcus agalactiae,Aquacult. Res. 40 (13) (2009) 1490–1500.

[15] T. Pérez-Sánchez, I. Ruiz-Zarzuela, I. Blas, J.L. Balcázar, Probiotics in aquaculture:a current assessment, Rev. Aquacult. 6 (3) (2014) 133–146.

[16] S. Pourmozaffar, A. Hajimoradloo, H.K. Miandare, Dietary effect of apple cider

vinegar and propionic acid on immune related transcriptional responses andgrowth performance in white shrimp, Litopenaeus vannamei, Fish ShellfishImmunol. 60 (2017) 65–71.

[17] R.M. Reda, R. Mahmoud, K.M. Selim, I.E. El-Araby, Effects of dietary acidifiers ongrowth, hematology, immune response and disease resistance of Nile tilapia,Oreochromis niloticus, Fish Shellfish Immunol. 50 (2016) 255–262.

[18] S. Nayak, Probiotics and immunity: a fish perspective, Fish Shellfish Immunol. 29(1) (2010) 2–14.

[19] C.M. John, P. Sandrasaigaran, C.K. Tong, A. Adam, R. Ramasamy,Immunomodulatory activity of polyphenols derived from Cassia auriculata flowersin aged rats, Cell. Immunol. 271 (2) (2011) 474–479.

[20] N. Kamalakkannan, P.S. Prince, Antihyperglycaemic and antioxidant effect ofrutin, a polyphenolic flavonoid, in streptozotocin-induced diabetic wistar rats,Basic Clin. Pharmacol. Toxicol. 98 (1) (2006) 97–103.

[21] M. Krifa, I. Bouhlel, L. Ghedira-Chekir, K. Ghedira, Immunomodulatory and cel-lular anti-oxidant activities of an aqueous extract of Limoniastrum guyonianum gall,J. Ethnopharmacol. 146 (1) (2013) 243–249.

[22] C.C. Tangney, H.E. Rasmussen, Polyphenols, inflammation, and cardiovasculardisease, Curr. Atherosclerosis Rep. 15 (5) (2013) 324.

[23] D.K. Gessner, R. Ringseis, K. Eder, Potential of plant polyphenols to combat oxi-dative stress and inflammatory processes in farm animals, J. Anim. Physiol. Anim.Nutr. 101 (4) (2017) 605–628.

[24] S. Said, F.M. Neves, A.J.F. Griffiths, Cinnamic acid inhibits the growth of thefungus Neurospora crassa, but is eliminated as acetophenone, Int. Biodeterior.Biodegrad. 54 (1) (2004) 1–6.

[25] M. Sova, Antioxidant and antimicrobial activities of cinnamic acid derivatives,Mini Rev. Med. Chem. 12 (8) (2012) 749–767.

[26] E. Pontiki, D. Hadjipavlou-Litina, K. Litinas, G. Geromichalos, Novel cinnamic acidderivatives as antioxidant and anticancer agents: design, synthesis and modelingstudies, Molecules 19 (7) (2014) 9655–9674.

[27] L. Liu, W.R. Hudgins, S. Shack, M.Q. Yin, D. Samid, Cinnamic acid - a naturalproduct with potential use in cancer intervention, Int. J. Canc. 62 (3) (1995)345–350.

[28] M. Fernandez, M. Saenz, M. Garcia, Natural Products: anti-inflammatory activityin rats and mice of phenolic acids isolated from Scrophularia frutescens, J. Pharm.Pharmacol. 50 (10) (1998) 1183–1186.

[29] U. Food, D. Administration, Code of Federal Regulations vol. 3, (2010) Title 21.[30] V.G.N.V. Prasad, P.L. Swamy, T.S. Rao, G.S. Rao, Antibacterial synergy between

quercetin and polyphenolic acids against bacterial pathogens of fish, Asian Pac. J.Trop. Dis. 4 (2014) S326–S329.

[31] S. Yilmaz, The Effect of Dietary Cinnamic Acid or Bacillus subtilis on GrowthPerformance and Immunological Parameters in Rainbow Trout, Department ofAquaculture, Çanakkale Onsekiz Mart University, Graduate School of Natural andApplied Sciences, Türkiye, 2017, p. 210.

[32] S. Yilmaz, S. Ergun, Effects of garlic and ginger oils on hematological and bio-chemical variables of sea bass Dicentrarchus labrax, J. Aquat. Anim. Health 24 (4)(2012) 219–224.

[33] S. Yilgmaz, S. Ergün, E.S. Celik, Effect of dietary spice supplementations on wel-fare status of sea bass, Dicentrarchus labrax L, Proc. Natl. Acad. Sci. India B Biol.Sci. 86 (1) (2016) 229–237.

[34] S. Yılmaz, Ü. Acar, O.S. Kesbiç, N. Gültepe, S. Ergün, Effects of dietary allspice,Pimenta dioica powder on physiological responses of Oreochromis mossambicusunder low pH stress, SpringerPlus 4 (1) (2015) 719.

[35] F. Fazio, C. Faggio, A. Torre, M. Sanfilippo, G. Piccione, Effect of Water Quality onHematological and Biochemical Parameters of Gobius niger Caught in Faro Lake(Sicily), (2013).

[36] F. Fazio, C. Saoca, S. Casella, G. Fortino, G. Piccione, Relationship between bloodparameters and biometric indices of Sparus aurata and Dicentrarcus labrax culturedin onshore tanks, Mar. Freshw. Behav. Physiol. 48 (4) (2015) 289–296.

[37] N. Ivanovska, H. Neychev, Z. Stefanova, V. Bankova, S. Popov, Influence of cin-namic acid on lymphocyte proliferation, cytokine release and Klebsiella infectionin mice, Apidologie 26 (2) (1995) 73–81.

[38] E. Awad, W.J. Mitchell, B. Austin, Effect of dietary supplements on cytokine geneexpression in rainbow trout, Oncorhynchus mykiss (Walbaum), J. Fish. Dis. 34 (8)(2011) 629–634.

[39] D. Castro-Osses, C. Carrera-Naipil, C. Gallardo-Escarate, A.T. Goncalves,Functional diets mo