Functional DNA Aptamers as Biotherapeutic Molecules

By

Erik William Orava

A thesis submitted in conformity with the requirements

for the degree of Doctor of Philosophy

Graduate Department of Pharmaceutical Sciences

University of Toronto

© Copyright by Erik William Orava, 2013

II

ABSTRACT

Functional DNA aptamers as biotherapeutic molecules

Erik William Orava

Doctor of Philosophy, 2013

Graduate Department of Pharmaceutical Sciences

University of Toronto

Aptamers are single-stranded oligonucleotides, DNA or RNA, which can bind to a

myriad of targets such as ions, peptides, proteins, drugs, organic and inorganic molecules

with high affinity and specificity. Aptamers are derived using combinatorial libraries

comprised of a variable region flanked by two primer regions used for a process termed

Systematic Evolution of Ligands by Exponential Enrichment (SELEX). The central

theme of my thesis was to use this technology to develop aptamers able to bind to

validated therapeutic targets, specifically the Tumour Necrosis Factor alpha (TNFα) and

Carcinoembryonic Antigen (CEA), and block their biological functions. As well, I

investigated the use of CEA and MUC1 binding aptamers as targeting agents to guide

and detect the delivery of contrast agent-loaded liposomes in tumour-bearing mice using

computed tomography (CT) imaging. Aptamer selections successfully identified a 25-

base aptamer (VR11) that can bind with high affinity and specificity to TNFα. VR11

blocked TNFα signaling, prevented apoptosis, reduced nitric oxide (NO) production in

cultured cells and was non-immunogenic when injected into C57BL/6 mice. As well,

aptamers were derived to the IgV-like N-domain of CEA. Two DNA aptamers were

isolated containing a 40-base variable region, N54 and N56, bearing anti- CEA

homotypic adhesive properties. These aptamers are not cytotoxic or immunogenic and

III

are able to prevent CEA-mediated homotypic and heterotypic cell adhesion events. In

addition, the pretreatment of murine cancer cells expressing CEA with these aptamers

prior to their intraperitoneal injection into C57BL/6 mice resulted in the prevention of

tumour foci formation. Finally, the in vivo targeting of nanoparticles such as pegylated

liposomes to tumour cells was enhanced by introducing tumour marker-specific DNA

aptamers on their surface. The CEA-specific aptamer N54 and a 40-base second

generation aptamer MUC1-VR1 that recognizes the tumour-associated mucin MUC1

were incorporated into liposomes containing the CT contrast agent Omnipaque350™ and

Cy5 to characterize their binding to CEA and MUC1-expressing cancer cells in vitro.

Pharmacokinetic studies also revealed that the incorporation of these aptamers into

pegylated liposomes significantly lenghthened their circulation half-lives to values that

parrallel that of untargeted pegylated liposomes.

IV

ACKNOWLEDGEMENTS

I would like to express my sincerest and deepest appreciation to Dr. Jean Gariépy for the

opportunity to work and study in his laboratory. I am particularly grateful for his

unwavering encouragement, support direction and persistent guidance over the 5 past

years. Without his motivation, creativity and assistance my reports, abstracts, patent

applications, manuscripts and this dissertation would not have been possible.

I would like to thank my committee members, Dr. Christine Allen, Dr. Robert

Macgregor, and Dr. Sachdev Sidhu for their time and expertise in supporting my graduate

studies. Their engagement and advice contributed greatly to the success I achieved

during my studies. I would like to acknowledge Dr. Chrstine Allen and former student

Mike Dunne and Huang Huang for their assistance in our CIHR Biotherapeutics

collaboration, Dr. Sachdev Sidhu and his lab member Nick Jarvik for their help with

surface plasmon resonance experiments as well as Dr. Robert Macgregor and Yuen Shek

for their advice and technical assistance for circular dichroism experiments.

In addition I would extend my greatest appreciation for my current lab members:

Arshiya, Aws, Amirul, Cailtin, Eric, Linda, Marzena, Nick, Nora and former lab

members: Andrew and Wei. A special thanks to Dr. Aws Abdul-Wahid for challenging me

and engaging in critical discussions that was instrumental in the development of CEA

aptamers. I wish everyone the best as they continue to pursue their future studies and

career paths.

This research would not have been possible without the financial assistance from

the Department of Pharmaceutical Sciences in the form of awards, bursaries and

scholarships, particularly the studentship award from the CIHR strategic training

V

program in biological therapeutics.

Lastly, I would like to thank Sarah and my family for their constant love and

support. I could not have pursued and accomplished my goals and attained my education

without them.

VI

Table of Contents

ABSTRACT................................................................................................................... II

ACKNOWLEDGEMENTS ........................................................................................ IV

LIST OF ABBREVIATIONS ...................................................................................... IX

LIST OF TABLES .................................................................................................... XIII

LIST OF FIGURES .................................................................................................. XIV

Chapter 1 : Introduction ....................................................................................................... 1

1.1. Aptamers as therapeutics ................................................................................... 2

1.1.1. The SELEX procedure: A rapid strategy to identify short single strand

synthetic oligonucleotides (aptamers) that recognize specific targets ......................... 3

1.1.2. Cell-SELEX ................................................................................................... 7

1.1.3. RNA versus DNA aptamers .......................................................................... 8

1.1. Aptamers as Inhibitors ....................................................................................... 9

1.2.1. The role of TNFα in disease progression ..................................................... 12

1.2.2. Inflammation and TNFα .............................................................................. 12

1.2.3. TNFα as a therapeutic target ........................................................................ 15

1.2. Aptamers can serve as intracellular delivery vehicles via their binding to

known cancer-associated surface antigens ................................................................ 15

1.3.1. CD33 ............................................................................................................ 18

1.3.2. Carcinoembryonic antigen (CEA) ............................................................... 21

1.3.3. CA15-3 antigen, MUC1 peptides and Tn antigens ...................................... 24

1.3. Aptamer-guided delivery of payloads into cancer cells ................................. 26

1.4.1. Aptamer-drug conjugates............................................................................. 28

1.4.2. Aptamer-protein conjugates......................................................................... 28

1.4.3. Aptamer-radionuclide conjugates ................................................................ 29

1.4.4. Aptamer-nanostructure conjugates .............................................................. 30

1.4.5. Challenges facing the in vivo use of aptamers ............................................ 32

1.4. Thesis Hypotheses ............................................................................................. 36

1.5. Specific Aims ...................................................................................................... 37

1.6. Chapter Overviews ........................................................................................... 38

Chapter 2 ............................................................................................................................ 39

2.1. Abstract .............................................................................................................. 40

2.2. Introduction ....................................................................................................... 41

2.1. Materials and Methods ..................................................................................... 43

2.3.1. Expression and purification of human TNFα. ............................................. 43

2.3.2. Aptamer selection screens. .......................................................................... 44

2.3.3. Aptamer-based enzyme linked binding assay.............................................. 45

2.3.4. NF-κB luciferase reporter assay. ................................................................. 45

2.3.5. Inhibition of TNFα induced cytotoxicity. .................................................... 46

VII

2.3.6. Surface plasmon resonance.......................................................................... 46

2.3.7. Determination of aptamer concentration and Circular Dichroism

Spectroscopy. ............................................................................................................. 47

2.3.8. Inhibition of TNFα induced NO production in macrophages. ..................... 48

2.3.9. Analysis of VR11 ability to activate an innate immune response. .............. 48

2.4. Results and Discussion ...................................................................................... 49

2.4.1. Identification of DNA aptamers directed at TNFα. ..................................... 49

2.4.2. DNA aptamer VR11 inhibits the binding of TNFα to its receptor. ............. 54

2.4.3. Structural features of DNA aptamer VR11. ................................................ 60

2.4.4. Immunogenicity of DNA aptamer VR11. ................................................... 64

Chapter 3 ............................................................................................................................ 66

Blocking the attachment of cancer cells in vivo with DNA aptamers displaying anti-

adhesive properties against the carcinoembryonic antigen ......................................... 66

3.0. Abstract .............................................................................................................. 67

3.1. Introduction ....................................................................................................... 68

3.2. Materials and Methods ..................................................................................... 71

3.2.1. Generation of recombinant CEA modules ................................................... 71

3.2.2. Aptamer selection and cloning .................................................................... 71

3.2.3. Aptamer-based inhibition of CEA homotypic interactions ......................... 72

3.2.4. Cells lines and growth conditions ................................................................ 73

3.2.5. Aptamer-based inhibition of homophilic cellular adhesion......................... 73

3.2.6. Aptamer binding to CEA on cells as measured by flow cytometry ............ 74

3.2.7. Inhibition of MC38.CEA tumour implantation ........................................... 75

3.2.8. Aptamer cytotoxicity assay.......................................................................... 75

3.2.9. Analysis of aptamer-based innate immune responses ................................. 76

3.2.10. Statistical methods and data analysis ........................................................... 76

3.3. Results ................................................................................................................ 77

3.3.1. Generation of DNA aptamers displaying inhibitory properties of CEA-

dependent homotypic adhesions ................................................................................. 77

3.3.2. Aptamers N54 and N56 inhibit homophilic cellular adhesion .................... 79

3.3.3. Aptamers N54 and N56 specifically recognize the N domain of CEA ....... 83

3.3.4. Addition of aptamers N54 and N56 to MC38.CEA cells reduces tumour

implantation in vivo ..................................................................................... 86

3.3.5. Aptamers specific to the CEA N domain are not cytotoxic and aptamer

N54 does not activate an innate immune response ...................................... 89

3.4. Discussion ........................................................................................................... 91

Chapter 4 ............................................................................................................................ 97

4.0. Abstract .............................................................................................................. 98

4.1. Introduction ....................................................................................................... 99

4.2. Materials and Methods ................................................................................... 103

4.2.1. MUC1 expression, purification and glycosylation .................................... 103

4.2.2. Identification of MUC1 binding aptamers using the SELEX process ....... 104

4.2.3. MUC1 Aptamer binding and internalization ............................................. 105

4.2.4. Binding kinetics of MUC1 aptamers determined by surface plasmon

resonance ................................................................................................... 105

VIII

4.2.5. Synthesis of Aptamer-PEG2000-DSPE conjugates ..................................... 106

4.2.6. Liposome preparation ................................................................................ 107

4.2.7. Efficiency of aptamer-DSPE-PEG insertion into liposomes ..................... 108

4.2.8. Aptamer-liposome characterization in vitro .............................................. 108

4.2.9. Physio-chemical characterization of aptamer-liposome formulations ...... 109

4.2.10. Aptamer-liposome pharmacokinetic profile .............................................. 110

4.2.11. Statistical methods and data analysis ......................................................... 110

4.3. Results .............................................................................................................. 111

4.3.1. Identification and characterization of MUC1-VR1, a MUC1-binding

aptamer ...................................................................................................... 111

4.3.2. Optimization of MUC1-VR1 and N54 aptamer-targeted liposomes ........ 114

4.3.3. Aptamer-Liposome internalization in MDA-MB-231 cells ...................... 117

4.3.4. Aptamer-Liposome physicochemical properties and stability in vivo ....... 119

4.4. Discussion ......................................................................................................... 120

Chapter 5 .......................................................................................................................... 124

5.1. Thesis Conclusions .......................................................................................... 125

5.2. Future Directions ............................................................................................ 127

5.2.1. Modification of aptamer VR11 for in vivo ................................................ 127

5.2.2. Determine the ability of aptamer N54 as a detection and targeting agent . 128

5.2.3. Determine the ability of MUC1 and CEA aptamer to target liposomes .... 128

References ................................................................................................................... 142

IX

LIST OF ABBREVIATIONS

99mTC Technetium-99m

ADCC antibody-dependent cell cytotoxicity

ALL acute lymphoblastic leukemia

AMD age-related macular degeneration

AML acute myeloid leukemia

BCL2 B-cell leukemia/lymphoma 2

BSA bovine serum albumin

C6 six carbon spacer

cApt control aptamer

CD circular dichroism

CD50 median curative dose

CDC complement-dependent cytotoxicity

CEA carcinoembryonic antigen

CEACAM carcinoembryonic antigen cell adhesion molecule

CH cholesterol

CI cell index

CT computed tomography

CTLA-4 cytotoxic T-cell antigen-4

Cy5 cyanine-5

DLS dynamic light scattering

DMARDs disease-modifying antirheumatic drugs

X

DMEM dulbecco’s modified eagle’s medium

DMSO Dimethyl sulfoxide

DPPC dipalmitoylphosphatidylcholine

DR5 death receptor 5

DSPE distearoyl-phosphatidyl ethanolamine

EDTA Ethylenediaminetetraacetic acid

ELISA enzyme-linked immunosorbent assay

EPR enhanced permeability and retention effect

FBS fetal bovine serum

FDA food and drug administration

FITC fluorescein isothiocyanate

FL full length

GPI glycosylphosphatidyl inositol

H3PO4 phosphoric acid

HBS hank’s buffered saline

HER2 human epidermal growth factor receptor 2

HER3 human epidermal growth factor receptor 3

hNE human neutrophil elastase

HPLC High performance liquid chromatography

HRP horseradish peroxidase

i.p. intraperitoneal

IFN-γ interferon-gamma

IgG immunoglobulin G

IgV Immunoglobulin variable

XI

IL-8 Interleukin 8

IPTG isopropyl β-D-thiogalactopyranoside

ka association rate

KCl potassium chloride

kD kilo dalton

KD dissociation constant

kd dissociation rate

KOH potassium hydroxide

LNA locked nucleic acid

LPS lipopolysaccharides

mAb monoclonal antibody

MAG2 mercapto-acetyl diglycine

MFI mean fluorescence intensity

MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenylttetrazolium bromide

MUC1 mucin 1

MWCO molecular weight cut off

NaCl Sodium chloride

NaOH sodium hydroxide

NF-κB nuclear factor kappa-light-chain-enhancer of activated B cells

Ni-NTA nickel-nitrilotriacetic acid

NO nitric oxide

NO2- nitrite ion

ODN oligodeoxynucleotide

OH hydroxide

XII

PBS phosphate buffered saline

PCR polymerase chain reaction

PEG polyethylene glycol

PLGA poly(lactic-co-glycolic acid)

PLK1 polo-like kinase 1

PSMA prostate-specific membrane antigen

PTK7 protein tyrosine kinase 7

RNA ribonucleic acid

SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis

SELEX systematic evolution of ligands by exponential enrichment

SPR surface plasmon resonance

SRB sulphorhodamine B

ssDNA single stranded deoxyribonucleic acid

TLR9 toll-like receptor 9

TMB 3,3’,5,5’-tetramethylbenzidine

TNFα tumour necrosis factor alpha

TNFβ tumour necrosis factor beta

VEGF vascular endothelial growth factor

VEGF vascular endothelial growth factor

VR variable region

α5β1 alpha-5-beta-1

β-gal beta-galactosidase

XIII

LIST OF TABLES

Table 1.1. Aptamers to targets of therapeutics interest ................................................... 10

Table 1.2. Advantages and limitations of aptamers versus antibodies. ............................ 11

Table 1.3. Examples of aptamers and their cargoes directed at internalized surface

markers on cancer cells ..................................................................................................... 17

Table 2.1. List of TNFα specific DNA aptamer sequences identified from the SELEX

screen as well as control aptamer [cApt(VR) and cApt(FL)] sequences used in the

present study. .................................................................................................................... 51

Table 4.1. Pharmacokinetics of different Omnipaque encapsulated non-targeted and

aptamer targeted liposome preparations in CD1 mice (n=5 per group). ........................ 119

XIV

LIST OF FIGURES

Figure 1.1. Isolation of aptamers using the SELEX procedure.. ........................................ 4

Figure 1.2. Overlapped crystal structures of a RNA and a DNA aptamer bound to the

protein thrombin.. ............................................................................................................... 6

Figure 1.3. Crystal structure of TNF alpha trimer created from the Protein Data Bank.. 14

Figure 1.4. A CD33-specific DNA aptamer binds to and is internalized by CD33+

myeloid leukemia cell lines.. ............................................................................................ 20

Figure 1.5. A CEA-specific DNA aptamer binds to and is imported into colon carcinoma

cells expressing human CEA.. .......................................................................................... 23

Figure 1.6. Proposed mechanisms of cellular entry and recycling of DNA aptamers

directed at aberrantly glycosylated mucin MUC1 present on the surface of epithelial

cancer cells........................................................................................................................ 25

Figure 1.7. Possible endocytic pathways taken by aptamer-cargoes.. .............................. 27

Figure 2.1. Binding of selected full-length (FL) and variable region (VR) DNA aptamers

to TNF and NfκB assays identify FL11 and VR11 as TNF inhibitors. ....................... 53

Figure 2.2. Aptamer VR11 inhibits TNF-induced cytotoxicity in murine fibroblasts. .. 55

Figure 2.3. Binding kinetics of TNF to aptamers VR11 and VR20 as determined by

surface plasmon resonance. .............................................................................................. 57

Figure 2.4. Inhibition of TNF-induced NO2- production in macrophages. ................... 59

Figure 2.5. Structural analysis of aptamers VR11 and VR20 by Circular Dichroism. ..... 63

Figure 2.6. Aptamer VR11 does not cause an innate immune response in vivo. ............. 65

Figure 3.1. Aptamers selected to bind to the CEA IgV-like N domain inhibit homotypic

adhesion events. ................................................................................................................ 78

Figure 3.2. Addition of aptamers specific to the CEA N domain inhibits homophilic

cellular adhesion. .............................................................................................................. 80

Figure 3.3. Minimal regions required for aptamer inhibition of homophilic cellular

adhesion. ........................................................................................................................... 82

Figure 3.4. Alignment of the IgV-like N-domains of CEACAM family members. ......... 84

Figure 3.5. Aptamer binding to CEA+ and CEA- cells using Cy5 labelled aptamers by

flow cytometry. ................................................................................................................ 85

Figure 3.6. Pre-treatment of CEA-expressing MC38.CEA cancer cells with CEA-specific

XV

aptamers reduces tumour implantation in vivo. ............................................................... 88

Figure 3.7. Aptamer N54 is noncytotoxic and does not activate innate immune responses.

