Functional analysis of the p53 pathway in neuroblastoma ...mct.aacrjournals.org/content/molcanther/early/2011/04/01/1535-7163... · Functional analysis of the p53 pathway in neuroblastoma

1

Functional analysis of the p53 pathway in neuroblastoma cells using the

small-molecule MDM2 antagonist nutlin-3∗

Tom Van Maerken,1,2 Ali Rihani,1 Daniel Dreidax,3 Sarah De Clercq,4 Nurten Yigit,1 Jean-

Christophe Marine,4 Frank Westermann,3 Anne De Paepe,1 Jo Vandesompele,1 Frank

Speleman1

1Center for Medical Genetics, Ghent University Hospital, Ghent, Belgium

2Department of Clinical Chemistry, Microbiology and Immunology, Ghent University

Hospital, Ghent, Belgium

3Department of Tumor Genetics, German Cancer Research Center, Heidelberg, Germany

4Laboratory for Molecular Cancer Biology, VIB-UGent, Ghent, Belgium

Running title: Analysis of the p53 pathway in neuroblastoma

Keywords: neuroblastoma, p53, nutlin-3, p14ARF

Abbreviations: CI, confidence interval; qPCR, quantitative real-time PCR; qRT-PCR,

quantitative real-time reverse transcription PCR

∗Grants: Research Foundation – Flanders (FWO), Concerted Research Actions – UGent (GOA), Interuniversity Attraction Poles – Belgium (IUAP), and Emmanuel van der Schueren Foundation. T. Van Maerken has conducted the study as Ph.D. fellow of the FWO. Correspondence: Tom Van Maerken, Center for Medical Genetics, Ghent University Hospital, De Pintelaan 185, B-9000 Ghent, Belgium. Phone: 32-9-332-0352; Fax: 32-9-332-6549. E-mail: [email protected] Conflict-of-interest disclosure: None.

on July 1, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 1, 2011; DOI: 10.1158/1535-7163.MCT-10-1090

http://mct.aacrjournals.org/

2

Abstract

Suppression of p53 activity is essential for proliferation and survival of tumor cells. A direct

p53-activating compound, nutlin-3, was used in this study, together with p53 mutation

analysis, to characterize p53 pathway defects in a set of 34 human neuroblastoma cell lines.

We identified 9 cell lines (26%) with a p53 loss-of-function mutation, including 6 missense

mutations, 1 nonsense mutation, 1 in-frame deletion, and 1 homozygous deletion of the 3′ end

of the p53 gene. Sensitivity to nutlin-3 was highly predictive of absence of p53 mutation.

Signaling pathways downstream of p53 were functionally intact in 23 out of 25 cell lines with

wild-type p53. Knockdown and overexpression experiments revealed a potentiating effect of

p14ARF expression on the response of neuroblastoma cells to nutlin-3. Our findings shed light

on the spectrum of p53 pathway lesions in neuroblastoma cells, indicate that defects in

effector molecules downstream of p53 are remarkably rare in neuroblastoma, and identify

p14ARF as a determinant of the outcome of the response to MDM2 inhibition. These insights

may prove useful for the clinical translation of evolving strategies aimed at p53 reactivation

and for the development of new therapeutic approaches.




3

Introduction

The p53 transcription factor plays a critical role in the cellular defense against malignant

transformation by promoting cell cycle arrest, DNA damage repair, apoptosis, and senescence

in response to stress signals (1). Tumor cells therefore invariably acquire aberrations that

permit them to escape from p53-mediated growth control. It is estimated that approximately

50% of all human cancers harbor inactivating mutations in the TP53 (p53) gene, whereas

defects in upstream or downstream components of the p53 pathway are believed to account

for loss of p53 activity in the other half of malignancies. Dissection of the p53 pathway

defects in individual tumor types is important, since improved understanding of the

mechanisms behind p53 inactivation may guide the development of targeted therapeutic

strategies.

Neuroblastoma is an aggressive childhood tumor of neural crest origin, that has a lethal

outcome in the majority of high-risk patients (2). A remarkable feature is that p53 is rarely

mutated at diagnosis and only in a minority of neuroblastoma tumors at relapse, as

demonstrated by a recent study that found mutation rates of 2% and 15%, respectively (3).

Conflicting data exist regarding p53 pathway signaling in neuroblastoma cells. The DNA

damage-induced G1 checkpoint function and apoptotic activity of p53 have been reported to

be impaired by cytoplasmic p53 sequestration (4-6), which may be caused by p53

hyperubiquitination (7). Furthermore, wild-type p53 in neuroblastoma cells may be in a

conformation refractory to integration into transcriptional complexes, resulting in reduced

transcriptional activity (8). In contrast, others have demonstrated a normal DNA-binding and

transactivation capacity of the p53 protein and an intact p53 signal transduction pathway in

neuroblastoma cells with wild-type p53 (9-11). No study has yet systematically investigated

the functional integrity of the p53 pathway in neuroblastoma cells on a larger scale, as the




4

reports mentioned above relied on the use of only one to five neuroblastoma cell lines to

judge on p53 functionality.

We have previously reported that a small-molecule MDM2 antagonist, nutlin-3, is capable of

inducing potent antitumor effects against neuroblastoma cells and xenografts with wild-type

p53, which may provide a new opportunity for targeted therapeutic intervention (12, 13).

Nutlin-3 is designed to compete with p53 for binding into a hydrophobic pocket on the

surface of MDM2 (14). The resulting disruption of the interaction between both proteins

releases p53 from negative control by MDM2, which functions as an E3 ubiquitin ligase to

promote p53 proteasomal degradation and as an inhibitor of p53 transcriptional activity.

Treatment with nutlin-3 thus leads to stabilization and activation of p53 and, if downstream

effectors are functionally intact, to a robust p53 response.

The availability of a direct and selective p53 activator makes it possible to systematically

search for defects in p53 and its downstream signaling components. Here, we set out to

examine the nature of p53 pathway defects in a large panel of neuroblastoma cell lines using

nutlin-3 as a tool for interrogating the functionality of the p53 pathway.




5

Materials and Methods

Cell culture and nutlin-3 treatment

Human neuroblastoma cell lines were obtained between 1993 and 2010 from Peter Ambros

(STA-NB-1.2, STA-NB-3, STA-NB-8, STA-NB-9, STA-NB-10), Garrett Brodeur (NGP,

NLF, NMB), Susan Cohn (NBL-S, SHEP), Valérie Combaret (CLB-GA), Thomas Look

(SJNB-1, SJNB-8, SJNB-10), John Lunec [SK-N-BE(1n), SK-N-BE(2c)], Sven Påhlman

(SH-SY5Y), Patrick Reynolds (CHP-134, CHP-901, CHP-902R, SMS-KAN, SMS-KCNR),

and Rogier Versteeg (GICIN-1, IMR-32, LA-N-1, LA-N-2, LA-N-5, LA-N-6, N-206, SK-N-

AS, SK-N-FI, SK-N-SH, TR-14), or established in our laboratory (UHG-NP). The

authenticity of the cell lines was verified during this study by array comparative genomic

hybridization and short tandem repeat genotyping. Cell culturing and treatment with nutlin-3

(Cayman Chemical, Ann Arbor, MI) were performed as previously described (12).

p53 mutation analysis

Sequencing of the p53 coding region was performed as previously described (12).

Cell viability analysis

Cells were seeded in duplicate or triplicate wells of a 96-well plate (104 cells per well) and

incubated for 6 h before treatment was initiated. Treatment typically consisted of exposure to

0, 2, 4, 8, 16, and 32 µM nutlin-3 for 24, 48, and 72 h, except for experiments with inducible

model systems, in which the inducing agent or a negative control was applied for 16 h prior to

incubation with nutlin-3. Cell viability was measured using a luminescent ATP-based assay

(CellTiter-Glo, Promega, Madison, WI).




6

Analysis of caspase-3 and caspase-7 activity

Cells were plated in duplicate or triplicate wells of a 96-well plate (104 cells per well) and

incubated for 6 h prior to treatment, which was performed in a similar way as described for

the cell viability experiments. The combined activity of caspase-3 and caspase-7 was

determined using the Caspase-Glo 3/7 assay (Promega).

Cell cycle and hypodiploidy analysis

Measurements of cell cycle phase distribution and hypodiploid (sub-G1) DNA content were

performed as previously described (13).

Quantitative real-time reverse transcription PCR (qRT-PCR)

Cells were treated with 0 or 8 µM nutlin-3 for 24 h (or, in the case of an inducible model

system, with the inducing agent or a negative control for 16 h and then with 0 or 8 µM nutlin-

3 for an additional 24 h). Total RNA extraction, DNase treatment, cDNA synthesis, and

SYBR Green I qRT-PCR were performed as previously described (13). Primer sequences are

available in the RTPrimerDB database (15): BAX (RTPrimerDB ID #814), BBC3 (PUMA;

#3500), CDKN1A (p21WAF1/CIP1; #631), GAPDH (#3), SDHA (#7), and UBC (#8). Expression

levels of the p53 target genes BAX, PUMA, and p21WAF1/CIP1 were calculated using qbasePLUS

software version 1.5 (Biogazelle, Ghent, Belgium) (16). Levels of GAPDH, SDHA, and UBC

were used for normalization.

Western blot analysis

Western blotting was performed as previously described (12) using primary antibodies against

p53 (mouse clone DO-1; Calbiochem, San Diego, CA), p21WAF1/CIP1 (mouse clone SX118;

BD Biosciences, San Jose, CA), and BAX (rabbit monoclonal antibody; Upstate,




7

Charlottesville, VA). An anti-β-actin antibody (mouse clone AC-74; Sigma, St. Louis, MO)

was used to confirm equal loading.

Knockdown and overexpression of CDKN2A (p16INK4a/p14ARF)

See Supplementary Data.

Statistical analysis

See Supplementary Data.




8

Results

p53 mutation analysis

The 34 human neuroblastoma cell lines used in this study were first characterized for

mutations in the p53 gene. Sequencing of the entire coding region in two overlapping

fragments demonstrated wild-type p53 in 25 cell lines (74%) and various genetic defects in

the other 9 cell lines (26%) (Table 1). The most frequent aberrations were missense

mutations, which were located in exon 5 [N-206, SK-N-BE(2c)], exon 6 (NLF), exon 7

(NMB, SK-N-FI), and exon 10 (LA-N-2) of p53. One cell line, LA-N-1, was characterized by

a nonsense mutation, resulting in a stop codon at amino acid residue 182. SJNB-8 cells were

found to possess an in-frame deletion that removes the coding sequence for amino acids 105-

125. The PCR step prior to the sequencing did not produce an amplicon for the second part of

the p53 coding region in SK-N-AS cells. It could be shown by quantitative real-time PCR

(qPCR) that this was due to a homozygous deletion of the 3′ end of p53 (Supplementary Fig.

S1), in line with previously published findings (17, 18).