. ......................................................................................................................................... 90

Figure 4.1. Proposed action of aptamer targeted liposomes accumulating at the site of the

tumour by virtue of the Enhanced permeability and Retention (EPR) effect and

internalzing into cells. ..................................................................................................... 102

Figure 4.2. Identification of MUC1-specific DNA aptamers and the ability of MUC1+

MDA-MB-231 cells to internalize FITC-labeled aptamer MUC1-VR1. ..................... 1133

Figure 4.3. Liposome internalization into CEA+/MUC1+ MDA-MB-231 cells is

dependent on the number of DNA aptamers present on the surface of liposomes. ........ 116

Figure 4.4. Binding and internalization of targeted liposome formulations in vitro. ..... 118

1

Chapter 1 : Introduction

A version of this chapter has been previously published:

Delivering cargoes into cancer cells using DNA aptamers targeting internalized

surface portals (Biochim Biophys Acta. 2010 Dec;1798(12):2190-200)

Erik W. Orava, Nenad Cicmil and Jean Gariépy

Author Contributions:

Erik Orava and Dr. Jean Gariépy wrote the review

Erik Orava contributed to Tables 1.3 and Figures 1.4.,1.5. and 1.6.

Nenad Cicmil contributed to Figures 1.2., 1.3. and 1.7.

2

1.1. Aptamers as therapeutics

Many classes of oligonucleotides such as siRNAs, microRNAs and antisense

oligonucleotides represent potential therapeutic agents in view of their ability to

selectively block the expression or transcription of genes and mRNAs inside diseased

cells. Unfortunately, their anionic character makes them cell-impermeant and thus will

not reach their intracellular targets unless they are conjugated or complexed to a cell-

penetrating peptide, a polymeric vector, a protein ligand (hormones, cytokines,

monoclonal antibodies), a nanoparticle or a liposome favoring their import into cells or

are delivered using a viral vector. A more recent and potentially simpler solution to this

challenge is to derive short synthetic oligonucleotides known as DNA and RNA aptamers

which themselves specifically bind to internalized surface markers (cellular portals) and

thus can act as delivery vehicles for therapeutic oligonucleotides and other therapeutic

cargoes. As well, these aptamers can be generated to bind to validated therapeutic targets

and act as antagonists (Keefe et al., 2010). Although in its infancy, the field of aptamer

development for therapeutic and diagnostic purposes is rapidly growing and their utility

is becoming even more evident (Soontornworajit and Wang, 2011; Yang et al., 2011)

3

1.1.1. The SELEX procedure: A rapid strategy to identify short single strand

synthetic oligonucleotides (aptamers) that recognize specific targets

Cancer cells typically harbor multiple oncogenic mutations leading to the aberrant

display and/or overexpression of molecular signatures on their surface. Classical

approaches to target such signatures have made use of peptides, proteins and mainly

antibodies. However, recent studies suggest that oligonucleotides known as aptamers can

be utilized in the same capacity. Aptamers are short single-stranded nucleic acid

oligomers (ssDNA or RNA) that can form specific and complex three-dimensional

structures which can bind with high affinity to specific targets. The term ‘aptamer’ is

derived from the Latin word aptus meaning “to fit” (Ellington and Szostak, 1990). Two

groups reported a PCR-based strategy termed SELEX (an acronym for Systematic

Evolution of Ligands by EXponential enrichment; (Tuerk and Gold, 1990)) to derive

aptamers that specifically recognized targets ranging from small molecules to large

proteins (Figure 1.1). SELEX is an iterative panning procedure where combinatorial

libraries composed of a random oligonucleotide element flanked by constant primer

regions are allowed to bind to an immobilized target. The bound oligonucleotides are

then recovered and amplified by PCR to generate a sub-library of aptamers able to

recognize a given target. The binding/amplification cycle is then repeated several times

on enriched pools of aptamers until one recovers ssDNA or RNA aptamers displaying

Kds in the nanomolar to picomolar range for their respective targets. So far, thrombin

represents the only protein that does not normally bind nucleic acids and for which

crystals structures of its complexes with aptamers have been obtained (Long et al., 2008;

Padmanabhan et al., 1993). Interestingly, the two available structures (thrombin

complexed to a DNA and a RNA aptamer) indicate that each aptamer binds to a distinct

4

Figure 1.1. Isolation of aptamers using the SELEX procedure. A combinatorial library of

DNA oligonucleotides is chemically synthesized using standard solid phase methods. The library

is composed of a random oligonucleotide element sequence (typically 20 to 50 nucleotides in

length) flanked by two distinct constant sequences for the subsequent enrichment of target-

binding library elements by PCR. The synthetic DNA oligonucleotide pool is directly mixed with

the immobilized target for the purpose of retaining bound DNA aptamers (step 1). In the case of

an RNA aptamer selection, a random library of RNA aptamers is initially derived from a double

stranded DNA library by in vitro transcription, in which case the 5' constant sequence includes a

T7 promoter region. Aptamers in each library will adopt different three-dimensional structures

based on their random sequence element with some oligonucleotides able to bind to a target

immobilized on beads or other solid supports (step 1). The crystal structure of a thrombin-binding

RNA aptamer (Padmanabhan et al., 1993) is displayed (center) to emphasize the presence of

bulges and hairpins in such structures. Following a washing step (step 2), the bound

oligonucleotides are eluted from the solid support (step 3) and amplified by PCR using the

constant flanking sequences acting as primer sites (step 4). The selection cycle is repeated (step

5) typically 10-15 times with increasing stringency (lower target concentration for example) until

tight-binding aptamers for a given target are identified, sequenced and synthesized for subsequent

5

analyses.

region on the protein located on opposite sides of each other on the molecule (Figure

1.2). This finding suggests that the process of identifying aptamers using the SELEX

procedure does not necessarily favor a unique epitope on a given target. Specifically, the

DNA aptamer was shown to contact a region of thrombin that normally binds to

fibrinogen (exosite 1), while the RNA aptamer binds to a domain associated with heparin

binding (exosite 2)(Sheehan and Sadler, 1994). Interactions between these aptamers and

thrombin are mostly electrostatic since both of the exosites are positively charged

interfaces (Bode et al., 1992; Padmanabhan et al., 1993; Sheehan and Sadler, 1994).

These structural features highlight the fact that aptamers may recognize these targets

mostly through electrostatic interactions in contrast to dominant hydrophobic interactions

typically observed in protein-protein interactions. It also suggests that the number of

surface elements on a given target that could serve as recognized interfaces for aptamers

is finite and potentially predictable.

6

Figure 1.2. Overlapped crystal structures of a RNA and a DNA aptamer bound to

the protein thrombin (Long et al., 2008; Padmanabhan et al., 1993). The SELEX

process has identified aptamers that interact with two distinct sites on thrombin (grey-

colored contour surface). The 25-nucleotide long RNA aptamer Toggle-25t [purple, top]

was found to bind near exosite 2 (heparin-binding site on thrombin) while the 15-base

long DNA aptamer [blue, bottom] bound near the thrombin exosite 1 (fibrinogen-binding

domain). Both interacting interfaces on thrombin displayed positively charged surfaces.

7

1.1.2. Cell-SELEX

Aptamers can be selected against recombinant forms of surface markers and still

recognize the native forms on cells. Most notably are the aptamers to the MUC1 peptide,

the extracellular domain of prostate-specific membrane antigen (PSMA), cell adhesion

molecule P-selectin and protein tyrosine phosphotase 1B (PTP1B) (Ferreira et al., 2009;

Gutsaeva et al., 2011; Lupold et al., 2002; Townshend et al., 2010). However, the

recombinant form of proteins can be different in a physiological context resulting in a

loss of aptamer binding. A case in point is the RNA aptamers to the EGFRvIII

ectodomain which bound with high affinity in vitro however showed no binding to this

target displayed on cells (Liu et al., 2009b). A process termed Cell-SELEX (also called

Whole-Cell SELEX and cell-based SELEX) was recently devised to prevent the selection

of aptamers to protein targets lacking their native conformation in vitro (Ohuchi et al.,

2005; Zhang et al., 2010).

Established SELEX techniques required the immobilization of a protein or target

on an affinity sorbent such as beads, resins, membranes, columns or plates. Washing

steps, altering buffer solutions and reducing the amount of target represent SELEX

stringencies that can remove DNA aptamer species that non-specifically associate with a

given target from the selected pool of aptamers. In the Cell-SELEX procedure, non-

specific species are removed by including a counter selection stage using cells that do not

express any of the markers of interest. This step allows for a pool of aptamers to be

generated that most likely recognize unique surface markers on the cell line of interest

and possibly unkown or uncharacterized surface markers. A case in point is Cell-SELEX

derived aptamers that were able to distinguish between rat glioblastoma and microglial

cells (Blank et al., 2001). This approach may prove useful to derive aptamers as

8

biosensors to detect and discern populations of cells as well as deliver therapeutic cargos

into cells.

1.1.3. RNA versus DNA aptamers

A large number of RNA aptamers have now been reported against different targets. The

versatility of RNA molecules as functional ligands is well documented in regards to the

frequent occurrence of modified nucleotides within their structure, their base pairing

properties and their tendency to form intricate three-dimensional structures (Maas, 2011).

For instance, all natural riboswitches (which bind to small molecules) are RNA

molecules (Wakeman et al., 2007). The derivation and use of RNA aptamers does present

some important practical challenges. For instance, the SELEX process requires the

synthesis of random oligonucleotide libraries and the chemical synthesis of random RNA

oligonucleotide pools remains expensive. Therefore, an in vitro transcription step is

introduced in the SELEX procedure to obtain the initial RNA pool. Secondly, RNA

oligonucleotides are more susceptible to hydrolysis than their DNA counterparts and thus

their manipulation requires RNAse-free conditions.

DNA tertiary structures have been observed in nature (Chou et al., 2003). These

structures, rich in guanine, are found in telomeres and promoter regions (Neidle and

Parkinson, 2003; Siddiqui-Jain et al., 2002). Guanine-rich sequences form various G-

quadruplexes that appear to be major structural elements found in DNA aptamers as

exemplified in the thrombin DNA aptamer (Figure 1.2). Examples of DNA aptamers

have been reported and include an anti-HIV aptamer (Phan et al., 2005) and the anti-

nucleolin aptamer AS1411(Teng et al., 2007). Catalytically-active DNA aptamers have

also been derived using the SELEX approach (Liu et al., 2009a; Silverman, 2009). The

9

selection procedure for DNA aptamers is simpler than for RNA aptamers. Specifically,

inexpensive pools (libraries) of DNA oligonucleotides can be chemically synthesized and

contain only single stranded sequences as opposed to the initial double stranded pool of

DNA sequences required for the in vitro transcription step used for RNA-based aptamer

selection. Furthermore, reverse transcription is not required and an asymmetric PCR step

is sufficient to recover the sub-library of ligand-binding aptamers needed to proceed to

the next round of selection. In summary, the advantages of DNA aptamers stem from the

simpler enrichment procedure involved and the lower cost and stability of the final

aptamers while the benefit of selecting for RNA aptamers is the higher level of structural

diversity possible with RNA templates.

1.1. Aptamers as Inhibitors

In theory, aptamers that function as inhibitors in blocking a given protein from

interacting with another protein, receptor or ligand can be identified for the purpose of

treating any disease. Thus, disease-promoting or persisting protein-protein and protein-

ligand interactions can be disrupted (White et al., 2000). Most of the aptamers already

developed as inhibitors tend to act as antagonists in blocking proteins to their receptors.

Although there have been reports of aptamers that can acts as agonists, namely to HER3

and isoleucyl tRNA synthetase, these aptamers have not yet proved to have any clinical

or therapeutic advantage (Chen et al., 2003; Hale and Schimmel, 1996). Since the

invention of the SELEX process in the early 1990’s, researchers have been able to

identify aptamers that bind to currently validated therapeutic targets (Table 1.1). As well,

modifications of the SELEX approach have been reported that allow for the selection of

aptamers with higher affinities (by decreasing off-rates) which would allow the aptamers

10

to be bound to their targers and in the case of inhibitors, provide a prolonged blockage

(Keefe and Cload, 2008). Aptamers also possess considerable advantages to their

antibody counterparts with some of their limitations being overcome such as synthesis

costs and the optimization of protocols for their chemical modifications (Table 1.2).

Table 1.1. Aptamers to targets of therapeutics interest (Keefe et al., 2010).

11

Table 1.2. Advantages and limitations of aptamers versus antibodies (Keefe et al., 2010).

12

1.2.1. The role of TNFα in disease progression

Despite the importance of immune responses in controlling infections, it is now clear that

uncontrolled reactions for such responses are intimately associated with degenerative

diseases such as atherosclerosis, arthritis, encephalitis, and tumours (Feldmann et al.,

2005). The primary pro-inflammatory cytokine, tumour necrosis factor alpha (TNFα)

plays a critical regulatory role in enhancing these responses (Borish and Steinke, 2003)

In the past decade, disease modifying antirheumatic drugs (DMARDs) that target

underlying immune responses processes have improved treatment outcomes in patients

with chronic immune response disorders. Anti-TNF antibody-based therapies represent

the dominant categories of DMARDs (Feldmann et al., 1998; Maini et al., 1993). These

protein therapeutics remain expensive to produce and ~40% of patients still display

moderate to high levels of disease activity after treatment, suggesting a substantial need

for improved therapies (Mierau et al., 2007).

1.2.2. Inflammation and TNFα

While the cause of many chronic inflammatory diseases remains unknown, most are

characterized by dysregulation of cytokine networks, which often leads to the

overproduction of proinflammatory cytokines, causing a perturbation in the equilibrium

between pro- and anti-inflammatory cytokines (Feldmann et al., 2005). At the apex of

this cytokine network is the Tumour necrosis factor alpha (TNFα), which acts as a

primary trigger for the inflammatory response by promoting the synthesis of other

proinflammatory cytokines (Borish and Steinke, 2003; van den Berg, 2001). TNFα was

first identified for its ability to induce rapid haemorrhagic necrosis of experimental

cancers (Carswell et al., 1975). TNFα is a type 2 transmembrane protein with an

13

intracellular amino terminus. It is produced by many cell types, including macrophages,

monocytes, lymphocytes, keratinocytes and fibroblasts, in response to inflammation,

infection, injury and other environmental challenges. It is synthesized as a 26-kD

membrane bound protein (pro-TNFα) that is cleaved to release a soluble 17-kD TNFα

molecule. TNFα has the ability to signal as a membrane bound protein and the soluble

form is only active as a non-covalently associated homotrimer (Figure 1.3) (Hehlgans

and Pfeffer, 2005; Locksley et al., 2001). Sufficient levels of TNFα as well as other

mediators are critical for sustaining normal immune responses (Ehlers, 2005; Furst et al.,

2006; Wallis and Ehlers, 2005). TNFα can initiate host defence at the site of a local

injury but its sustained presence can also cause acute and chronic tissue damage (Beutler,

1999). Elevated levels of TNFα have been detected in patients with rheumatoid arthritis

(RA), psoriasis and Crohn’s disease (Komatsu et al., 2001; Mussi et al., 1997; Robak et

al., 1998). The evidence for the effects of sustained production of TNFα in inflammatory

and autoimmune diseases sparked investigations to develop TNFα antagonists as anti

inflammatory agents (Brennan et al., 1989; Feldmann et al., 1992).