Sensitivity to nutlin-3

We next used the selective MDM2 antagonist nutlin-3 to test whether the p53 pathway was

functional in our series of neuroblastoma cell lines. As illustrated in Fig. 1A, determination of

the nutlin-3 concentration that causes 50% reduction in cell viability (IC50 value) provides a

quantitative measure of the functional integrity of the p53 pathway. IC50 values were

established at 24, 48, and 72 h of nutlin-3 treatment and correlated with the mutation status of

p53 (Fig. 1B). Cell lines with wild-type p53 displayed highly significantly lower IC50 values

than lines harboring mutant p53 (P=0.004 at 24 h, P<0.001 at 48 and 72 h). All 9 cell lines

with p53 mutation were characterized by high IC50 values, indicating that the genetic




9

aberration effectively impaired the function of the p53 protein. Pronounced reductions in cell

viability after nutlin-3 treatment and corresponding low IC50 values were observed in 23 out

of the 25 cell lines with wild-type p53. This suggests that p53 downstream signaling pathways

are not a major target for p53-inactivating lesions in neuroblastoma and lends support to the

development of therapeutic strategies aimed at p53 reactivation.

Two cell lines, LA-N-6 and SHEP, were relatively resistant to nutlin-3 despite the presence of

wild-type p53 (IC50 values comparable to those observed in neuroblastoma lines with mutant

p53, i.e., IC50 values >32 µM, >30 µM, and >20 µM nutlin-3 at 24, 48, and 72 h of treatment,

respectively) (Fig. 1B). Of particular interest were SHEP cells, because their response to

nutlin-3 was strikingly different from that of two closely related cell lines, SK-N-SH and SH-

SY5Y. Cell line SK-N-SH was originally derived from bone marrow metastases of a patient

with stage 4 neuroblastoma, and subcloning of these cells has generated several

morphologically distinct sublines, including SHEP and SH-SY5Y (19). Fig. 2A demonstrates

that nutlin-3 profoundly suppressed the viability of SK-N-SH and SH-SY5Y cells, whereas

only mild effects were noted in SHEP cells. Further experiments were performed to determine

whether the poor nutlin-3 response of SHEP cells was due to failure to enter apoptosis or to

defective cell cycle arrest. Analysis of caspase-3 and caspase-7 activity indicated that a 24-h

exposure to nutlin-3 induced a dose-dependent apoptotic response in SK-N-SH and SH-SY5Y

cells (Fig. 2B). In contrast, no increase in caspase-3 and caspase-7 activity was observed in

nutlin-3-treated SHEP cells. This was confirmed by flow cytometric analysis of sub-G1 DNA

content after treatment with vehicle control or 8 µM nutlin-3 for 24 h, which showed a nutlin-

3-induced increase in the apoptotic sub-G1 fraction in SK-N-SH and SH-SY5Y cells, but not

in SHEP cells (Fig. 2C). Flow cytometric cell cycle profiling further demonstrated a reduction

in the percentage of cells in S phase 24 h after treatment of SK-N-SH, SH-SY5Y, and SHEP

cells with 8 µM nutlin-3, indicative of cell cycle arrest in all three cell lines (Fig. 2D). The




10

phenotypic effects of nutlin-3 on apoptosis and cell cycle progression were paralleled by

similar changes in expression levels of p53 target genes. As shown in Fig. 2E, a 24-h

treatment of SK-N-SH and SH-SY5Y cells with 8 µM nutlin-3 induced an increase in the

mRNA levels of p53 target genes involved in apoptosis (BAX, PUMA) and cell cycle arrest

(p21WAF1/CIP1). A large increase in p21WAF1/CIP1 expression was also present in SHEP cells

treated with 8 µM nutlin-3 for 24 h, but expression levels of the proapoptotic target genes

BAX and PUMA remained considerably lower in nutlin-3-treated SHEP cells than in nutlin-3-

treated SK-N-SH and SH-SY5Y cells. Similar findings were observed by Western blot

analysis. Treatment with 8 µM nutlin-3 for 24 h induced p53 accumulation and increased

expression of p21WAF1/CIP1 in all three cell lines, whereas induction of BAX expression was

observed only in nutlin-3-treated SK-N-SH and SH-SY5Y cells (Fig. 2F). Taken together,

these data indicate that SHEP cells have an intact cell cycle checkpoint control mechanism,

but fail to undergo apoptosis in response to treatment with nutlin-3.

Interestingly, SHEP cells have previously been reported to contain a homozygous deletion of

the CDKN2A gene on chromosome 9p21, in contrast to SK-N-SH and SH-SY5Y cells (20).

We confirmed the copy number status of CDKN2A in these three cell lines by qPCR

(Supplementary Fig. S2). The CDKN2A gene encodes two structurally distinct growth-

inhibitory proteins, p16INK4a and p14ARF, that are important regulators of the pRb and p53

tumor suppressor pathways, respectively (21). This raised the possibility that the homozygous

CDKN2A deletion may underlie the nutlin-3-resistant phenotype of SHEP cells. Analysis of

the entire panel of 25 neuroblastoma cell lines with wild-type p53 further revealed that the

presence of homozygous CDKN2A deletion was strongly associated with a higher IC50 value

at 48 and 72 h of nutlin-3 treatment (P=0.009 and P<0.001, respectively) (Supplementary

Table S1). Amplification of MDM2 did not have an impact on the IC50 values of

neuroblastoma cell lines with wild-type p53 (P>0.05) (Supplementary Table S1). MYCN-




11

amplified neuroblastoma cell lines with wild-type p53 were characterized by a lower IC50

value at 72 h of nutlin-3 treatment than wild-type p53 neuroblastoma cell lines without MYCN

amplification (P=0.023), but this difference was not observed anymore after exclusion of cell

lines with homozygous CDKN2A deletion (P>0.05) (Supplementary Table S1). No significant

difference in p53 mutation status nor in MDM2 and CDKN2A copy number status was found

between MYCN-amplified and MYCN-nonamplified neuroblastoma cell lines (P>0.05)

(Supplementary Table S2).