14

Figure 1.3. Crystal structure of TNF alpha trimer created from the Protein Data

Bank (PDB: 1TNF). Each colour represents a monomer. It is believed that the

highlighted area is responsible for binding to its receptors.

15

1.2.3. TNFα as a therapeutic target

The need for new therapies for the treatment of inflammatory diseases has arisen during

an era where clinicians have realized that chronic inflammatory conditions are far more

ominous than was previously thought. Inhibition of TNFα alone has been shown to

downregulate the proinflammatory cascade leading to two findings: the discovery of an

inter-linkage between different cytokines and the ability of one cytokine to orchestrate

inflammation (Feldmann et al., 2001). It was realized by the mid 1990’s that inhibitors

of TNFα would be successful therapeutic agents for a range of human chronic

inflammatory diseases (Feldmann and Maini, 2008). Although pro-inflammatory

cytokines aid in protecting the host against infectious agents, anti-TNFα protein

therapeutics can reduce systemic and local inflammation in patients with rheumatoid

arthritis (RA), psoriasis and Crohn’s disease. As of 2012, the global market for anti-

TNFα protein therapeutics was valued at US$26.5 billion with Humira, Remicade and

Enbrel representing the top 3 selling drugs in the world (2012).

1.2. Aptamers can serve as intracellular delivery vehicles via their binding to

known cancer-associated surface antigens

The main purpose of this review is to highlight the potential of membrane-impermeant

oligonucleotides to serve as intracellular delivery agents if they can be engineered to

target internalized surface markers on cancer cells. The best described surface

determinant used for this purpose (Table 1.3) has been the prostate-specific membrane

antigen (PSMA), a membrane protein overexpressed on the surface of prostate cancer

cells. PSMA is internalized by such cells via clathrin-coated pits (Chang et al., 1999; Liu

et al., 1998; Lupold et al., 2002; Ross et al., 2003). From a drug delivery perspective,

16

antibody studies have shown that the rate of PSMA internalization was promoted by the

binding of an antibody to its extracellular domain (Liu et al., 1998). The PSMA antigen is

also differentially expressed on prostate cancer cells with normal prostate cells

displaying an alternatively spliced cytosolic form of the protein while malignant cells

express the full length surface protein (Su et al., 1995). The extracellular domain of

PSMA served as a target for developing the first RNA aptamers known to bind a tumour-

associated antigen (Lupold et al., 2002). The selective delivery and uptake properties of

such aptamers by prostate cancer cells led to the subsequent design of an RNA chimera

incorporating a PSMA-specific aptamer (delivery vehicle) and a therapeutic siRNA that

targets Polo-like kinase 1 (PLK1) and BCL2. This RNA aptamer-siRNA construct was

shown to cause tumour regression in a xenograft model of prostate cancer (McNamara et

al., 2006). These findings suggested that by choosing appropriate internalized surface

markers on cancer cells, one may be able to develop aptamers that can serve as both cell

targeting agents and intracellular delivery vehicles. We will now focus our discussion on

recent evidence from our laboratory suggesting that DNA aptamers can indeed be

generated against membrane-bound tumour markers that are recycled inside cells.

17

Table 1.3. Examples of aptamers and their cargoes directed at internalized surface

markers on cancer cells

Reference Aptamer Internalized Target Cargoes (Tong et al., 2009) sgc8c PTK7 Viral capsid Drugs (Bagalkot et al., 2006) A10 PSMA Doxorubicin (Huang et al., 2009) sgc8c PTK7 Doxorubicin (Ferreira et al., 2009) 5TR1 MUC1 tandem

repeat

Chlorin e6

(Ferreira et al., 2009) 5TRG2 Tn antigen Chlorin e6 (Ferreira et al., 2009) GalNAc3 N-

acetylgalactosamine

Chlorin e6

Toxins (Chu et al., 2006a) A9 PSMA Gelonin Nanostructures (Huang et al., 2008) sgc8c PTK7 Nanorod (Cheng et al., 2007; Dhar et

al., 2008; Farokhzad et al.,

2006; Farokhzad et al.,

2004; Zhang et al., 2007)

A10 PSMA Nanoparticle

(Cao et al., 2009) AS1411 Nucleolin Nanoparticle (Chu et al., 2006b) A9 PSMA Quantum dot (Bagalkot et al., 2007) A10 PSMA Quantum dot -

doxorubicin Radioisotopes (Hicke et al., 2006) TTA1 Tenascin-C

99mTC

18

1.3.1. CD33

The CD33 antigen is a 67-kDa type 1 transmembrane glycoprotein that belongs to the

superfamily of sialic acid-binding immunoglobulin-related lectins (siglecs; siglec-3)

(Freeman et al., 1995). CD33 is expressed on early multilineage hematopoietic

progenitors, myelomonocytic precursors, as well as more mature myeloid cells,

monocytes, macrophages and dendritic cells (Andrews et al., 1986; Andrews et al., 1983;

Griffin et al., 1984). Most adult and pediatric acute myeloid leukemia (AML) cases as

well as 15–25% of acute lymphoblastic leukemia (ALL) cases are CD33-positive

(Dinndorf et al., 1986; Putti et al., 1998; Scheinberg et al., 1989; Terstappen et al., 1992).

The presence of CD33 on AML blasts has led to the development of monoclonal

antibody treatments that have been approved for AML patients that have relapsed. One of

these anti-CD33 antibodies was conjugated to calicheamicin, a potent cytotoxic antibiotic

that cleaves double-stranded DNA at unique sites. The resulting antibody-drug conjugate

is commonly known as Gemtuzumab ozogamicin or Mylotarg (Wyeth Laboratories, PA,

USA) (Bernstein, 2000; Hamann et al., 2002). Antibody-bound CD33 has been shown to

be rapidly internalized by myeloid cells, a process that is largely modulated by its

cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (van der Velden et al.,

2004; Walter et al., 2005). A 26% response rate has been observed for AML patients

treated in first relapse with gemtuzumab ozogamicin as a monotherapy with a median

disease-free-survival of 6·4 months in patients achieving complete remission

(Tsimberidou et al., 2006). Surprisingly, there is no major loss of surface CD33

expression on leukemic blasts at relapse after Gemtuzumab treatment suggesting that

alternate therapies targeting CD33-positive cell populations would be feasible and safe

(Chevallier et al., 2008; van der Velden et al., 2004). This finding would suggest the

19

development and use of smaller and less immunogenic CD33-specific aptamers carrying

less toxic cargoes than calicheamicin (hepatotoxicity) into CD33+ cells. As a proof-of-

concept, our group recently developed 25-base long synthetic DNA aptamers against a

recombinant form of CD33 to examine their ability to be internalized by myeloid

(CD33+) cell lines. As shown by flow cytometry and confocal microscopy (Figure 1.4),

one such CD33-specific Cy5-labeled DNA aptamer binds to (4°C) and is internalized

(37°C) by CD33+ cells within 90 minutes of exposing cells to this oligonucleotide. In

contrast, no binding or cellular uptake was observed for a control aptamer (25-base long

repeat of the sequence GATC) identically modified with a Cy5 probe exposed to the

same set of cell lines. Finally, neither aptamers bound to the CD33- cell line LP1. The

dissociation constant (Kd) of this monomeric CD33-specific aptamer was calculated to be

17.3 nM suggesting that it is only ~10 fold less avid for its target than modified forms of

the established bivalent-binding CD33-specific monoclonal antibody HuM195 (Chen et

al., 2006). These results suggest that DNA aptamers evolved to bind to the antigen CD33

can mimic the properties of anti-CD33 antibodies in terms of binding and being imported

into CD33-positive cells.

20

Figure 1.4. A CD33-specific DNA aptamer binds to and is internalized by CD33+

myeloid leukemia cell lines. FACS histograms (top) and fluorescence confocal images

(bottom) of CD33+ myeloid leukemia cell lines HL60, OCI-AML5 and THP1 exposed to

a 25-base long synthetic, Cy5-labeled CD33-specific DNA aptamer at 4°C and 37°C for

90 minutes. The flow cytometry profiles indicate that the CD33-specific DNA aptamer

binds specifically to CD33+ cells at 4°C (green curves) with increased fluorescence

intensities being observed at 37°C (red curves) as a consequence of internalization. In

contrast, the labeled aptamer did not recognize the CD33- myeloma cell line LP1. A 25-

base long Cy5-labeled control DNA aptamer composed of GATC repeats displayed

fluorescence profiles at 4°C (black curves) and 37°C (blue curves) that were comparable

to the autofluorescence profiles (grey areas) of unstained cells.

21

1.3.2. Carcinoembryonic antigen (CEA)

The human carcinoembryonic antigen (CEA) is a 180 kDa GPI-linked cell glycoprotein

and a member of an immunoglobulin cell adhesion molecule superfamily (CEACAMs).

CEA was originally identified as a surface marker on adenocarcinomas of the human

gastrointestinal tract as well as on cells of the fetal digestive system (Gold and Freedman,

1965a). Other CEACAM members have since been identified in an array of tumours

including breast, lung, pancreas, stomach, thyroid, ovaries and melanomas

(Hammarstrom, 1999). CEA is aberrantly overexpressed on the surface of colorectal

tumour cells in relation to normal colonic cells (Boucher et al., 1989). As the tumour

progresses and invades the basal lamina, elevated levels of CEA can be detected in sera.

For this reason, CEA has been used as a serum marker for recurrence of colorectal cancer

despite its low sensitivity and specificity (Goldstein and Mitchell, 2005). CEA has often

being referred to as a non-internalizing or as a shed antigen, yet studies have shown that

anti-CEA antibodies are endocytosed at a rate consistent with the metabolic turnover of

CEA (Ford et al., 1996; Schmidt et al., 2008; Shih et al., 1994; Stein et al., 1999) Anti-

CEA antibody targeted therapies have been reported to date (Behr et al., 2002;

Goldenberg, 2002). As in the case of antibody therapies aimed at solid tumours, poor

tumour penetration remains an issue and in the specific cases of high affinity CEA

antibodies, their rapid clearance due by free circulating antigen (Adams et al., 2001;

Graff and Wittrup, 2003). In order to assess the potential of CEA as an internalizing

antigen on cancer cells, DNA aptamers were developed specifically to recognize a

recombinant form of the N-terminal Ig domain of human CEA using the SELEX

approach. The binding of one such 25-base long DNA aptamer (and a control DNA

aptamer) to the mouse colon adenocarcinoma cell line MC-38 (CEA-) and its related cell

22

line transduced to express the human CEA gene, MC-38.cea (CEA+) (Robbins et al.,

1991) was monitored by flow cytometry. Specifically, these cells were incubated with a

Cy5 conjugated CEA-specific DNA aptamer at 4°C (surface binding only) and at 37°C

(binding and internalization). As shown in Figure 1.5, MC-38 (CEA-) MC38 cells

showed no significant binding of the CEA-specific aptamer at both temperatures (Figure

1.5B). In contrast, the CEA-specific aptamer strongly associated with the CEA-positive

cell line MC-38.cea, with a significant increase in mean fluorescence intensity being

observed after 2 hours at 37°C in relation to 4°C (Figure 1.5B). The higher fluorescence

signal observed at 37°C is attributed to the CEA aptamer being internalized during this

time period. The irrelevant Cy5-labeled DNA aptamer (control; GATC repeats) did not

bind to either cell lines at both temperatures. Thus, CEA may represent a powerful portal

for aptamer-directed conjugates to selectively reach and be imported into colon cancer

cells.

23

Figure 1.5. A CEA-specific DNA aptamer binds to and is imported into colon

carcinoma cells expressing human CEA. FACS histograms confirmed the binding

(4°C, green curves) and internalization (37°C, red curves) of a 25-base long synthetic,

Cy5-labeled CEA-specific DNA aptamer binding to the human CEA+ MC38.cea cell line

after a 2-hour incubation period. No binding or internalization was observed for the Cy5

aptamer to the parent CEA-

MC38 cell line or for a control aptamer (as described in

Figure 1.4; black (4°C) and blue (37°C) curves) to both cell lines.

24

1.3.3. CA15-3 antigen, MUC1 peptides and Tn antigens

The mucin MUC1 is a membrane glycoprotein that is highly expressed and is aberrantly

glycosylated [shortened O-glycans structures] in greater than 90% of all primary and

metastatic breast cancers (Hanisch and Muller, 2000; McGuckin et al., 1995; Spicer et

al., 1995; Taylor-Papadimitriou et al., 1999). The mucin MUC1 extracellular domain

largely consists of 30 to 100 copies of a 20-amino acid long tandem repeat (Gendler et

al., 1988). Serine and threonine residues within the tandem repeat represent sites of O-

glycosylation. The pattern of O-glycosylation at such sites is altered in cancer cells

giving rise to truncated short sugar chains known as the T, Tn and sialyl-Tn antigens as

well as exposing antigenic sites on the peptide chain itself (Hanisch et al., 1996). MUC1

peptide domains and its associated truncated carbohydrate epitopes are clinically referred

to as the CA15-3 antigen. Increasing serum levels of the CA15-3 antigen correlate with

poor prognosis. In terms of drug delivery, mucin MUC1 glycoforms are endocytosed and

recycled by cells in order to complete their glycosylation pattern prior to returning to the

cell surface (Altschuler et al., 2000; Ceriani et al., 1992; Henderikx et al., 2002; Litvinov

and Hilkens, 1993). Any ligands binding to such structures will thus be imported into

MUC1+ cells and in particular through Golgi compartments. Our group has recently

derived short 25-base long, synthetic DNA aptamers that specifically recognize either the

MUC1 peptide backbone or its Tn antigens (GalNAc sugars linked to serine and

threonine hydroxyl side chains on the MUC1 peptide tandem repeat) on epithelial cancer

cells with binding affinities (Kds) for their targets ranging from 18 to 85 nM (Ferreira et

al., 2009). Confocal microscopy and flow cytometry studies have shown that these

labeled aptamers circulate from the cell surface and into endosomal and Golgi

compartments upon binding to underglycosylated mucins (Figure 1.6). These DNA

25

aptamers were subsequently derivatized at their 5`end with the photodynamic therapy

agent chlorin e6 and shown to deliver chlorin e6 to cellular compartments and cause

cytotoxicity at concentrations 2- to 3-orders of magnitude lower than the concentration

needed for the free drug (Ferreira et al., 2009).

Figure 1.6. Proposed mechanisms of cellular entry and recycling of DNA aptamers

directed at aberrantly glycosylated mucin MUC1 present on the surface of epithelial

cancer cells. Aptamers bind to membrane-bound, underglycosylated MUC1 mucin

(branched structures). These mucin structures are recycled from the cell surface into

endosomes that are either sent back to the cell surface or routed to the Golgi network

where they are further glycosylated before returning to the cell surface.

26

1.3. Aptamer-guided delivery of payloads into cancer cells

In theory, aptamers represent simpler antibody-like mimics in terms of their ability to

recognize tumour markers. Therapeutic agents can be directly coupled to aptamers or

packaged into particles modified with aptamers in order to exploit recycling pathways

associated with internalized cancer markers. However, the optimal efficacy of an

aptamer-based intracellular delivery agent will depend in part on the recycling properties

of their target and the possible induction of a receptor-mediated internalization event

upon binding to a surface marker. In addition, the intracellular routing of aptamers is

influenced by the abundance of the cell surface target itself, the macroscopic nature of

the aptamer conjugate being delivered (size and nature of the cargo) and the dominant

endocytic pathways associated with a given tumour cell type. The known cellular import

mechanisms that lead to the vesicular trafficking of ligands bound to cell surface

receptors are illustrated in Figure 1.7 and include (1) macropinocytosis and (2)

phagocytosis, distinguished by the size of their endocytic vesicles, (3) clathrin-mediated,

(4) caveolae (caveolin-based lipid rafts) and (5) clathrin-independent pathways. Recently

designed aptamer-cargoes complexes do exploit import pathways, although few studies

have explored their mode of cellular delivery. Most reported examples of internalized

aptamer conjugates (Table 1.3) have either made use of the RNA aptamers A9 and A10

directed at the prostate-specific membrane antigen (PSMA) or the DNA aptamer sgc8c

recognizing the tyrosine kinase 7 (PTK7).

27

Figure 1.7. Possible endocytic pathways taken by aptamer-cargoes. The nature and

size of a cargo, the membrane-cycling property and abundance of a targeted surface

portal on a given cell type as well as the number of portal-directed aptamers attached to a

cargo (valency) can influence which import mechanism(s) may dominate in routing an

aptamer-containing conjugate into cells. Large multivalent aptamer-targeted

nanoparticles, polymer aggregates and liposomes would favor actin-filament-mediated

uptake mechanisms such as macropinocytosis (1) or phagocytosis (2) while smaller

monomeric aptamer conjugates involving a drug, a radionuclide, an siRNA or a protein

as examples of payloads may enter cells via receptor-mediated events involving clathrin-

dependent (3), caveolin-dependent (4) and/or clathrin-independent (5) endocytic

pathways.