Effect of CDKN2A knockdown on the response to nutlin-3

A possible involvement of p14ARF and p16INK4a in the nutlin-3 response was first tested by

transient knockdown of the CDKN2A gene in IMR-32 and NGP cells, two easy-to-transfect

neuroblastoma cell lines that have a good and previously well-characterized nutlin-3 response

(12), using a pool of siRNAs directed against sequences common to both p14ARF and p16INK4a

transcripts. The efficiency of CDKN2A knockdown, measured by qRT-PCR 24 h

posttransfection, is shown in Fig. 3A. Silencing of CDKN2A resulted in a moderate reduction

in the sensitivity of IMR-32 and NGP cells to nutlin-3, as demonstrated by cell viability

assays performed after 24, 48, and 72 h of exposure to nutlin-3 (Fig. 3B and C).

To unravel whether this potentiating effect of CDKN2A expression on the response to nutlin-3

was mediated by p14ARF or p16INK4a, NGP cells were infected with lentiviruses encoding a

p14ARF-specific shRNA, a p16INK4a-specific shRNA, an shRNA directed simultaneously

against both transcripts, or a negative control shRNA targeting firefly luciferase, and

subsequently selected with puromycin to eliminate uninfected cells. qRT-PCR analysis of

p14ARF and p16INK4a expression in the established sublines, termed NGP-LV-p14, NGP-LV-

p16, NGP-LV-p14/p16, and NGP-LV-luc, respectively, demonstrated successful transcript-

specific knockdown (Fig. 4A). Treatment of these stable knockdown cell lines with nutlin-3




12

followed by cell viability assays indicated that the influence of CDKN2A expression on the

nutlin-3 response was primarily attributable to p14ARF (Fig. 4B). These findings were

confirmed by analysis of caspase-3 and caspase-7 activity, which showed that silencing of

p14ARF decreased the susceptibility of NGP cells to undergo apoptosis upon nutlin-3 treatment

(Fig. 4C). Quantification of p53 target gene expression demonstrated that knockdown of

p14ARF, but not p16INK4a, attenuated the p53 transcriptional response induced by a 24-h

exposure to 8 µM nutlin-3 (Fig. 4D). This was accompanied by a marked p14ARF shRNA-

induced decrease in the basal mRNA levels of PUMA and p21WAF1/CIP1 in vehicle-treated cells,

whereas BAX expression was upregulated to a lesser extent by nutlin-3, rather than basically

suppressed, when p14ARF was silenced.

Effect of CDKN2A overexpression on the response to nutlin-3

We next examined whether overexpression of CDKN2A could enhance the response of

neuroblastoma cells to nutlin-3. We therefore generated stable transfectants of an IMR-32

subclone, IMR-5/75, in which transgenic expression of either p14ARF or p16INK4a or, as a

negative control, lacZ was inducible by addition of tetracycline. Fig. 5A shows the relative

mRNA expression levels of p14ARF and p16INK4a in these sublines, designated as IMR-Tet-

p14, IMR-Tet-p16, and IMR-Tet-lacZ, respectively, 24 h after treatment with tetracycline or

vehicle control. Overexpression of p14ARF resulted in a more pronounced reduction in cell

viability and stronger caspase-3 and caspase-7 activation following nutlin-3 treatment,

whereas overexpression of p16INK4a or lacZ had no appreciable effect on the nutlin-3 response

(Fig. 5B and C). In line with these observations, incubation of IMR-Tet-p14 cells with 8 µM

nutlin-3 for 24 h induced a more potent p53 transcriptional response when the cells had been

exposed to tetracycline compared to vehicle control (Fig. 5D). The expression of PUMA and

p21WAF1/CIP1 in these cells in the absence of nutlin-3 was also considerably increased by the




13

addition of tetracycline. In contrast, switching on transgene expression in IMR-Tet-p16 and

IMR-Tet-lacZ cells did not affect basal nor nutlin-3-induced expression levels of p53-

responsive genes.

Finally, similar CDKN2A overexpression experiments were undertaken in SHEP cells to

investigate whether this manipulation could restore the sensitivity to nutlin-3. Despite

successful generation of several sublines with tetracycline-inducible expression of p14ARF and

p16INK4a, we did not observe a reversal or improvement of the nutlin-3-resistant phenotype of

SHEP cells (Supplementary Fig. S3).

Taken together, our data provide evidence for a dosage effect of p14ARF expression on the

response of neuroblastoma cells to nutlin-3, but they also indicate that the homozygous

CDKN2A deletion in SHEP cells is not responsible for the poor response of these cells to

nutlin-3.




14

Discussion

The p53 tumor suppressor protein is at the crossroads of cellular stress response pathways that

control decisions between life and death. We used here the selective MDM2 antagonist nutlin-

3 as a tool to gain insight into the mechanisms by which neuroblastoma cells escape from

p53-mediated growth control. Mutation analysis demonstrated a p53 gene alteration in 9 out

of 34 neuroblastoma cell lines, which rendered the p53 pathway nonfunctional in all cases.

Three mutations were located outside the classic hot-spot region (exons 5-9), indicating that

p53 mutations are best identified by sequencing the entire coding region. The observed

mutation frequency in our cell line panel (26%) is considerably higher than the p53 mutation

rate of approximately 1% that was found in early studies of neuroblastoma tumors (22-27).

This may reflect the fact that cell lines are frequently derived from progressive or relapsed

tumors, as p53 mutations can develop during chemotherapy and malignant progression of

neuroblastoma (28). Additionally, older studies may have underestimated to some extent the

p53 mutation frequency in neuroblastoma tumors, since analysis was often confined to the

mutational hot-spot region.