28

1.4.1. Aptamer-drug conjugates

Aptamer-drug conjugates have been constructed by chemically coupling a

chemotherapeutic drug to the aptamer via a linker or by intercalating the drug into the

aptamer folded structure creating a physical complex (Bagalkot et al., 2006; Huang et al.,

2009). The drug is then imported into target cells while reducing its toxicity towards

other cells (oligonucleotides including aptamers are cell-impermeant). Drugs can be

conjugated to aptamers during solid-phase synthesis or post-synthesis by incorporating

an amino or thiol group at one end of the oligonucleotide during their assembly. For

instance, doxorubicin, an anthracycline used in the treatment of various cancers, has been

coupled via an acid-labile hydrazone linker to a 41-nucleotide long tyrosine kinase 7

PTK7-specific DNA aptamer (sgc8c) to release the drug in endosomes (Willner et al.,

1993). This aptamer-drug conjugates has been shown to prevent the nonspecific

internalization of the drug as well as decrease its cellular toxicity towards non-target

cells. The conjugate is selectively internalized by CCFR-CEM cells (T-cell acute

lymphoblastic leukemia cells) with no apparent reduction in aptamer affinity for its target

(Huang et al., 2009). As mentioned in section 1.3.3, DNA aptamers targeting known

tumour-associated antigens such as mucin MUC1 peptides and mucin Tn antigens have

also been modified with a photodynamic therapy agent chlorin e6 and delivered to

epithelial cancer cells. These aptamer-chlorin e6 conjugates exhibited a >500-fold

increase in toxicity upon light activation as compared to the drug alone and were not

cytotoxic to cells lacking these mucin markers (Ferreira et al., 2009).

1.4.2. Aptamer-protein conjugates

Previous work with antibody-toxin conjugates has suggested that the most important

determinant of cellular cytotoxicity of immunotoxins is the efficiency of their import into

29

cells (Goldmacher et al., 1989). The coupling of aptamers to cytotoxic as well as

therapeutic proteins can facilitate them reaching their intracellular substrates. A case in

point is the anti-PSMA RNA aptamer (A9) conjugated to gelonin, a ribosome-

inactivating protein toxin. As mentioned in section 1.2, the prostate-specific membrane

antigen (PSMA) is internalized by prostate cancer cells and thus provides a portal for the

directed entry of the cytotoxic PSMA-specific aptamer-gelonin construct into such cells.

Gelonin is an enzyme that inactivates ribosomes when deposited in the cytosol of

intoxicated cells. The construct displayed a 600-fold increase in toxicity towards PSMA+

LNCaP cells as compared to non-PSMA-expressing PC3 cells and ~180-fold increase in

toxicity towards LNCaP cells relative to free gelonin (Chu et al., 2006a).

1.4.3. Aptamer-radionuclide conjugates

Few aptamers to date have been modified to incorporate radionuclides or metal chelators

with a view to image or kill cancer cells in vivo. Hicke and coworkers have reported the

introduction of the metal chelator mercapto-acetyl diglycine (MAG2) at the 5’ end of

TTA1, a Tenascin-C-specific aptamer (Hicke et al., 2001). TTA1 is a 40-nucleotide long

RNA aptamer that incorporates 2-fluoro-pyrimidines and binds to the protein Tenascin C

with a Kd of 5 nM (Hicke et al., 2001). Tenascin is a large, hexameric glycoprotein

associated with the extracellular matrix and is expressed during tissue remodeling events

linked to angiogenesis and tumour growth. The MAG2-containing TTA1 aptamer

chelates 99m

Tc and was used to determine its biodistribution in vivo in the context of nude

mice harboring a human glioblastoma U251 xenograft. 99m

Tc-TTA1 showed rapid blood

clearance and tumour uptake, reaching a tumour-to-blood ratio of 50 within 3 hours. In

addition, good scintigraphy images of a breast and glioblastoma tumour xenograft in

nude mice were recorded using this labeled aptamer (Hicke et al., 2006). The success of

30

this particular chelator-aptamer complex also highlighted the empirical nature of the

design process as an alternate choice of a chelator and radionuclide does result in

significant changes in the uptake and clearance patterns of this aptamer in vivo.

Nevertheless, the use of radiolabeled aptamers for imaging purposes in vivo is feasible.

1.4.4. Aptamer-nanostructure conjugates

The recent creation of aptamer conjugated nanostructures suggests that they may

represent a promising class of new agents for targeted cancer imaging and therapy. These

targeted structures include nanorods, quantum dots, as well as soft and hard

nanoparticles. Nanorods for example, can be viewed as an alternate scaffold for

assembling and immobilizing aptamers to nanomaterials in order to generate multivalent

conjugates. Huang and colleagues were able to show that up to 80 aptamers could be

covalently linked to the surface of Au-Ag nanorods via a 5’end thiol group introduced

into the structure of the fluorescein-labeled DNA aptamer sgc8c (section 1.4.1). The

avidity of the resulting aptamer-nanorods towards the tyrosine kinase 7 PTK7

transmembrane protein on CCFR-CEM cells was shown to be 26-fold higher than the

affinity of the unconjugated fluorescein-labeled aptamer sgc8c for the same cells. The

fluorescence intensity signal observed by flow cytometry was also 300-fold greater for

the aptamer-nanorod labelled cells than the signals observed for CCFR-CEM cells

labelled with the unconjugated fluorescein-labeled aptamer (Huang et al., 2008).

RNA aptamers directed at the prostate-specific membrane antigen (PSMA) have

been used in the design of numerous nanostructures. Streptavidin-coated quantum dots

(QD; semiconductor nanocrystals) have also been decorated with a biotinylated, 70-

nucleotide long PSMA-specific RNA aptamer termed A9 and the resulting conjugates

used for cellular imaging. Specifically, the photostability and small size of quantum dots

31

was shown to improve the visualization of PSMA-positive cells (LNCaP) as adherent cell

monolayers, in suspension preparations and embedded in a collagen matrix(Chu et al.,

2006b). Aptamer particles have also been designed to serve the dual purpose of acting as

a tumour-targeted agent and as a particle capable of controlled drug release. For example,

the FITC-labeled PSMA-specific RNA aptamer A10 was coupled to a poly(lactic acid)-

block-polyethylene glycol (PEG) copolymer nanoparticles that have been derivatized

with a terminal carboxylic acid functional group (PLA-PEG-COOH). Rhodamine-

labelled dextran was encapsulated (as a model drug) into these polymeric particles. The

nanoparticles including their cargo were selectively imported into PSMA-positive

LNCaP cells as confirmed by fluorescence microscopy (Farokhzad et al., 2004).

Farokhzad and colleagues subsequently loaded docetaxel, a chemotherapeutic drug into

the aptamer-conjugated nanoparticles and injected a single intratumoural dose of the

construct in nude mice harboring a LNCaP xenograft (Farokhzad et al., 2006).

Significant tumour regression was observed with no apparent immunogenicity. More

recently, the same aptamer-nanoparticle conjugates were loaded with docetaxel and

doxorubicin or with cisplatin although the overall improvement in survival in the treated

tumour-bearing animals was modest in relation to the non-aptamer targeted drug loaded

nanoparticles (Dhar et al., 2008; Zhang et al., 2007). Finally, the creation of a conjugate

composed of the PSMA-specific RNA aptamer A10-doxorubicin-quantum dot was

recently reported by Jon and Farokhzad groups (Bagalkot et al., 2007). Again, this

nanostructure is imported into PSMA+ LNCaP prostate cancer cells by PSMA-mediated

endocytosis. The construct offers the dual advantages of specifically delivering

doxorubicin intercalated into the A10 aptamer structure to prostate cancer cells as well as

32

imaging the delivery process through a FRET event arising from interactions of the

released doxorubicin and the QD itself (Bagalkot et al., 2007).

To date, liposomes remain one of the most successful drug delivery systems

(Kaneda, 2000). Liposome formulations of many of the most frequently prescribed

chemotherapeutic drugs have been approved and are currently used in clinical practice

(Wagner et al., 2006). Liposomes have been shown to increase the circulation time of

aptamers while these aptamers aid in targeting liposomes to their desired site of action

(Farokhzad et al., 2006; Willis et al., 1998). Liposomal drug delivery strategies have

focused on developing long-circulating liposomes that target areas of increased vascular

permeability via the enhanced permeation and retention (EPR) effect (Matsumura and

Maeda, 1986). The EPR effect however remains a passive tumour localization strategy

that can lead to detrimental systemic consequences and suboptimal antitumour efficacy

(Mamot et al., 2003; Woo et al., 2008). Aptamer-labeled liposomes can thus increase the

delivery of encapsulated therapeutic agents to cancer cells.

1.4.5. Challenges facing the in vivo use of aptamers

The concept of using aptamers as therapeutic agents was initially tested by selecting

aptamers to thrombin with a view to preventing blood clotting (Bock et al., 1992). The

rationale for creating thrombin-selective aptamers was to generate heparin mimics that

did not form complexes with platelet factor 4 which reacts with platelet-activating

antibodies leading to heparin-induced thrombocytopenia (Stribling et al., 2007). Larry

Gold`s group selected aptamers against the targeted HIV reverse transcriptase (Schneider

et al., 1995). Since virus transcriptases normally bind nucleic acids, they represent

excellent aptamer targets. Other parts of the virus are also being targeted by aptamers,

some of which are DNA aptamers (Chou et al., 2005; Zhou et al., 2009). In spite of their

33

large therapeutic potential, aptamer drugs are still not a commonplace treatment mostly

due to the previously mentioned challenges associated with translating small scale in

vitro laboratory experiments into medical practice. Currently, the only aptamer approved

by the FDA is Macugen (OSI Pharmaceuticals and Pfizer), an aptamer used to treat age-

related macular degeneration (AMD). Macugen is a PEGylated 29-nucleotide long RNA

aptamer with a modified backbone that significantly increases its circulating half-life (Ng

et al., 2006). Macugen recognizes the vascular endothelial growth factor isoform

VEGF165 but does not bind to VEGF121. In contrast, the antibody against VEGF

marketed by Genentech under the name Ranibizumab shows specificity towards both

isoforms (Kourlas and Abrams, 2007).

Aptamer structures can be evolved to recognize minor structural differences

within a given target and typically bind to their targets with affinities comparable to those

of antibodies (Conrad et al., 1994; Schneider et al., 1995). Practical advantages of

aptamers over antibodies include their lower mass, low cost of synthesis, long shelf-life

and consistent quality. However, aptamers do face challenges as potential therapeutic or

delivery agents. Firstly, nucleic acids are small, charged molecules. As such, they cannot

passively traverse a cell membrane. Secondly, oligonucleotides are rapidly degraded by

nucleases in plasma and cleared from circulation, resulting in short in vivo half-lives

(Chu et al., 2006a; White et al., 2000). Thirdly, oligonucleotides are typically not

immunogenic. Yet, immune responses mediated by Toll-like receptor family members

have been reported as exemplified by unmethylated CpG sequences (Wagner et al.,

2006). Solutions to these challenges are available. There are several approaches for

increasing the circulating time (half-life) of aptamers in plasma. One of them is

PEGylation, the process of conjugating polyethylene glycol (PEG) groups to such

34

molecules. The coupling of a cholesterol group or a cell-penetrating peptide can also

reduce their systemic clearance (Healy et al., 2004; Willis et al., 1998). Another approach

is by using chemically modified nucleotides shown to increase the half-life of aptamer

sequences by more than 40-fold (Peng and Damha, 2007). Such changes can be

introduced during the SELEX process by using modified nucleotides that are

incorporated by the T7 polymerase at the in vitro transcription step when RNA aptamers

are being selected. In the case of DNA aptamers, modified nucleotides are simply

introduced during library synthesis (Aurup et al., 1992; Latham et al., 1994). Possible

modifications compatible with the SELEX protocol include substitution of the 2' OH

group with a 2' fluoro or 2' amino group (Jellinek et al., 1995; Padilla and Sousa, 1999).

Besides the sugar component of the molecule, various groups such as aromatic and alkyl

moieties can be attached to the C5 position of UTP (Schoetzau et al., 2003). Other

modifications termed “post SELEX” have been introduced after a useful sequence is

identified (Eaton et al., 1997). One form of post-SELEX modification is Locked Nucleic

Acid (LNA) (Barciszewski et al., 2009). The LNAs can have one or more nucleotides

with a methylene linkage between the 2' oxygen and the 4' carbon, which results in the

“locked” conformation of the sugar. This modification provides an increased affinity for

the complementary strand, higher thermal stability, and resistance to nuclease

degradation (Vester and Wengel, 2004). Multivalency represents another factor that can

increase the avidity and potency of aptamers, as demonstrated by the oligomerization of

an RNA aptamer against the Drosophila protein B52 (Santulli-Marotto et al., 2003). The

tetravalent RNA aptamer recognizing the cytotoxic T-cell antigen-4 (CTLA-4) has also

shown a therapeutic advantage over its monomeric counterpart in prolonging the survival

of C57BL/6 mice implanted with the B16/F10.9 murine melanoma (McNamara et al.,

35

2008).

Among other aptamers selected to target tumour specific proteins, the first one to

enter clinical trials is an unmodified DNA aptamer termed AS1411 (Antisoma). It was

shown that its G rich sequence binds nucleolin present on the surface of cancer cells and

can inhibit NF-kB pathways (Bates et al., 1999; Girvan et al., 2006). This aptamer is

currently in Phase II clinical trials and shows activity towards many types of

hematological cancers (clinical trials.gov identifier NCT00512083; NCT00740441).

Interestingly, this 26-nucleotide long unmodified DNA aptamer is stable in serum, which

indicates that the sequence of the aptamers results in a three dimensional structure that is

not easily susceptible to nuclease degradation (Dapic et al., 2002). Thus, the need to

further modify DNA aptamers to increase their stability in vivo may not be necessary in

all cases.

Finally, Figure 1.7 outlines how aptamer-cargoes can reach several intracellular

vesicular compartments. The illustration is also meant to highlight the fact that the

cytosolic release of cargoes entrapped in vesicles remains an inefficient process and a

common challenge confronting other drug delivery strategies involving polymer

formulations, antibody conjugates and cell-penetrating peptides. Aptamer-targeted

cargoes such as radionuclides (acting within a cell diameter or via a bystander effect),

hydrophobic drugs, gold particles and liposomes may reach the cytosol or have their

therapeutic effect enhanced by simply residing or cycling through vesicles. Other

charged cargoes such as siRNAs, plasmids and proteins will be inefficiently released

from endosomal compartments and may require the use of endosomolytic agents.

36

1.4. Thesis Hypotheses

To date, many protein-based therapeutics have established themselves as the gold

standard for the treatment of an array of diseases. However, the use of proteins as

therapeutic agents comes with challenges such as immunogenicity [even for humanized

forms] and production costs. Many of the protein-based therapies involve the binding

and blocking of targets associated with the persistence or occurrence of a disease.

Therefore, new biotherapeutics are needed that exhibit reduced immunogenicity and are

less costly than proteins while acting as potent agonists or antagonists to clinically

relevent targets. My overall objective was to develop DNA aptamers able to target and

block the function of validated therapeutic targets or to act as specific delivery agents.

The hypotheses of this thesis were:

1) DNA aptamers can be developed to behave as inhibitors of TNFα activity.

2) DNA aptamers can be developed to act as anti-adhesives of carcinoembryonic

antigen (CEA).

3) DNA aptamers recognizing the unique cell surface biomarkers CEA and MUC1

can be used as targeting agents on liposomes containing a contrast agent for

Computed Tomography (CT) imaging of breast cancer tumours.

37

1.5. Specific Aims

To test these hypothese, the specifc aims were:

1) To develop a robust SELEX protocol that can be used to screen and identify DNA

aptamers to TNFα, CEA and MUC1.

2) Employ the SELEX methodology to select and identify DNA aptamers to TNFα

and evaluate their ability to block binding to the TNF receptor by monitoring the

inhibition of apoptosis, downstream signaling and reduction of nitric oxide (NO)

and characterize the level of immunogenicity.

3) Employ the SELEX methodology to select and identify DNA Aptamers to CEA

and characterize their ability to behave as anti-adhesive in blocking homotypic

binding and prevent peritoneal tumour foci formation.

4) To evaluate whether DNA aptamers to CEA and MUC1 can target liposomes

encapsulated with Omnipaque350™ to the breast cancer cell line MDA-MB-231

and characterize their effect on tumour accumulation and internalization.