Treatment with nutlin-3 was capable of inducing potent antiproliferative and cytotoxic effects

in 23 out of 25 neuroblastoma cell lines with wild-type p53. These findings are particularly

relevant in the light of an ongoing debate whether p53 is functional in neuroblastoma or not

(4-11). Discrepancies between previous studies may be in part attributed to different treatment

regimens (11) and to whether the p53-inducing stimulus directly interferes with potential

restraints on p53 activity, such as p53 hyperubiquitination (7). Our data provide good

evidence of almost uniform functionality of the p53 protein and its downstream effectors in

neuroblastoma cells with wild-type p53 when the interaction between p53 and MDM2 is

disrupted by nutlin-3. As a consequence, selective MDM2 inhibitors may prove beneficial for




15

treating neuroblastoma patients, provided that wild-type p53 is present. Our findings of

functional p53 effector pathways also suggest that circumvention of the p53-driven antitumor

barrier in neuroblastoma cells relies primarily on defects upstream of p53. Cumulating

evidence indicates that it is precisely an increased activity of MDM2 which serves as the

predominant mode of p53 inactivation in neuroblastoma (28), but further study is warranted to

identify the full spectrum of aberrations in regulators of p53 activity.

The presence of a homozygous CDKN2A deletion in the nutlin-3-refractory SHEP cells but

not in the nutlin-3-sensitive SK-N-SH and SH-SY5Y cells prompted us to investigate the role

of p14ARF and p16INK4a in the response to nutlin-3. The nutlin-3-resistant phenotype of SHEP

cells could not be reversed by reintroduction of p14ARF or p16INK4a, but knockdown and

overexpression experiments in other neuroblastoma cell lines pointed to a stimulatory effect

of p14ARF expression on the nutlin-3 response. Our data suggest that a p14ARF-driven increase

in basal expression levels of p53-responsive genes, such as PUMA and p21WAF1/CIP1,

contributes to this potentiating effect of p14ARF, although other mechanisms cannot be

excluded. High levels of the MDM2-inhibitory protein p14ARF may result in a larger fraction

of the nuclear pool of MDM2 molecules being inhibited after nutlin-3 treatment and thus in

stronger activation of the p53 pathway. Alternatively, p14ARF may provide a costimulatory

signal for the p53 response independently of MDM2. For instance, p14ARF may increase p53

protein synthesis (29), inhibit p53 turnover by repressing other components of the p53

degradation pathway than MDM2 (30), enhance p53 transcriptional activity (31), or regulate

pathways that crosstalk with p53 signaling (32). We did not aim to identify the molecular

basis of the cooperation between p14ARF and nutlin-3 in this study, but rather wish to

comment on the potential clinical implications. Previous studies using mouse models have

demonstrated that Cdkn2a mutations induce chemoresistance by disabling p53 (33) and that

loss of p19ARF, the murine homolog of p14ARF, limits the therapeutic response to the tyrosine




16

kinase inhibitor imatinib (34). Based on our findings, it can be expected that tumor cells may

also gain resistance to nutlin-3 treatment by suppressing p14ARF. The likelihood of this

scenario is corroborated by data from a switchable p53 knock-in mouse model of lymphoma

showing that p53 reactivation strongly selects for the emergence of p53-resistant tumors

through inactivation of either p53 or p19ARF (35). Several early-phase clinical studies with

selective MDM2 inhibitors and other p53-reactivating compounds have recently been initiated

(36). Our data indicate that the occurrence of aberrations in p14ARF should be monitored in

these studies and provide an incentive for the development of strategies to counter p14ARF

lesions.

The lack of improvement in nutlin-3 sensitivity after reintroduction of p14ARF into SHEP cells

leaves us with the question of how to explain the resistant phenotype of these cells. We

provided evidence of intact cell cycle arrest but defective apoptosis following nutlin-3

treatment of SHEP cells. This cell line is also resistant to other apoptosis-inducing stimuli,

including irradiation (37, 38) and adenoviral gene therapy (39). The poor sensitivity to death-

inducing triggers might be related to the S-type (substrate-

adherent/Schwannian/melanoblastic) morphology of SHEP cells, as S-type neuroblastoma

cells seem to be more resistant to apoptosis than N-type (neuroblastic/neuroendocrine)

neuroblastoma cells (40). Another notable feature is that SHEP cells have lost the capacity to

form colonies in soft agar and tumors in nude mice (41). One could therefore wonder whether

the loss of oncogenic signals – which often have a collateral proapoptotic effect – may result

in desensitization to apoptosis. For instance, SHEP cells lack expression of the MYCN

oncoprotein, and artificial induction of MYCN expression in these cells has been shown to

slightly increase the sensitivity to nutlin-3 (42). Alternatively, SHEP cells may contain high

levels of antiapoptotic proteins, as has been previously proposed (37). Further study is needed

to pinpoint the exact mechanism underlying the nutlin-3-resistant phenotype of SHEP cells.




17

In conclusion, this study provides several insights into the spectrum of p53 pathway defects in

neuroblastoma cells that may prove useful for designing new therapeutic approaches. The

rarity of signaling defects downstream of p53 indicates that p53-reactivating strategies may

represent an excellent therapeutic tool for treating neuroblastoma tumors with wild-type p53.

Resistance to nutlin-3 is mostly attributable to the presence of p53 mutation, which is not

uncommon in neuroblastoma cell lines. This highlights the need to search for effective p53-

independent anticancer agents or mutant p53-targeting compounds as a complementary

therapeutic modality. Finally, the finding that p14ARF expression levels modulate the

sensitivity of neuroblastoma cells to nutlin-3 raises the possibility that p14ARF may contribute

to the outcome of p53 activation in patients treated with selective MDM2 inhibitors. It

remains to be determined whether clinical treatment failure with this new class of anticancer

drugs may result from loss or suppression of p14ARF.




18

Acknowledgments

We thank Griet Van Lancker and Xiaoyang Zhang for technical assistance.