38

1.6. Chapter Overviews

The studies addressing the specifc aims outlined are described in Chapters 2-4 of the

thesis. Chapter 2 describes the selection and identification of aptamer VR11 and

characterizes its ability to block TNFα-induced apoptosis in murine cells as well as

prevent the production of nitric oxide (NO) in macrophage cells. This study also showed

that aptamer VR11 has a high binding affinity and is specific to TNFα while exhibits no

immunogenicity in C57BL/6 mice. Chapter 3 demonstrates that DNA aptamers identified

to bind CEA with high affinity and specifically bound to the IgV-like N domain of CEA.

Two such aptamers prevented the adhesion properties of CEA expressing cells and

prevented the formation of peritoneal tumour foci whithout elicting an immune response.

Chapter 4 describes the characterization of CEA and MUC1 targeted liposomes

containing the contrast agent Omnipaque350™ and their ability to internalize in MDA-

MB-231 cells. As well, conjugation of these aptamers did not significantly change the

circulatory half-life of the liposomes formulations in mice. In Chapter 5 the overall

conclusions are presented and discussed and future research is proposed.

39

Chapter 2

A short DNA aptamer that recognizes TNF-alpha and blocks its activity

in vitro

A version of this chapter has been previously published:

A short DNA aptamer that recognizes TNF-alpha and blocks its activity in vitro

(ACS Chem Biol. 2013 Jan 18;8(1):170-8.)

Erik W. Orava, Nick Jarvik, Yuen Lai Shek, Sachdev S. Sidhu, Jean Gariépy

Author Contributions:

Erik Orava and Dr. Jean Gariépy designed the experiments, analyzed data and wrote the

paper.

Erik Orava contributed Table 2.1 and Figures 2.1, 2.2, 2.3A-B, 2.4, 2.6, 2.7, 2.8 and 2.9.

Nick Jarvik helped perform SPR experiments for Figure 2.3 C-G. in the laboratory of Dr.

Sachdev S. Sidhu

Yuen Lai Shek contributed by performing CD experiments for Figure 2.5.

40

2.1. Abstract

Tumour necrosis factor-alpha (TNF) is a pivotal component of the cytokine network

linked to inflammatory diseases. Protein-based, TNF inhibitors have proven to be

clinically valuable. Here, we report the identification of short, single stranded DNA

aptamers that bind specifically to human TNF. One such 25-base long aptamer, termed

VR11, was shown to inhibit TNF signalling as measured using NF-κB luciferase

reporter assays. This aptamer bound specifically to TNF with a dissociation constant of

7.0±2.1nM as measured by surface plasmon resonance (SPR) and showed no binding to

TNFβ. Aptamer VR11 was also able to prevent TNF-induced apoptosis as well as

reduce nitric oxide (NO) production in cultured cells for up to 24 hours. As well, VR11,

which contains a GC rich region, did not raise an immune response when injected

intraperitoneally into C57BL/6 mice when compared to a CpG oligodeoxynucleotide

(ODN) control, a known TLR9 ligand. These studies suggest that VR11 may represent a

simpler, synthetic scaffold than antibodies or protein domains upon which to derive

nonimmunogenic oligonucleotide-based inhibitors of TNF.

41

2.2. Introduction

Unregulated immune responses are intimately associated with degenerative diseases such

as atherosclerosis, arthritis, encephalitis, and tumours (Borish and Steinke, 2003;

Feldmann and Maini, 2001; van den Berg, 2001). The primary pro-inflammatory

cytokine, tumour necrosis factor alpha (TNF) plays a critical regulatory role in

enhancing these responses (Furst et al., 2006). In the past decade, disease-modifying

antirheumatic drugs (DMARDs) that target underlying immune responses processes have

improved disease outcomes in patients with chronic immune response disorders (Smolen

et al., 2007). Anti-TNF protein-based therapies (Enbrel, Humira, InfliximAb) have

emerged as a dominant category of DMARDs (Mount and Featherstone, 2005). However,

~ 40% of patients still display moderate to high levels of disease even after treatment

with protein therapeutics suggesting a substantial need for improved therapies (Mierau et

al., 2007).

TNF is a pro-inflammatory cytokine that is produced by an array of cell types

such as macrophages, monocytes, lymphocytes, keratinocytes and fibroblasts, in

response to inflammation, infection, injury and other environmental challenges (Carswell

et al., 1975). TNF is a type 2 transmembrane protein with an intracellular amino

terminus and is synthesized as a 26-kD membrane-bound protein (pro-TNF) that is

cleaved to release a soluble 17-kD TNF molecule. TNF has the ability to signal as a

membrane bound protein as well as a soluble cytokine. As a soluble cytokine, TNF is

only active as a non-covalently associated homotrimer (Hehlgans and Pfeffer, 2005;

Locksley et al., 2001). Sufficient levels of TNF as well as other mediators are critical

for sustaining normal immune responses. TNF can initiate host defence mechanisms to

42

local injury but can also cause acute and chronic tissue damage (Beutler, 1999; Feldmann

and Maini, 2008).

Despite advances in antibody and protein engineering, the major drawbacks of

protein-based TNF inhibitors are their immunogenicity arising from their chronic use

and their production costs resulting in expensive therapies for patients. Simpler,

synthetic, non-immunogenic classes of TNF inhibitors could be derived from short,

single-stranded nucleic acid oligomers (ssDNA or RNA) known as aptamers. These

molecules adopt a specific tertiary structure allowing them to bind to molecular targets

with high specificity and affinities comparable to that of monoclonal antibodies

(Ellington and Szostak, 1990). In some cases, aptamers will display functional properties

beyond just binding to their target. For instance, an aptamer to the inflammation factor

human neutrophil elastase (hNE) was shown to significantly reduce lung inflammation in

rats and displayed greater specificity for their target than an antielastase IgG control

(Bless et al., 1997). Examples of other aptamers exhibiting functional attributes include a

DNA aptamer to anti-HIV reverse transcriptase and RNA aptamers to the basic fibroblast

growth factor and vascular endothelial growth factor (Jellinek et al., 1994; Jellinek et al.,

1993; Schneider et al., 1995). Finally, a single-stranded DNA aptamer selected to bind to

thrombin has been shown to inhibit thrombin-catalyzed fibrin-clot formation in vitro

using either purified fibrinogen or human plasma (Bock et al., 1992).

In the present study, we constructed a 25-nucleotide variable region DNA library

to perform SELEX [Systematic Evolution of Ligands by Exponential enrichment] (Tuerk

and Gold, 1990) selections using recombinant TNF as our target. Several ssDNA

aptamers shown to specifically bind to TNF were further evaluated for their ability to

inhibit TNF signalling in several independent in vitro assays. These analyses led to the

43

identification of VR11, a DNA aptamer capable of inhibiting TNF functions in vitro.

2.1. Materials and Methods

2.3.1. Expression and purification of human TNF.

The expression plasmid (RCA-093) encoding a 157-amino acid TNFα his-tag

recombinant protein (residues 77-233) was obtained from Bioclone Inc. (San Diego,

CA). LB broth supplemented with kanamycin (50µg/ml) was inoculated with a glycerol

stock and grown at 37°C until the A600 reached 0.8. The expression of the TNFα fragment

was induced using a final concentration of 0.5 mM isopropyl β-D-thiogalactopyranoside

(IPTG) and incubated overnight. Soluble TNFα was purified by nickel affinity

chromatography under non-denaturing conditions. Cells were harvested by centrifugation

at 8,000 rpm for 30 min and resuspended for 1 hour in BugBuster Reagent (Novagen), 1

U Benzonase (Novagen) and a complete EDTA-free protease inhibitor tablet (Roche).

The lysate was then centrifuged at 8,000 rpm for 30 min and supernatant was loaded on a

Ni-NTA agarose column (Sigma-Aldrich) pre equilibrated with Buffer A (50 mM

phosphate buffer, pH 8, 300 mM NaCl, and 10 mM imidazole). After several washes with

buffer A the protein was eluted with 3 column volumes of Buffer B (50 mM phosphate

buffer, pH8, 300 mM NaCl and 250 mM imidazole). The eluate was concentrated by

ultrafiltration into a 100 mM Tris-HCl buffer (pH 6.0) using an Amicon ultrafiltration

unit (Millipore; 10 kDa MWCO). Purified TNFα was characterized by SDS-PAGE and

quantified using the Bradford assay (Bradford, 1976).To verify that the protein was

properly folded and functionally active, a cytotoxicity assay was performed using the

L929 cell line sensitized with Actinomycin D and compared to a commercial

recombinant human TNFpurchased from Bioclone Inc. (Appendix 3).

44

2.3.2. Aptamer selection screens.

The initial ssDNA library contained a central randomized sequence of 25 nucleotides

flanked by T3 and SP6 primer regions respectively. Briefly, the sequence of the starting

library was 5’ AAT TAA CCC TCA CTA AAG GG-(25N)-CTA TAG TGT CAC CTA

AAT CGTA. The forward primer 5’AAT TAA CCC TCA CTA AAG GG 3’ and reverse

primer 5’ TAC GAT TTA GGT GAC ACT ATA G 3’ were used for selection and cloning

(IDT Technologies, Inc.). A 25 nucleotide-long aptamer (cApt) comprised of AGTC

repeats [which has no predicted secondary structures] served as a control for all

experiments. To begin the selection, 50 nmol aliquot of the library representing ~3.0 ×

1016

molecules consisting of ~25 copies of each possible unique sequence was first

counter-selected against a 6-His peptide (HHHHHH) loaded onto Ni-NTA magnetic

agarose beads. The resulting sub-library was then exposed to 10 µg of His-tagged TNF

immobilized onto Ni-NTA beads suspended in Selection Buffer (PBS, 0.005% (v/v)

Tween-20) at 37°C for 1 hour. Unbound DNA sequences were washed away (PBS,

0.005% (v/v) Tween-20) and DNA-protein complexes were eluted from the recovered

beads using an imidazole buffer (PBS, 0.005% (v/v) Tween-20, 240 mM imidazole). The

ssDNA component was precipitated with sodium perchlorate/isopropanol and recaptured

using a silica membrane-based purification system (Qiagen Inc.). The DNA aptamers

were then amplified by asymmetrical PCR using a 100-fold excess of forward primer.

After every three subsequent rounds of selection, the amount of target was reduced in

half to increase the selection pressure to capture the tightest binding species. After 12

rounds of selection, the bound sequences were amplified by PCR, cloned into a pCR™4-

TOPO® TA vector (Invitrogen) and sequences were analyzed using BioEdit sequence

alignment editor software (Ibis Therapeutics).

45

2.3.3. Aptamer-based enzyme linked binding assay.

A 96-well ELISA microtiter-plate (BD Falcon) was coated overnight at 4°C with 100µl

of human TNF (10µg/ml) prepared in coating buffer (0.2 M carbonate/bicarbonate, pH

9.4). The plate was then washed 3 times with PBS-T (0.1M phosphate, 0.15M sodium

chloride, pH 7.0 containing 0.05% Tween-20) and blocked overnight at 4°C in 150 µl of

blocking solution (PBS-T + 1% (w/v) BSA). The plate was washed 3 times with PBS-T

and incubated overnight at 4°C with 100µl (10µg/ml) of 5’ biotinylated aptamers

dissolved in PBS, 0.005% (v/v) Tween-20. The plates were washed and incubated for 1

hour at 4°C with 100 µl of streptavidin-HRP (1:2000). Plates were then read on a plate

reader at 450 nm following washing and dispensing of 100µl of TMB substrate [1 TMB

tablet (Sigma-Aldrich Inc.) dissolved in 1ml of DMSO in 10 ml of 0.05M phosphate

citrate, pH 5.0 and 2 µl sodium peroxide] per well. Color development was stopped by

adding 50µl of 1M sulphuric acid per well.

2.3.4. NF-κB luciferase reporter assay.

An NF-κB luciferase reporter plasmid was transfected into cells as a marker of TNF

binding as previously described (Mamaghani et al., 2009). Briefly, 0.1μg/well TA-LUC

NF-κB and 10ng/well β-gal CMV were co-transfected to the cells. PANC1 (ATCC) cells

(1.0×104) and HEK293T (ATCC) (5.0×10

3) were seeded in a 96-well plate 24 hours

before the transfection steps. DNA was transfected into cells using Lipofectamine 2000

(Invitrogen Canada Inc.). Cells were incubated 4-6 hours in Opti-mem medium

(Promega) and transferred to 10% FBS DMEM overnight. Aptamers were added to the

medium (1 µM final concentration for PANC-1 cells or 2 µM, 200nM and 20nM for

HEK293T) 30 minutes prior to treating the transfected cells with recombinantly

46

expressed human TNF (100 ng/ml). Luciferase activity was measured after 6 hours

using the Dual-Light®

System luciferase assay from Applied Biosystems according to the

manufacturer's protocol and read on a Luminoskan Ascent luminometer (ThermoLab

Systems). The results were normalized to the values obtained for β-galactosidase activity.

2.3.5. Inhibition of TNF induced cytotoxicity.

L929 cells (ATCC) were seeded 24 hours before experiments in 96-well flat-bottom

microtiter plates at a density of 1.0×104

cells/well in DMEM medium containing 10%

FBS. Aptamers (2µM) or 20µg/ml anti-TNF mAb (R&D systems) were incubated with

human TNF for 2 hours in PBS prior to incubation with cells. Subsequently, aptamer-

TNF samples were added to the cells for 2 hours. Cells were then washed with warm

PBS and incubated in complete medium for another 48 hours. The viability of adherent

cells was subsequently determined using the sulforhodamine B assay (Skehan et al.,

1990).

2.3.6. Surface plasmon resonance.

All experiments were performed using the ProteOn XPR36 protein interaction array

system (Bio-Rad Laboratories, Inc.) and one ProteOn NLC sensor chip, coated with

NeutrAvidin for coupling of biotinylated molecules. Biotinylated aptamer VR11, VR20

and rApt(VR) were synthesized with a 5’ biotin with a standard C6 spacer and HPLC

purified (Integrated DNA Technologies, Inc.). Subsequently 2.5nM of aptamers were

diluted in PBS-T and injected for 30 sec at 30ul/min. Aptamer loading on the chip

yielded approximately 10–12 response units which represented ~1ng of aptamer. Human

47

TNF and TNFβ stock solutions were diluted as a series of two-fold dilutions ranging

from 2µM to 3.9nM in PBS-T (0.05% (v/v) Tween-20) pH 7.4 (Figure 3C-F). Protein

concentrations and a buffer control were injected in the analyte channel with a contact

time of 120 sec, dissociation time of 800 sec, and a flow rate of 100 µl/min. The ligand

channels were regenerated with a 30 sec injection of 1M H3PO4 followed by a 30 sec

injection of 1 M NaCl. All experiments were performed at 25°C and repeated in

triplicate. Sensorgrams were then double-referenced by subtracting the buffer response

and using the interspot reference. The sensorgrams were fitted globally to a 1:1 Langmuir

binding model and the kinetic parameters for the association (ka), dissociation rates (kd),

and binding constant (KD) were derived from the fitted curves.

2.3.7. Determination of aptamer concentration and Circular Dichroism

Spectroscopy.

The oligonucleotide concentration of each aptamer solution was determined from its

absorbance at 260 nm as measured at 25 °C with a Cary 300 Bio spectrophotometer

(Varian Canada, Inc.) using molar extinction coefficients of 244 400 M−1

cm−1

, 239 400

M−1

cm−1

and 251 800 M−1

cm−1

for VR11, VR20 and cApt respectively.. Circular

dichroism (CD) spectra were recorded at 25 °C using an Aviv model 62 DS

spectropolarimeter (Aviv Associates). The buffer used for CD measurements contained

10 mM phosphate, 0.1 mM EDTA (free acid) and 100 mM of either sodium or potassium

ions. Either KOH or NaOH was added to the buffers until pH 7 was reached and the ionic

strengths of the buffers were adjusted to the desired level by adding known amounts of

NaCl or KCl. Dry and desalted DNA aptamers were dissolved in the buffers until a

concentration of 0.03 mM was achieved. The DNA aptamer solutions were heated to

48

100°C for 5 minutes to transform the DNA aptamer into their unfolded forms and slowly

allowed to cool to 25°C. Ellipticity values [reported as θ] were measured from 320 nm to

200 nm in 1 nm increments using a quartz cuvette with an optical path length of 0.1 cm.

2.3.8. Inhibition of TNF induced NO production in macrophages.

Experiments were modified using a previous protocol (Ding et al., 1988). Briefly, RAW

264.7 cells (ATCC) were seeded at a density of 1.0 × 105

cells/well in a 12-well plate in

RPMI 1640 + 10% FBS. Cells were pre-treated for 1 hour with 2U/ml IFN-γ (Peprotech)

then treated with 100ng/ml of human TNF in 1ml of medium with aptamers VR11,

VR20 or the control aptamer cApt(VR) at a final concentration of 2µM or with 10µg/ml

anti-TNF mAb. Aliquots of the medium [100µl] were removed at each time point and the

NO2- level determined using the Griess reagent kit for nitrite determination (Invitrogen).