19

References

1. Levine AJ, Oren M. The first 30 years of p53: growing ever more complex. Nat Rev Cancer 2009;9:749–58. 2. Maris JM, Hogarty MD, Bagatell R, Cohn SL. Neuroblastoma. Lancet 2007;369:2106–20. 3. Carr-Wilkinson J, O'Toole K, Wood KM, Challen CC, Baker AG, Board JR, et al. High frequency of p53/MDM2/p14ARF pathway abnormalities in relapsed neuroblastoma. Clin Cancer Res 2010;16:1108–18. 4. Moll UM, Ostermeyer AG, Haladay R, Winkfield B, Frazier M, Zambetti G. Cytoplasmic sequestration of wild-type p53 protein impairs the G1 checkpoint after DNA damage. Mol Cell Biol 1996;16:1126–37. 5. Rodriguez-Lopez AM, Xenaki D, Eden TO, Hickman JA, Chresta CM. MDM2 mediated nuclear exclusion of p53 attenuates etoposide-induced apoptosis in neuroblastoma cells. Mol Pharmacol 2001;59:135–43. 6. Wang X, Zalcenstein A, Oren M. Nitric oxide promotes p53 nuclear retention and sensitizes neuroblastoma cells to apoptosis by ionizing radiation. Cell Death Differ 2003;10:468–76. 7. Becker K, Marchenko ND, Maurice M, Moll UM. Hyperubiquitylation of wild-type p53 contributes to cytoplasmic sequestration in neuroblastoma. Cell Death Differ 2007;14:1350–60. 8. Wolff A, Technau A, Ihling C, Technau-Ihling K, Erber R, Bosch FX, et al. Evidence that wild-type p53 in neuroblastoma cells is in a conformation refractory to integration into the transcriptional complex. Oncogene 2001;20:1307–17. 9. Goldman SC, Chen CY, Lansing TJ, Gilmer TM, Kastan MB. The p53 signal transduction pathway is intact in human neuroblastoma despite cytoplasmic localization. Am J Pathol 1996;148:1381–5. 10. Chen L, Malcolm AJ, Wood KM, Cole M, Variend S, Cullinane C, et al. p53 is nuclear and functional in both undifferentiated and differentiated neuroblastoma. Cell Cycle 2007;6:2685–96. 11. Xue C, Haber M, Flemming C, Marshall GM, Lock RB, MacKenzie KL, et al. p53 determines multidrug sensitivity of childhood neuroblastoma. Cancer Res 2007;67:10351–60. 12. Van Maerken T, Speleman F, Vermeulen J, Lambertz I, De Clercq S, De Smet E, et al. Small-molecule MDM2 antagonists as a new therapy concept for neuroblastoma. Cancer Res 2006;66:9646–55. 13. Van Maerken T, Ferdinande L, Taildeman J, Lambertz I, Yigit N, Vercruysse L, et al. Antitumor activity of the selective MDM2 antagonist nutlin-3 against chemoresistant neuroblastoma with wild-type p53. J Natl Cancer Inst 2009;101:1562–74. 14. Vassilev LT, Vu BT, Graves B, Carvajal D, Podlaski F, Filipovic Z, et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 2004;303:844–8. 15. Lefever S, Vandesompele J, Speleman F, Pattyn F. RTPrimerDB: the portal for real-time PCR primers and probes. Nucleic Acids Res 2009;37:D942–5. 16. Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol 2007;8:R19.




20

17. Goldschneider D, Horvilleur E, Plassa LF, Guillaud-Bataille M, Million K, Wittmer-Dupret E, et al. Expression of C-terminal deleted p53 isoforms in neuroblastoma. Nucleic Acids Res 2006;34:5603–12. 18. Nakamura Y, Ozaki T, Niizuma H, Ohira M, Kamijo T, Nakagawara A. Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line. Biochem Biophys Res Commun 2007;354:892–8. 19. Biedler JL, Roffler-Tarlov S, Schachner M, Freedman LS. Multiple neurotransmitter synthesis by human neuroblastoma cell lines and clones. Cancer Res 1978;38:3751–7. 20. Carr J, Bell E, Pearson AD, Kees UR, Beris H, Lunec J, et al. Increased frequency of aberrations in the p53/MDM2/p14ARF pathway in neuroblastoma cell lines established at relapse. Cancer Res 2006;66:2138–45. 21. Lowe SW, Sherr CJ. Tumor suppression by Ink4a–Arf: progress and puzzles. Curr Opin Genet Dev 2003;13:77–83. 22. Imamura J, Bartram CR, Berthold F, Harms D, Nakamura H, Koeffler HP. Mutation of the p53 gene in neuroblastoma and its relationship with N-myc amplification. Cancer Res 1993;53:4053–8. 23. Komuro H, Hayashi Y, Kawamura M, Hayashi K, Kaneko Y, Kamoshita S, et al. Mutations of the p53 gene are involved in Ewing's sarcomas but not in neuroblastomas. Cancer Res 1993;53:5284–8. 24. Ohgaki H, Eibl RH, Schwab M, Reichel MB, Mariani L, Gehring M, et al. Mutations of the p53 tumor suppressor gene in neoplasms of the human nervous system. Mol Carcinog 1993;8:74–80. 25. Vogan K, Bernstein M, Leclerc JM, Brisson L, Brossard J, Brodeur GM, et al. Absence of p53 gene mutations in primary neuroblastomas. Cancer Res 1993;53:5269–73. 26. Castresana JS, Bello MJ, Rey JA, Nebreda P, Queizan A, Garcia-Miguel P, et al. No TP53 mutations in neuroblastomas detected by PCR-SSCP analysis. Genes Chromosomes Cancer 1994;10:136–8. 27. Hosoi G, Hara J, Okamura T, Osugi Y, Ishihara S, Fukuzawa M, et al. Low frequency of the p53 gene mutations in neuroblastoma. Cancer 1994;73:3087–93. 28. Van Maerken T, Vandesompele J, Rihani A, De Paepe A, Speleman F. Escape from p53-mediated tumor surveillance in neuroblastoma: switching off the p14ARF-MDM2-p53 axis. Cell Death Differ 2009;16:1563–72. 29. Huang Y, Tyler T, Saadatmandi N, Lee C, Borgstrom P, Gjerset RA. Enhanced tumor suppression by a p14ARF/p53 bicistronic adenovirus through increased p53 protein translation and stability. Cancer Res 2003;63:3646–53. 30. Chen D, Kon N, Li M, Zhang W, Qin J, Gu W. ARF-BP1/Mule is a critical mediator of the ARF tumor suppressor. Cell 2005;121:1071–83. 31. Miao L, Song Z, Jin L, Zhu YM, Wen LP, Wu M. ARF antagonizes the ability of Miz-1 to inhibit p53-mediated transactivation. Oncogene 2010;29:711–22. 32. Rocha S, Garrett MD, Campbell KJ, Schumm K, Perkins ND. Regulation of NF-κB and p53 through activation of ATR and Chk1 by the ARF tumour suppressor. Embo J 2005;24:1157–69. 33. Schmitt CA, McCurrach ME, de Stanchina E, Wallace-Brodeur RR, Lowe SW. INK4a/ARF mutations accelerate lymphomagenesis and promote chemoresistance by disabling p53. Genes Dev 1999;13:2670–7. 34. Williams RT, Roussel MF, Sherr CJ. Arf gene loss enhances oncogenicity and limits imatinib response in mouse models of Bcr-Abl-induced acute lymphoblastic leukemia. Proc Natl Acad Sci U S A 2006;103:6688–93. 35. Martins CP, Brown-Swigart L, Evan GI. Modeling the therapeutic efficacy of p53 restoration in tumors. Cell 2006;127:1323–34.