2.3.9. Analysis of VR11 ability to activate an innate immune response.

The aptamer VR11 and cApt were dissolved in sterilized saline at a concentration of 500

µg/ml and CpG ODN (5’-TCCATGACGTTCCTGACGTT-3’; type B murine, ODN

1826, Invivogen) was dissolved at a concentration of 50 µg/ml. Intraperitoneal injections

(200 µl) were administered in C57BL/6 mice. Untreated group received an injection of

200 µl of saline alone. Three hours after injection, mice were sacrificed and their serum

was collected for analysis. Protein cytokine concentrations were determined using the

DuoSet ELISA development kits for mouse CXCL1/KC (murine IL-8, R & D systems

Inc.) and murine TNF (R & D systems Inc.) as per manufacturer’s protocols. Animals

were kept under standard pathogen-free conditions at the Ontario Cancer Institute animal

49

facility. Experiments were performed in accordance with the rules and regulations of the

Canadian Council for Animal Care.

2.4. Results and Discussion

2.4.1. Identification of DNA aptamers directed at TNF.

Traditional treatments for chronic inflammation include NSAIDs, glucocorticoids,

cytostatic drugs and DMARDs. Due to the increased understanding of the molecular

pathology of several inflammatory disorders, immunosuppressants, such as those

directed at TNF, have moved to the forefront of anti-inflammatory drugs. The current

anti-TNF therapy market is dominated by protein therapeutics, namely etanercept

(Enbrel®), adalimumAb (Humira®) and infliximAb (Remicade®). These TNF

inhibitors have been shown to be therapeutically non-equivalent in terms of their

structure, binding to TNF and their therapeutic effects (van Vollenhoven, 2007). More

importantly, these protein-based therapeutics are large macromolecules that are costly to

produce, immunogenic when used in a chronic therapy setting, with close to 40% of

patients still showing disease symptoms even after treatment.

Using TNF as a target, we perform SELEX searches with a view to identify

short, synthetic DNA aptamers able to recognize this key cytokine and potentially mimic

the inhibitory action of an anti-TNF antibody (Figure 2.1). After 12 rounds of selection,

60 clones were sequenced and found to be enriched for 3 specific variable region (VR)

sequences. Specifically, the 25-base long sequences VR1, VR2, and VR6 accounted for

20%, 13% and 10% of the observed sequences respectively (Table 2.1). Aptamers VR11

50

and VR20 represented unique sequences identified in this search that also selectively

bound to TNF. Aptamer VR11 was the only aptamer that inhibited human TNF

functions on cells. Interestingly, VR11 incorporates the sequence 5’ – CAGTCGGCGA-

3’ which was identical to a region of aptamer VR12 with the exception of a single G base

insertion [5’ – CAGGTCGGCGA – 3’]. This 10-base long conserved span represents a

40% coverage of the variable region element of our library and despite the homology

between these two sequences, VR12 displayed no inhibitory activity. This finding

suggests that even a single base insertion can eliminate the functional properties of such

aptamers.

In order to identify and confirm that observed sequences were specifically

binding to TNF, 96-well ELISA microtitre plates were coated with human TNF. and

subsequently exposed to synthetic full-length (FL; a sequence that includes a specific VR

sequence as well as the two flanking primer regions) and variable region (VR) only DNA

aptamers harbouring a 5’ biotin group. Aptamer binding to TNF was confirmed with

streptavidin–HRP for 20 unique sequences tested (Figure 1A) with most of them showing

an ELISA signal at least double that of the control aptamers (cApt(VR), cApt(FL)).

51

Table 2.1. List of TNFα specific DNA aptamer sequences identified from the SELEX

screen as well as control aptamer [cApt(VR) and cApt(FL)] sequences used in the

present study.

Aptamer Sequence

VR1 ACAACCGACAAATTATCGCACTTAC

VR2 ATCACAGCGGGTACGAATGGCAGTG

VR4 ACGCTACGGGACTCTCAAACCGCC

VR5 AAGAACTGGCAGGCCGACCACCGGT

VR6 CGTCCGCTTTGAGTCTCGAAAAGGG

VR8 ATACCCATGGTACGACGGGCCATTC

VR11 TGGTGGATGGCGCAGTCGGCGACAA

VR12 CTCGTCAGTTCAGGTCGGCGATCAT

VR16 AGTGAGCGCTTAGTCTGCGCACTGG

VR20 TCCTCATATAGAGTGCGGGGCGTGT

cApt(VR) AGTCAGTCAGTCAGTCAGTCAGTCA

FL1 AATTAACCCTCACTAAAGGGACAACCGACAAATTATCGCACTTACCTATAGTGTCACCTAAATCGTA

FL2 AATTAACCCTCACTAAAGGGATCACAGCGGGTACGAATGGCAGTGCTATAGTGTCACCTAAATCGTA

FL4 AATTAACCCTCACTAAAGGGACGCTACGGGACTCTCAAACCGCCCTATAGTGTCACCTAAATCGTA

FL5 AATTAACCCTCACTAAAGGGAAGAACTGGCAGGCCGACCACCGGTCTATAGTGTCACCTAAATCGTA

FL6 AATTAACCCTCACTAAAGGGCGTCCGCTTTGAGTCTCGAAAAGGGCTATAGTGTCACCTAAATCGTA

FL8 AATTAACCCTCACTAAAGGGATACCCATGGTACGACGGGCCATTCCTATAGTGTCACCTAAATCGTA

FL11 AATTAACCCTCACTAAAGGGTGGTGGATGGCGCAGTCGGCGACAACTATAGTGTCACCTAAATCGTA

FL12 AATTAACCCTCACTAAAGGGCTCGTCAGTTCAGGTCGGCGATCATCTATAGTGTCACCTAAATCGTA

FL16 AATTAACCCTCACTAAAGGGAGTGAGCGCTTAGTCTGCGCACTGGCTATAGTGTCACCTAAATCGTA

FL20 AATTAACCCTCACTAAAGGGTCCTCATATAGAGTGCGGGGCGTGTCTATAGTGTCACCTAAATCGTA

cApt(FL) AATTAACCCTCACTAAAGGGAGTCAGTCAGTCAGTCAGTCAGTCACTATAGTGTCACCTAAATCGTA

52

53

Figure 2.1. Binding of selected full-length (FL) and variable region (VR) DNA

aptamers to TNF and NfκB assays identify FL11 and VR11 as TNF inhibitors.

(A) Histogram of ELISA signals confirming the binding of biotinylated FL (grey bars)

and VR aptamers (black bars) to immobilized recombinant TNF. The control DNA

aptamers cApt(VR) and cApt (FL) gave ELISA signals comparable to wells treated with

streptavidin-HRP alone (open bar) (B) Histogram of fold increase in luciferase activity in

PANC-1 cells transiently transfected with a DNA plasmid construct expressing the

luciferase gene under the control of NfκB DNA binding promoter. Cells were treated

with TNF (100ng/ml), FL (dark grey bars) and VR aptamers (black bars) or an

inhibitory anti-TNF mAb (light grey bar). Only aptamer VR11 and its full-length

variant FL11 displayed inhibitory activities comparable to a control anti-TNF mAb. (C)

Histogram of TNF induced, NF-κB luciferase activity in HEK293T cells. Cells were

treated with 2 µM (black bars), 200 nM (grey bars) and 20 nM (white bars) of the control

aptamer cApt (VR), the TNF specific DNA aptamers VR11, VR20 as well as 20µg/ml

of the inhibitory anti-TNF mAb. Each histogram bar represents the average

enhancement in observed luciferase activity + SEM (n=9) normalized to that of untreated

samples.

54

2.4.2. DNA aptamer VR11 inhibits the binding of TNFto its receptor.

NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells) is a downstream

eukaryotic transcription factor that is activated by various intra and extra cellular

cytokines, including TNF (Sen and Baltimore, 1986). We selected a cell-based assay

using an NF-κB luciferase reporter assay in order to define aptamer sequences that

inhibited human TNF from binding to its receptor, leading to the loss of a cell

signalling event. Our preliminary screen was conducted using the human pancreatic

cancer cell line PANC-1 transiently transfected with the NF-κB luciferase reporter

(Mamaghani et al., 2009). The luciferase activity was measured 6 hours post-transfection

with only two DNA aptamers, namely VR11 and FL11, displaying an ability to inhibit

TNF-dependent NF-κB expression (Figure 2.1B). We subsequently used a more

sensitive TNF-mediated NF-κB assay employing HEK293T cells [higher transfection

efficiency] and confirmed the inhibitory ability of VR11 in a dose-dependent manner

(Figure 2.1C). The inhibition of TNF-mediated NF-κB signal was observed down to a

VR11 aptamer concentration of 200nM which represented a 35-fold molar excess of

aptamer over TNF. As expected, control aptamers VR20 and cApt(VR) did not show

any inhibition of TNF-mediated signalling suggesting that the inhibitory effects of

VR11 were not due to a concentration-dependent, non-specific binding event.

The L929 mouse fibroblast cell line was subsequently employed to define the

ability of aptamer VR11 to inhibit human TNF-induced cytotoxicity (Matthews et al.,

1987). The TNF CD50 value for L929 mouse fibroblast cells is approximately 3 nM

(Figure 2.2). When L929 mouse fibroblast cells were treated with human TNF in the

presence of aptamer VR11 or an inhibitory TNF mAb, the observed CD50 values were

55

Figure 2.2. Aptamer VR11 inhibits TNF-induced cytotoxicity in murine

fibroblasts. L929 cells were treated with increasing concentrations of TNF alone (▲)

or in the presence of either the inhibitory anti-TNF mAb (∆), inhibitory aptamer VR11

(○), the control aptamer cApt (VR) (□) or aptamer VR20 (■). Each point represents the

average % survival value ± SEM (n=12).

56

shifted to approximately 100 nM and 260 nM respectively representing a 33-fold and 86-

fold decrease in toxicity (Figure 2.2). These CD50 values for aptamer VR11 and TNF

mAb, correspond to approximately a 24-fold and 5-fold molar excess over TNF

respectively. The control aptamer cApt(VR) as well as the TNF-specific DNA aptamer

VR20 showed no effect on the toxicity of TNF (Figure 2). Besides the removal of the 3’

terminal A base of VR11, the truncation of bases from either the 3’ or 5’ ends of VR11

resulted in the loss of its inhibitory activity towards human TNF (Appendix 1).

The binding properties of two TNF-binding DNA aptamers, namely VR11 and

VR20, were further characterized by surface plasmon resonance (SPR) with their binding

constants determined to be in the low nanomolar range [respective Kd values of

7.0±2.1nM and 8.7±2.9nM]. To assess the specificity of VR11 and VR20 for human

TNF, we also used human TNFβ as an analyte. TNFβ was chosen since it binds to TNF

receptors and is the closest known homolog to TNF having highly similar structures

(Figure 3B) despite having low sequence homology (Figure 2.3A). It was subsequently

observed that aptamers VR11 and VR20 showed no binding to TNFβ by SPR (Figure 3E

and 3F). One feature of aptamer VR11 which may contribute to its inhibitory function

may be its slow on- and off-rates (Figure 2.3). Once bound to TNF, VR11 was able to

block TNF-enhanced NO production in macrophages over a period of 24 hours (Figure

2.4B; as referred to as NO2- levels). Specifically, one of the consequences of unregulated

overproduction of TNF is the persistence of inflammation. Nitric oxide (NO) is a key

mediator of inflammation stimulated by TNF that is released by macrophages (Figure

4). We thus used the measurement of nitrite ions [NO2-] in solution as a marker of TNF-

57

Figure 2.3. Binding kinetics of TNF to aptamers VR11 and VR20 as determined by

surface plasmon resonance. (A) Sequence alignment of soluble TNF and the closest

known homolog TNFβ. (B) Alignment of ribbon diagrams derived from the crystal

structures of monomeric TNF (orange, PBD: 1TNF) and TNFβ (blue, PDB: 1TNR).

Fitted binding curves of immobilized inhibitory aptamer VR11 associated with increasing

concentrations of (C) TNF and (E) TNFβ (n=3). Binding curves of immobilized

aptamer VR20 associated with increasing concentrations of (D) TNF and (F) TNFβ

(n=3). (G) Calculated dissociation constants (KD) for TNF binding to aptamer VR11

and VR20.

58

induced inflammatory signalling in the macrophage cell line RAW264.7. Human TNF

alone does not elicit the release of nitrite ions from macrophages. However, a synergistic

effect occurs when macrophages are concomitantly treated with interferon-gamma (IFN-

γ) and TNF (Paludan, 2000). At the 12 and 24 hour time periods, aptamer VR11 was

able to inhibit ~54% and ~45% of the TNF-dependent NO release signal respectively

(Figure 2.4). In comparison, the TNF mAb blocked ~79% and ~74% of the NO release

signal over the same two time periods (Figure 2.4). No inhibition of TNF-induced NO

release by RAW264.7 cells was observed when treated with control aptamers cApt(VR)

and VR20. This sequence thus represents a template that may be useful for modifications

that may yield a suitable product for use in vivo.

59

Figure 2.4. Inhibition of TNF-induced NO2- production in macrophages.

RAW264.7 cells were stimulated for (A) 6 hours or (B) 24 hours with IFNγ, IFNγ and

TNF or IFNγ, TNF in the presence of either the inhibitory anti-TNF mAb, inhibitory

aptamer VR11, control aptamer cApt(VR) and aptamer VR20. The concentration of NO2-

produced in culture medium was determined using the Griess assay. Each point

represents the average amount of NO2- produced ± SEM (n=9).

60

2.4.3. Structural features of DNA aptamer VR11.

The site targeted by VR11 on TNF was not defined in the present study. The epitope

recognized by the mAb to TNF has not been identified to date and as such this probe

could not be used to locate the VR11 binding site on TNF. In addition, the size and high

avidity of this anti-TNF mAb was able to block the binding of VR4, VR11 and VR20

TNF-directed aptamers to their target (see Appendix 2). A structural feature of aptamer

VR11 that may contribute to its inhibitory activity is its predicted G-quadruplex structure

as determined by the QGRS Mapper software (Kikin et al., 2006). G-quadruplexes arise

from the association of four G-bases into a cyclic Hoogsteen H-bonding arrangement.

Identifying G-quadruplex structures within aptamers has been the focus of recent interest

in view of the therapeutic efficacy of previously identified G-quadruplex forming ssDNA

and RNA (Bates et al., 1999; Marchand et al., 2002; Xu et al., 2001). A case in point is

the 15-mer DNA thrombin aptamer which folds into a G-quadruplex structure (Russo

Krauss et al., 2011). Structurally, VR11 incorporates 11 Guanine bases which accounts

for 44% of its sequence. G-quadruplexes typically occur when 3 or more consecutive G

bases are present within a sequence (Randazzo et al., 2012). However, the G-rich content

of VR11 sequence displays an 18-base long stretch containing 4 GG repeats (5’-

GGTGGATGGCGCAGTCGG -3’) which may stabilize the aptamer (Collie and

Parkinson, 2011). Interestingly, the DNA aptamer KS-B, specific for thrombin, also

incorporates 4 GG repeats within its sequence (GGTTGGTGTGGTTGG), and adopts an

intramolecular G-quadruplex structure (monomeric chair form) has proven from its

crystal structure (Macaya et al., 1993; Padmanabhan et al., 1993; Wang et al., 1993).

Thus, the projected G-quadruplex for VR11 may exist in solution. An intramolecular G-

quartet structure (Gilbert and Feigon, 1999; Williamson, 1994) within VR11 would

61

support our SPR data which suggest a 1:1 association of VR11 with TNF. The circular

dichroism spectra of VR11, VR20 and the control aptamer cApt were thus recorded in

order to monitor for the possible occurrence of a G-quadruplex structure within these

DNA aptamers. The sequence of VR20 harbours 4 consecutive G bases [Table 1; 5’-

CGGGGC-3’motif] and its CD spectrum displays a negative ellipticity band centered

around 240 nm as well as a positive band near 260 nm. This spectrum indicates that the

GGGG motif present within VR20 adopts a characteristic G quadruplex structure in

solution with a stacking pattern involving guanosines having identical glycosidic bond

angles giving rise to a four stranded parallel quadruplex structure typically observed for

the motif 5’-TGGGGT-’3 (Hardin et al., 1991; Hardin et al., 1992). The CD spectrum of

control aptamer cApt did not reveal any known spectral features indicative of G-

quadruplexes. As for VR11, its CD spectrum harbours a broad positive band around 290

nm suggesting that guanosines with different glycosidic bond angles within its sequence

are stacked in the presence of sodium or potassium (Figure 2.5A and 2.5B). Unlike the

CD spectrum observed for VR20, the VR11 spectrum does not provide conclusive proof

that the guanosine elements within its 25-bp sequence are arranged in a traditional G-

quadruplex structure. Nevertheless, a structural arrangement involving the stalking of

guanosine bases is present in VR11 and may stabilize its structure. Aptamer stability is

crucial for targeting TNF since the effectiveness of current protein-based therapies can

partly be attributed to their long circulating half-lives such as Etanercept which is linked

to the Fc portion of an IgG1 to help extend its half-life to 4-5 days or the PEGylation of

anti-TNF antibodies (Choy et al., 2002; Mohler et al., 1993). Recently, some of the most

common modifications of aptamers investigated have been their conjugation to

polyethylene glycol (PEG) groups for increased stability (Healy et al., 2004; Willis et al.,

62

1998). In addition, to increase the in vivo circulating half-life of DNA aptamers, modified

nucleotides could be introduced into the libraries during synthesis such as 2’ OH group

with 2’fluoro or 2’ amino, aromatic or alkyl moieties or introduction of Locked Nucleic

Acid (LNA) (Barciszewski et al., 2009; Schoetzau et al., 2003). Also, aptamer libraries

with longer variable regions may identify sequences with a higher G-rich content which

in turn could adopt different G-quadruplex structures and yield improved inhibitors to

TNF (Burge et al., 2006).

63

Figure 2.5. Structural analysis of aptamers VR11 and VR20 by Circular Dichroism.

CD spectra of the 25-bp aptamers VR11, VR20 and cApt in the presence of either a)

Sodium or b) Potassium ions.

64

2.4.4. Immunogenicity of DNA aptamer VR11.

One therapeutic obstacle that DNA aptamers may encounter is their possible activation of

an immune response similar to that of oligodeoxynucleotides containing CpG motifs.

These CpG motifs can promote a Th1 response by signaling through TLR9 which is

expressed on human B cells and plasmacytoid dendritic cells leading to an innate

immune response (Krieg, 2002; Krug et al., 2001). VR11 contains two possible CpG

motif sequences (Figure 2.6A). To test whether this DNA aptamer can induce an innate

immune response, we injected 100 µg of aptamer VR11 and cApt as well as 10 µg of a

known TLR9 ligand CpG ODN in the intraperitoneal cavity of C57BL/6 mice and

quantified the amount of TNF and mouse IL-8 present in their serum after 3 hours. The

CpG ODN positive control yielded a 35-fold increase in TNF and a 24-fold increase in

murine IL-8 serum levels while the control aptamer cApt (which contains no CpG

motifs) and the TNF-specific VR11 DNA aptamer yielded statistically non-significant

increases in both TNF and murine IL-8 cytokine levels as compared to untreated mice

(Figure 2.6B and 2.6C).

65

Figure 2.6. Aptamer VR11 does not cause an innate immune response in vivo. (A)

Potential CpG motifs located in the variable region of aptamer VR11. C57BL/6 mice

(n=3) were given an intraperitoneal injection of 10 µg of CpG ODN, 100 µg of aptamer

VR11 or cApt and the amount of (B) TNF or (C) KC in serum 3 hours after injection

were determined by ELISA.

66

Chapter 3

Blocking the attachment of cancer cells in vivo with DNA aptamers displaying anti-

adhesive properties against the carcinoembryonic antigen

A version of this chapter has been accepted for publication in the journal

Molecular Oncology

Blocking the attachment of cancer cells in vivo with anti-adhesive DNA aptamers

(Molecular Oncology 2013)

Erik W. Orava, Aws Abdul-Wahid, Eric H.B. Huang, Amirul Islam Mallick, Jean Gariépy

Author Contributions:

Erik Orava, Dr. Aws Abdul-Wahid and Dr. Jean Gariépy designed the experiments,

analyzed the data and wrote the paper.

Erik Orava contributed Figures 3.1, 3.2, 3.3, 3.4, 3.5 and 3.7.

Dr. Aws Abdul-Wahid contributed Figure 3.6

Eric Huang performed selection experiments that identify DNA aptamers in this project

as well as helped perform animal studies.

Dr. Amirul Islam Mallick helped perform animal studies.

67

3.0. Abstract

The formation of metastatic foci occurs through a series of cellular events, initiated by

the attachment and aggregation of cancer cells leading to the establishment of

micrometastases. We report the derivation of synthetic DNA aptamers bearing anti-

adhesive properties directed at cancer cells expressing the carcinoembryonic antigen

(CEA). Two DNA aptamers targeting the homotypic and heterotypic IgV-like binding

domain of CEA were shown to block the cell adhesion properties of CEA, while not

recognizing other IgV-like domains of CEACAM family members that share strong

sequence and structural homologies. More importantly, the pre-treatment of CEA-

expressing tumour cells with these aptamers prior to their intraperitoneal implantation

resulted in the prevention of peritoneal tumour foci formation. Taken together, these

results highlight the effectiveness of targeting the cell adhesion properties of cancer cells

with aptamers in preventing tumour implantation.

68

3.1. Introduction

Metastatic forms of cancer account for 90% of all cancer-related deaths (Sporn, 1996).

Cellular processes associated with tumour cell implantation and expansion of

micrometastases at sites distal from a primary tumour site are linked to altered growth

signals, deregulation of proliferative potential, evasion of apoptosis/anoikis and cell and

matrix adhesion events that create and support the formation of metastatic foci (Fidler,

2003; Hanahan and Weinberg, 2000). As such, surface molecules which mediate

intercellular adhesion represent candidate targets for engineering antiadhesive or

antiaggregative therapies. One such surface marker is the carcinoembryonic antigen

(CEA, CEACAM5 and CD66e), a member of the CEACAM family, an oncofetal antigen

over-expressed on the surface of breast, colon, lung and a range of other epithelial cancer

cells and an important cancer biomarker (Gold and Freedman, 1965b; Goldenberg et al.,

1976; Hammarstrom, 1999; Thompson et al., 1991). Under normal physiological

conditions, cells lining the colon express CEA in a polarized manner, with low levels of

this antigen being detected in the intestinal lumen and blood. In contrast, higher levels of

shed CEA are detected in the blood of 95% of patients with colorectal cancer (Chevinsky,

1991; Zhu et al., 2000). The deregulated overexpression of CEA has been linked to

tumour implantation and metastasis (Hammarstrom, 1999).

Membrane-bound CEA is comprised of a 108-amino acid IgV-like N domain

followed by 6 Ig-C like domains (A1, B1, A2, B2, A3 and B3) and a 27-amino acid C-

terminus region which includes a glycosylphosphatidyl inositol (GPI) anchor signal

sequence. The precise biological function of CEA has not been determined, but its

deregulated overexpression by cancer cells is associated with a vast array of functional

roles such as cooperating with novel oncogenes in cellular transformation, inhibition of

69

anoikis, differentiation inhibition via its GPI anchor, protection of tumour cells to

apoptotic stimuli, immunomodulation as well as functioning as an intercellular adhesion

molecule displaying both homotypic and heterotypic cell adhesion properties (Benchimol

et al., 1989; Jessup et al., 2004; Kitsuki et al., 1995; Ordonez et al., 2000; Screaton et al.,

2000; Screaton et al., 1997; Soeth et al., 2001).

A common denominator in CEA-dependent adhesion events is its IgV-like N-

domain which can lead to cellular aggregation through by binding to other N-domains

(defined as homotypic binding and homophilic interactions) or CEA IgC-like A3B3

domains on distinct tumour cells (defined as heterotypic binding and homophilic

interactions) or its association with extracellular markers (defined as heterophilic

interactions) such as its association with α5β1 integrins in binding to fibronectin (Jessup

et al., 1993a; Nicholson and Stanners, 2006; Taheri et al., 2000; Zhou et al., 1993).

Clinically, CEA is used to monitor patients with metastatic disease during active therapy,

as increasing levels of CEA in serum correlate with treatment failure and poor prognosis

(Duffy, 2006; Harris et al., 2007). Importantly, mounting a sustained antibody response

directed at an altered self form of the CEA N domain results in the prevention of tumour

implantation and formation of metastatic tumour foci in CEA transgenic mice (Abdul-

Wahid et al., 2012). This effect has been assigned to the blockage of CEA-dependent

adhesion properties by circulating antibodies as well as by immune mechanisms such as

antibody-dependent cell cytotoxicity (ADCC) and complement-dependent cytotoxicity

(CDC). Similarly, targeting the CEA IgV-like N domain with cyclised peptides or

monoclonal antibodies result in modest blockage of CEA-specific cell adhesion,

migration and invasion in vitro as well as impeding the metastatic potential in mouse

models (Blumenthal et al., 2005; Taheri et al., 2000; Zheng et al., 2011). These findings

70

suggest that CEA-specific, anti-adhesive agents may represent a successful treatment for

metastatic cancers linked to the overexpression of CEA.

Aptamers represent an emerging alternative to protein-based ligands. Specifically,

Aptamers are short single-stranded DNA or RNA oligonucleotides that adopt complex

secondary and tertiary structures that allow for their specific and high affinity binding to

a range of targets that include metal ions, proteins, bacterial cells and tumour cells

(Hamula et al., 2008; Hicke et al., 2001; Morris et al., 1998; Rajendran and Ellington,

2008). Aptamers are derived through an iterative selection process, termed systematic

evolution of ligands by exponential enrichment (SELEX), using a synthetic library

containing a randomized region of 25 to 80 nucleotides flanked by two constant regions

for PCR amplification (Tuerk and Gold, 1990). Alternatively, RNA aptamers are more

labile than DNA oligonucleotides and the cost as well as time required to perform RNA

SELEX searches are greater. More stable variants of RNA aptamers can be assembled

with a modified T7 polymerase to incorporate 2’-fluoro and 2’-O-Me nucleotides.

Our group has reported the expression and purification of a folded recombinant

form of the IgV-like N domain able to elicit an immune response as well as recapitulate

the binding property of glycosylated full length CEA with CEA-expressing cells and

purified human CEA from cancer patients. Importantly, the un-glycosylated form of the

CEA N domain represents a suitable target for identifying aptamers since this domain has

few putative glycosylation sites and that glycosylation of the N domain does not

contribute to the adhesive properties between CEA N domain molecules (Charbonneau

and Stanners, 1999; Krop-Watorek et al., 2002). We report the isolation of two functional

DNA aptamers selected to bind this recombinant form of the IgV-like N domain of CEA

and show its ability to block CEA-mediated cellular interactions and inhibit peritoneal

71

tumour nodule formation from CEA-expressing tumour cells in vivo.

3.2. Materials and Methods

3.2.1. Generation of recombinant CEA modules

Recombinant CEA (rCEA) modules N, FLAG-N and FLAG-A3B3 were expressed and

purified as previously reported (Abdul-Wahid et al., 2012). Briefly, recombinant CEA

domains were purified from inclusion bodies in E. coli under denaturing conditions using

urea (8M). The protein was subsequently purified by nickel-NTA chromatography and

treated with Detoxi-gel (endotoxin removing gel; Thermo Fisher Scientific Inc.) to

remove remaining traces of bacterial lipopolysaccharides (LPS).

3.2.2. Aptamer selection and cloning

The initial ssDNA library contained a central randomized sequence of 25 nucleotides

flanked by two primer regions with the sequence 5’ GAC GAT AGC GGT GAC GGC

ACA GAC G-(25N)-CGT ATG CCG CTT CCG TCC GTC GCT C 3’. The forward

primer 5’ GAC GAT AGC GGT GAC GGC ACA GAC G 3’ and reverse primer 5’ GAG

CGA CGG ACG GAA GCG GCA TAC G 3’ were used for selection and cloning (IDT

Technologies, Inc.). A 50 nmol aliquot of the library was first counter-selected against

Ni-NTA magnetic beads prior to selection against rCEA N in order to reduce non-

specifically bound DNA species. The resulting sub-library was then exposed to 10 µg of

His-tagged rCEA N domain immobilized onto Ni-NTA beads suspended in 1 mL of

Selection Buffer (150 mM NaCl, 50mM Tris pH 8.0) at 37°C for 1 hour. Unbound DNA

oligonucleotides were washed away with a 10-fold excess of selection buffer and DNA-

72

protein complexes were eluted from the recovered beads using an imidazole containing

buffer (Selection buffer with 240mM imidazole). The ssDNA component was

precipitated with sodium perchlorate/isopropanol and recaptured using a silica

membrane-based purification system (Qiagen Inc., Mississauga, Ontario). The DNA

aptamers were then amplified by asymmetrical PCR using a 10-fold excess of forward

primer. After every three subsequent rounds of selection, the amount of target was

reduced in half to increase the selection pressure to capture the tightest binding species.

After 12 rounds of selection, the bound sequences were amplified by PCR to produce

double stranded products, cloned into a pCR4-TOPO TA vector (Invitrogen) and

sequences were analyzed using BioEdit sequence alignment editor software (Ibis

Therapeutics, Carlsbad, USA).

3.2.3. Aptamer-based inhibition of CEA homotypic interactions

An enzyme-linked immunosorbent assay (ELISA)-based binding assay was employed to

identify aptamers capable of inhibiting homotypic interactions between FLAG-tagged

rCEA N domain and either rCEA A3B3 or rCEA N. Briefly, 96-well flat-bottomed Falcon

microtiter plates (Becton-Dickinson Biosciences, Franklin Lakes, NJ) were coated with

either N or A3B3 domain (1 µg/well in 100µl) in coating buffer (0.2 M

carbonate/bicarbonate, pH 9.4) at 37ºC. Plates were then blocked with BSA (1% in PBS)

and salmon sperm DNA (200 µl; 10 µg/mL) for 1 hour at room temperature then

aptamers were added (200 µl; 25 µg/ml, 1µM) overnight at 4 ºC in PBS-T (0.05%

Tween-20). Plates were then washed three times with PBS-T and FLAG-tagged rCEA N

domain was added (100 µl; 10 µg/ml, 670 nM) for 1 hour at room temperature after

being incubated with a given aptamer (100 µl; 25 µg/ml , 1µM) for 1 hour at room

73

temperature. After wash steps with PBS-T, the remaining bound FLAG-tagged rCEA N

was detected by incubating the plates for 1 hour at room temperature with horseradish

peroxidase (HRP) coupled anti-FLAG monoclonal antibody M2 (1:2500) dilution;

Sigma-Aldrich). All experiments were performed in quadruplicate.

3.2.4. Cells lines and growth conditions

The murine colonic carcinoma cell lines MC38.CEA and MC38 were kindly provided by

Dr. Jeffrey Schlom (National Cancer Institute, Bethesda, Maryland). The cervical

adenocarcinoma cell line HeLa (ATCC No CCL-2) as well as transfected cell lines

HeLaCEACAM1

, HeLaCEACAM3

, HeLaCEACAM5

, HeLaCEACAM6

and HeLaCEACAM8

used for

flow cytometry experiments were a gift from Dr. Scott Gray-Owen (University of

Toronto, Toronto, Canada). All cell lines were cultured at 37ºC, 5.0% CO2 in Dulbecco’s

modified Eagle’s medium supplemented with 10% fetal bovine serum, penicillin (100

U/mL) and dihydrostreptomycin (100 µg/mL).

3.2.5. Aptamer-based inhibition of homophilic cellular adhesion

The ability of aptamers to inhibit CEA-dependent cellular adhesion was measured in

real-time using an xCELLigence RTCA SP label-free, impedance-based cell sensing

device (Roche Applied Sciences, Laval, Canada). The inhibition of CEA-dependent

cellular adhesion was monitored using MC38.CEA and MC38 cells (2.5 × 104 cells per

well) grown in complete medium as described above. Cell suspensions were dispensed

alone, with aptamers (100 µl, 250 µg/ml, 10µM) or in the presence of the rCEA N

domain acting as a positive control (100 µl, 50 µg/ml, 3.3 µM) into wells of a 96-well

74

microtiter plate incorporating a sensor electrode array (E-plates) that had been precoated

with the rCEA N domain, rCEA A3B3 domain or BSA (1µg/well). Cell attachment was

quantified as a change in relative impedance, termed cell index (CI) (Matrone et al.,

2010). The adhesion of MC38.CEA cells in the absence of aptamers served as a positive

control. Data was collected after 3 hours to allow cells to fully adhere to protein-coated

plates but before the start of cell proliferation. All experiments were performed in

duplicate and were repeated three times.