21

36. Brown CJ, Lain S, Verma CS, Fersht AR, Lane DP. Awakening guardian angels: drugging the p53 pathway. Nat Rev Cancer 2009;9:862–73. 37. Jasty R, Lu J, Irwin T, Suchard S, Clarke MF, Castle VP. Role of p53 in the regulation of irradiation-induced apoptosis in neuroblastoma cells. Mol Genet Metab 1998;65:155–64. 38. Tweddle DA, Malcolm AJ, Cole M, Pearson AD, Lunec J. p53 cellular localization and function in neuroblastoma: evidence for defective G1 arrest despite WAF1 induction in MYCN-amplified cells. Am J Pathol 2001;158:2067–77. 39. Van Maerken T, Sarkar D, Speleman F, Dent P, Weiss WA, Fisher PB. Adenovirus-mediated hPNPaseold-35 gene transfer as a therapeutic strategy for neuroblastoma. J Cell Physiol 2009;219:707–15. 40. Mergui X, Leteurtre F, Lipinski M, Benard J, Amor-Gueret M. Two distinctly altered cellular responses to DNA double-strand breaks in human neuroblastoma. Biochimie 2008;90:1656–66. 41. Ross RA, Spengler BA. Human neuroblastoma stem cells. Semin Cancer Biol 2007;17:241–7. 42. Barbieri E, Mehta P, Chen Z, Zhang L, Slack A, Berg S, et al. MDM2 inhibition sensitizes neuroblastoma to chemotherapy-induced apoptotic cell death. Mol Cancer Ther 2006;5:2358–65. 43. Davidoff AM, Pence JC, Shorter NA, Iglehart JD, Marks JR. Expression of p53 in human neuroblastoma- and neuroepithelioma-derived cell lines. Oncogene 1992;7:127–33. 44. Teitz T, Wei T, Liu D, Valentine V, Valentine M, Grenet J, et al. Caspase-9 and Apaf-1 are expressed and functionally active in human neuroblastoma tumor cell lines with 1p36 LOH and amplified MYCN. Oncogene 2002;21:1848–58. 45. Tweddle DA, Malcolm AJ, Bown N, Pearson AD, Lunec J. Evidence for the development of p53 mutations after cytotoxic therapy in a neuroblastoma cell line. Cancer Res 2001;61:8–13.




22

Table 1. Neuroblastoma cell lines with p53 mutation

Cell line p53 mutation* Previous report

LA-N-1 546C>A (C182X)† Yes (43) LA-N-2 1009C>T (R337C) No N-206 529C>A (P177T) No NLF 607G>A (V203M) No NMB 733G>A (G245S) Yes (9) SJNB-8 313-375delGGCAGCTACGGTTTCC

GTCTGGGCTTCTTGCATTCTGGGA CAGCCAAGTCTGTGACTTGCACG

(GSYGFRLGFLHSGTAKSVTCT105-125del)

Yes (44)

SK-N-AS Homozygous deletion of exons 10-11‡ Yes (17, 18) SK-N-BE(2c) 404G>T (C135F) Yes (45) SK-N-FI 737T>G (M246R) Yes (12)

*The other neuroblastoma cell lines in this study were wild-type for p53. †X, termination codon. ‡See Supplementary Fig. S1.




23

Figure legends

Figure 1. Sensitivity of neuroblastoma cells to nutlin-3. A, principle of p53 pathway probing

by determination of the IC50 value of nutlin-3. B, distribution of IC50 values of nutlin-3 in 34

neuroblastoma cell lines according to p53 mutation status. Calculated IC50 values above 32

µM fall outside the range of tested nutlin-3 concentrations and are denoted by dots at 32 µM.

Bars, median IC50 value; solid arrow, SHEP cells; dashed arrow, LA-N-6 cells.

Figure 2. Impairment of the apoptotic response to nutlin-3 in SHEP cells, but not in SK-N-

SH and SH-SY5Y cells. A, effect of nutlin-3 treatment for 24, 48, and 72 h on cell viability.

Bars, SD (n=3). B, caspase-3 and caspase-7 activity after a 24-h exposure to nutlin-3, relative

to a similar amount of viable vehicle-treated cells. Bars, SD (n=3). C, flow cytometric

analysis of the apoptotic sub-G1 fraction after 0 or 8 µM nutlin-3 for 24 h. Bars, SD (n=3). D,

flow cytometric analysis of cell cycle phase distribution after 0 or 8 µM nutlin-3 for 24 h.

Results are derived from the same three experiments as those used for sub-G1 quantification.

E, qRT-PCR analysis of p53 target gene expression after 0 or 8 µM nutlin-3 for 24 h. Bars,

SEM of duplicate wells. F, Western blot analysis of p53, p21WAF1/CIP1, and BAX expression

after 0 or 8 µM nutlin-3 for 24 h. β-actin is shown as loading control.

Figure 3. Transient silencing of CDKN2A decreases the sensitivity of IMR-32 and NGP cells

to nutlin-3. A, qRT-PCR assessment of siRNA-mediated CDKN2A knockdown 24 h

posttransfection, using a primer pair that measures both p14ARF and p16INK4a. Bars, SEM of

duplicate wells. B and C, effect of CDKN2A knockdown on the nutlin-3 response. Cells were

transfected with negative control siRNA or CDKN2A siRNA and subsequently treated with

nutlin-3 for 24, 48, and 72 h, followed by cell viability analysis. Three independent




24

experiments were performed. Dose-response curves at 24 h, derived from a representative

experiment, are shown as an example in B. Bars, SD of duplicate wells. RLU, relative

luminescence units. IC50 ratios at 24, 48, and 72 h, defined as the fold change in the IC50 value

of nutlin-3 after CDKN2A knockdown relative to control transfection and derived from the

three experiments, are shown in C. All IC50 ratios were >1, indicating that CDKN2A silencing

suppresses the response to nutlin-3. Bars, 95% confidence interval (CI).

Figure 4. Stable knockdown of p14ARF attenuates the response of NGP cells to nutlin-3. A,

qRT-PCR analysis of p14ARF and p16INK4a expression in NGP cells transduced with

lentiviruses carrying a negative control shRNA (NGP-LV-luc), an shRNA targeting

simultaneously p14ARF and p16INK4a (NGP-LV-p14/p16), a p14ARF-specific shRNA (NGP-LV-

p14), or a p16INK4a-specific shRNA (NGP-LV-p16). Bars, SEM of duplicate wells. B, IC50

values as determined by cell viability assays at 24, 48, and 72 h of nutlin-3 treatment. Three

independent experiments were performed. Bars, 95% CI. C, EC50 values as determined by

caspase-3 and caspase-7 assays at 24, 48, and 72 h of nutlin-3 treatment. The EC50 value is the

half-maximal effective concentration of nutlin-3 for caspase activation, as defined in the

“Statistical analysis” section. Two independent experiments were performed. Bars, 95% CI.

D, qRT-PCR analysis of p53 target gene expression after 0 or 8 µM nutlin-3 for 24 h. Bars,

SEM of duplicate wells.

Figure 5. Overexpression of p14ARF increases the sensitivity of IMR-5/75 cells to nutlin-3. A,

qRT-PCR measurement of p14ARF and p16INK4a expression in IMR-5/75 cells stably

transfected with a tetracycline-inducible expression vector for a negative control construct

(IMR-Tet-lacZ), p14ARF (IMR-Tet-p14), or p16INK4a (IMR-Tet-p16). Cells were treated with 1

µg/mL tetracycline or vehicle control for 24 h. Bars, SEM of duplicate wells. B, effect of




25

p14ARF and p16INK4a overexpression on the cell viability response to nutlin-3. Cells were

treated with 1 µg/mL tetracycline or vehicle control and subsequently exposed to nutlin-3 for

24, 48, and 72 h, followed by cell viability analysis. IC50 ratios were determined as the fold

change in the IC50 value of nutlin-3 after tetracycline pretreatment compared to vehicle

control. IC50 ratios in IMR-Tet-p14 cells were <1 at all time points, indicating that p14ARF

overexpression increases the sensitivity to nutlin-3. Three independent experiments were

performed. Bars, 95% CI. C, effect of p14ARF and p16INK4a overexpression on the apoptotic

response to nutlin-3. Cells were treated with 1 µg/mL tetracycline or vehicle control and then

exposed to nutlin-3 for 24 h, followed by caspase-3 and caspase-7 analysis. Ratios of caspase-

3 and caspase-7 activity were calculated as the fold change in nutlin-3-induced caspase

activity after tetracycline administration compared to vehicle control. Ratios of caspase-3 and

caspase-7 activity in IMR-Tet-p14 cells were >1 at all nutlin-3 concentrations, indicating that

p14ARF overexpression enhances the apoptotic response to nutlin-3. Three independent

experiments were performed. Bars, 95% CI. D, qRT-PCR analysis of p53 target gene

expression after treatment with 1 µg/mL tetracycline or vehicle control and subsequent

exposure to 0 or 8 µM nutlin-3 for 24 h. Bars, SEM of duplicate wells.



















Published OnlineFirst April 1, 2011.Mol Cancer Ther Tom Van Maerken, Ali Rihani, Daniel Dreidax, et al. using the small-molecule MDM2 antagonist nutlin-3Functional analysis of the p53 pathway in neuroblastoma cells

Updated version

10.1158/1535-7163.MCT-10-1090doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2011/04/07/1535-7163.MCT-10-1090.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/early/2011/04/01/1535-7163.MCT-10-1090To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-10-1090

http://mct.aacrjournals.org/content/suppl/2011/04/07/1535-7163.MCT-10-1090.DC1

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/early/2011/04/01/1535-7163.MCT-10-1090


Documents

Functional analysis of the p53 pathway in neuroblastoma ...mct.aacrjournals.org/content/molcanther/early/2011/04/01/1535-7163... · Functional analysis of the p53 pathway in neuroblastoma