3.2.6. Aptamer binding to CEA on cells as measured by flow cytometry

The binding specificity of aptamers N54 and N56 to the N domain of CEA was assessed

by flow cytometry using the cell lines MC38.CEA (CEA+) and MC38 (CEA

-) as well as

HeLa cells expressing different members of the CEACAM family. Aptamers N54, N56

and the control aptamer cApt were synthesized with a 5’end Cy5 fluorophore (IDT

Technologies, Inc., Coralville, Iowa). Cells were grown to mid-log phase and detached

using an enzyme-free EDTA based cell dissociation buffer (Sigma-Aldrich, St. Louis,

MO) washed with PBS (-CaCl2, -MgCl2) and resuspended at a concentration of 106

cells/mL in cold PBS. Aptamers were then added to 1.0×106 cells at a final concentration

of 200 nM in 1 mL. The expression of CEACAMs on HeLa transfected cells lines was

confirmed using a FITC-labeled polyclonal anti-CEACAM antibody (Gift from Dr.

Gray-Owen, University of Toronto, Toronto, Canada). CEA expression was confirmed

with a CEA-specific COL-1 antibody (Invitrogen Inc.). Aptamers and antibody were

allowed to bind for 2 hours at 4ºC. Cells were then washed three times in cold PBS and

subsequently analysed using a FACScan (BD Biosciences, Franklin Lakes, NJ).

75

3.2.7. Inhibition of MC38.CEA tumour implantation

For tumour implantation studies, 5.0 × 105 MC38.CEA cells were co-injected in the

intraperitoneal cavity of C57BL/6 mice with either aptamers N54, N56, N71, cApt or no

aptamer (saline) (200 µl; 2.5mg/mL, 100 µM). After 21 days, mice were sacrificed and

the number of nodules and their volumes were recorded following dissection, as

previously described (Abdul-Wahid et al., 2012). Specifically, the length and width of

tumour nodules were measured using microcallipers. Tumour volumes were calculated

using the modified formula where the volume of the tumour (mm3) equals [(x

2 × y)/2];

where x and y represent the transverse and longitudinal diameters of the tumour

respectively. Each group consisted of 3 females and 2 male mice. All animals were kept

under standard pathogen-free conditions at the Ontario Cancer Institute animal facility.

Experiments were performed under the approval of the local animal welfare committee

and in accordance with the rules and regulations of the Canadian Council for Animal

Care.

3.2.8. Aptamer cytotoxicity assay

MC38.CEA cells were seeded for 24 hours before cell viability experiments were

performed in 96-well flat-bottom microtiter plates at a density of 5.0×103

cells/well in

DMEM medium containing 10% FBS. Aptamers at a concentration of either 250 µg/ml

(10 µM) or 2.5 mg/ml (100 µM) were incubated with the cells in medium for 24 hours at

a volume of 100 µl. Cells were then washed with warm PBS and incubated in complete

medium for another 24 hours. The viability of adherent cells was subsequently

determined using a sulforhodamine B assay (Skehan et al., 1990). The absorbance of the

sulforhodamine B signal in each well was read at 570 nm using a plate reader. Each

76

experiment was performed in quadruplicate and repeated three times.

3.2.9. Analysis of aptamer-based innate immune responses

The aptamers N54 (200 µl; 500 µg/ml, 20µM) and cApt (200 µl; 500 µg/ml, 20µM) as

well as a TLR9 ligand CpG ODN (5’-TCCATGACGTTCCTGACGTT-3’; type B

murine, ODN 1826, Invivogen, CA; (200 µl; 50 µg/ml, 500nM) were dissolved in sterile

USP saline. These oligonucleotides (200µl) were administered intraperitoneally to 6-8

weeks old C57BL/6 mice. An untreated group of mice received an injection of 200 µl of

saline alone. Three hours after injection, mice were sacrificed and their serum was

collected for analysis. Serum IL-8 and TNFα concentrations were determined using the

DuoSet ELISA development kits for mouse CXCL1/KC (murine IL-8, R & D systems

Inc.) and murine TNFα (R & D systems Inc.) as outlined by the manufacturer.

3.2.10. Statistical methods and data analysis

Data sets derived from individual groups of mice were compared using student’s t-test

and grouped data sets were analyzed by ANOVA. Statistical analyzes and graphs were

assembled using GraphPad PRISM (version 5.01, GraphPad software for Science, San

Diego, CA). P values ≤ 0.05 were considered significant unless otherwise indicated.

Flow cytometry statistics were analyzed using WinMDI (version 2.8, Windows multiple

document interface for flow cytometry, Scripps Research Institute).

77

3.3. Results

3.3.1. Generation of DNA aptamers displaying inhibitory properties of CEA-

dependent homotypic adhesions

Short, 25-base long DNA aptamer sequences specifically recognizing a recombinant

protein coding for residues 1-132 of mature CEA (referred to as rCEA N domain) were

identified by the SELEX approach (Figure 3.1). Specifically, twelve iterative rounds of

PCR-based selection were performed yielding six unique DNA aptamer sequences

(Figure 1A). These six sequences, labelled N54, N56, N57, N59, N65 and N71, as well

as a control aptamer (cApt) were synthesized with their primer regions and subsequently

tested using an ELISA-based assay to assess their ability to directly block the binding of

the IgV-like N domain to either rCEA IgC-like A3B3 domains (Figure 3.1B) or to itself (to

rCEA N domain; Figure 1C). Aptamers N54 and N56 were the only aptamers found to

display inhibitory properties of both types of binding events, where N54 inhibited 39% of

the rCEA N→rCEA A3B3 signal and 45% of the rCEA N→rCEA N signal relative to

control wells (in the absence of aptamer. Aptamer N56 inhibited 32% of the signal

associated with either homotypic interactions (Figure 3.1B and 3.1C). Interestingly,

aptamer N65 shares a nearly identical sequence to N54 with the exception of two bases

flanking the ends of the sequence and a C to T substitution in the sequence [5’ GCTGAC

3’]. This finding suggests that the antiadhesive property of N54 is sensitive to even a

single base change in its sequence.

78

Figure 3.1. Aptamers selected to bind to the CEA IgV-like N domain inhibit

homotypic adhesion events. (A) Aptamer sequences identified using the SELEX

procedure. CEA N-domain-specific aptamers inhibit homotypic binding events. ELISA

plates (96-well) were pre-coated with (B) rCEA A3B3 or with (C) the rCEA N domain.

Aptamers selected to the N-domain and control aptamer (cApt) were added to the wells,

incubated overnight at 4°C, washed followed by the addition of FLAG-tagged rCEA N

incubated with aptamers for 1 hour and added to the appropriate wells. Bound FLAG-

tagged rCEA N was detected using an anti-FLAG HRP-coupled M2 mAb. Each bar

represents the average percent of binding ± SEM (n=4).

79

3.3.2. Aptamers N54 and N56 inhibit homophilic cellular adhesion

CEA-dependent homophilic interactions are a prerequisite to the expansion of metastatic

tumour foci. As such, the inhibitory capacity of aptamers N54 and N56 was determined

using the CEA-expressing murine cell line MC38.CEA and its parental CEA-negative

cell line MC38. MC38.CEA cells adhere to the wells of impedence-based plates (E-

plates) pre-coated with the rCEA N and A3B3 domains, but only weakly to wells coated

with BSA (Figure 3.2A). Addition of aptamers N54 and N56 resulted in a loss of 59%

and 49% of the signal arising from homophilic cellular adhesion between the

immobilized CEA N domain and MC38.CEA cells respectively after 3 hours. This time

point was chosen as it was observed that cells were able to fully adhere without the

presence of inhibitors (Appendix 4). Similarly, a 45% and 51% decrease in signal was

observed for MC38.CEA cells interacting with the immobilized rCEA A3B3. In contrast,

the control aptamers cApt and N71 showed no significant inhibition of homophilic

interactions (Figure 3.2A). As a positive control, the soluble rCEA N domain was pre-

incubated with MC38.CEA cells and resulted in a 59% and 44% loss of binding signal of

these cells to the immobilized rCEA N or A3B3 domain respectively. As expected,

aptamer treatments as well as BSA and rCEA N domain showed no ability to inhibit

MC38 cells from adhering to rCEA N- or BSA-coated plates (Figure 3.2B).

Subsequently, the inhibitory effects of aptamers N54 and N56 (as 75-base long aptamers)

on cell adhesion were titrated in a dose-dependent manner (Figure 3.2C). A significant

inhibition of MC38.CEA adhesion was observed starting at an aptamer concentration of 1

µM. Control aptamers cApt and N71 showed no effect suggesting that the inhibition of

homophilic cellular adhesion by aptamers N54 and N56 was not due to a concentration

dependent non-specific effect.

80

Figure 3.2. Addition of aptamers specific to the CEA N domain inhibits homophilic

cellular adhesion. (A) Addition of aptamers N54 and N56 significantly inhibited CEA-

dependent binding of MC38.CEA cells to wells coated with rCEA N domain and rCEA

A3B3 while not affecting their binding to BSA coated wells. (B) Addition of aptamers

N54 and N56 had no effect on CEA- MC38 cells adhering to wells coated with rCEA N,

rCEA A3B3 or BSA. (C) Dose-dependent inhibition of CEA-mediated cellular adhesion

of MC38.CEA to rCEA N coated wells was monitored in the presence of increasing

concentrations of specific and control aptamers. Each bar in Panels A and B represents

the average cell index values observed ± SEM (n=6). In panel C, each bar represents the

average percentage of cell binding ± SEM (n=6).

81

To further characterize the inhibitory properties of aptamers N54 and N56, we

constructed series of truncated forms to determine the minimal binding regions required

to retain their inhibition of CEA-dependent homophilic adhesion (Figure 3.3A). Aptamer

N54 did not retain its ability to inhibit cellular adhesion after a total of 18 bases were

removed from both ends of its sequence (aptamer N54-57; Figure 3B). Interestingly,

although full length N56 was not as effective as N54 in inhibiting MC38.CEA cell

adherence (36% compared to 48% inhibition respectively), N56 did retain its inhibitory

ability when truncated down to 32 bases with no significant decrease in the adherence of

cells as compared to the full length sequence (Figure 3.3B). Further truncations of N56

however yielded inactive inhibitors of cell adhesion.

82

Figure 3.3. Minimal regions required for aptamer inhibition of homophilic cellular

adhesion. (A) List of aptamer sequences synthesized to determine the minimum aptamer

regions needed to inhibit CEA-dependent binding of cells to immobilized CEA N

domain. Bold italic letters represent the variable region of aptamer sequences identified

by SELEX searches. (B) Inhibition of CEA-dependent binding of MC38.CEA cells to

rCEA N with full length and truncated aptamer N54 and N56 sequences. Each bar

represents the average percentage of cell binding to wells ± SEM (n=6).

83

3.3.3. Aptamers N54 and N56 specifically recognize the N domain of CEA

The IgV-like N domain of CEA is homologous in sequence to that of other CEACAM

members. Specifically, the alignment of CEACAM1, CEACAM3, CEACAM5 (CEA),

CEACAM6, and CEACAM8 IgV-like N domain primary structures indicate that 61% of

residues along their sequences are identical with up to 84 % of residues being similar

(Figure 3.4A). In addition, the known structures of the CEACAM1, CEACAM 5 and

CEACAM8 N domains also indicate that these IgV-like N domains adopt the same

folded structure (Figure 3.4B) (Fedarovich et al., 2006; Korotkova et al., 2008).

Accordingly, the ability of aptamers N54 and N56 to specifically recognize the N domain

of CEA and not IgV-like N domains of related CEACAMs was assessed by monitoring

the binding of Cy5-labelled aptamers to CEACAM+ and CEACAM

- cells by flow

cytometry. Specifically, HeLa cells were stably transfected to express CEACAM1,

CEACAM3, CEACAM5, CEACAM6 or CEACAM8.

Analysis of the CEACAM-expressing HeLa cells as well as the CEA+

MC38.CEA cells, CEA- HeLa and MC38 cells demonstrated that aptamers N54 and N56

specifically bound to MC38.CEA and HeLaCEACAM5

cells while the irrelevant cApt

control aptamer showed no binding to any of the cells tested (Figure 3.5). The FITC-

labeled polyclonal anti-CEACAM antibody confirmed the expression of individual

CEACAMs in all transfected HeLa cell lines and the CEA antibody COL-1 confirmed

the presence of CEA (Figure 3.5). Aptamer N56 binding to MC38.CEA and HeLaCEACAM5

resulted in a ~7-fold increase in mean fluorescence signal intensity (Figure 3.5B,D).

Aptamer N54 binding to MC38.CEA and HeLa CEACAM5

resulted in a greater increase in

binding as shown by a ~ 16-fold and ~14-fold increase in mean fluorescence intensities

respectively (Figure 3.5B,D). Similar binding patterns were seen for the endogenously

84

Figure 3.4. Alignment of the IgV-like N-domains of CEACAM family members. (A)

Sequence alignment of the N-domain of CEACAM family members involved in cell-cell

interactions. (B) Structural alignment of the N-domains of CEACAM1 (red; PDB:

2GK2), CEA (blue; PDB: 2QSQ) and CEACAM8 (yellow; PDB:2DKS). (C) The ABED

face (red) and the CFG face (blue) of CEA. Residues 42 to 46 (NRQII) and residues 80

to 84 (QNDTG) are shown in yellow. Structures were obtained from the protein data

bank (PDB) with accession numbers shown.

85

Figure 3.5. Aptamer binding to CEA+ and CEA- cells using Cy5 labelled aptamers

by flow cytometry. Cy5-labelled aptamers N54, N56 and cApt were incubated with

CEA- cells (A) MC38, (C) HeLa or CEA

+ (B) MC38.CEA and (D) HeLa

CEACAM5.

Aptamers N54 and N56 did not detect the presence of other CEACAM family members

as shown by low mean fluorescence intensities observed for (E) HeLaCEACAM1

, (F)

HeLaCEACAM3

, (G) HeLaCEACAM6

, (H) HeLaCEACAM8

transfected cell lines. A FITC-labeled

polyclonal anti-CEACAM antibody was used to confirm the surface expression of

CEACAM proteins and an anti-CEA mAb to monitor for the presence of CEA. The auto-

fluorescence signal arising from unlabelled cells is shown for cells alone. (I) Binding of

Cy5-labelled aptamers N54, N56 and cApt to MC38.CEA cells. Data points represent

average mean fluorescence intensity values ± SEM (n=3).

86

CEA expressing cell lines MCF-7, HT29 and BxPC3 (Appendix 5). The binding of Cy5-

labeled aptamers N54 and N56 to MC38.CEA cells was also determined as a function of

concentration (Figure 3.5, panel I). Using a single site binding model, it was calculated

that aptamers N54 and N56 display binding constants (Kd) of 45 ± 11 nM and 78 ± 24

nM respectively to their CEA target on MC38.CEA cells. Together, these findings

suggest that the derived N54 and N56 aptamer sequences specifically bind their cognate

target with high affinity.

3.3.4. Addition of aptamers N54 and N56 to MC38.CEA cells reduces tumour

implantation in vivo

The ability of aptamers N54 and N56 to inhibit CEA-dependent tumour implantation and

subsequent metastasis was addressed by monitoring their ability to interfere with the

implantation of murine MC38.CEA tumour cells in the peritoneal cavity of C57BL/6

mice. Briefly, murine MC38.CEA cells were pretreated for 30 minutes at 37°C with 500

µg (200 µl of a 100 µM concentration) of control aptamers cApt, N71, inhibitory

aptamers N54, N56 or untreated and co-injected directly into the peritoneal cavity of

mice (Figure 3.6A). Mice were then euthanized after 21 days to assess tumour

implantation by recording the number of tumour nodules as well as their volumes. Post-

mortem analyses of the dissected mice showed that tumour masses were limited to the

peritoneal cavity, and that tumour nodules were numerous in the control animal groups

given either no aptamer, cApt or N71 (Figure 3.6B,C). In contrast, implanted MC38.CEA

cells treated with aptamers N54 and N56 generated significantly fewer tumour nodules

(Figure 3.6B). Specifically, aptamer N56 reduced tumour implantation as seen by an

average decrease of 48% of cumulative tumour volume while N54 had a significant

87

decrease of 57% compared to untreated mice (Figure 3.6C). Control aptamers cApt and

N71 showed no significant decrease in tumour implantation in relation with the control

group that was just implanted with MC38.CEA cells (untreated). The inhibitory effect of

aptamers N54 and N56 was even more dramatic in terms of implantation when tumour

nodules were enumerated and compared to control groups (Figure 3.6D). Specifically, in

the group pretreated with aptamer N54, four of five mice did not develop a secondary

tumour nodule compared to untreated groups which had an average of ~6 tumour

nodules. Mice treated with control aptamer cApt and N71 showed no significant decrease

in the number of tumour foci when compared to the aptamer-untreated group.

88

Figure 3.6. Pre-treatment of CEA-expressing MC38.CEA cancer cells with CEA-

specific aptamers reduces tumour implantation in vivo. (A) Experimental design of

implantation studies. MC38.CEA cells (5 × 105) were co-administered intraperitoneally

into C57BL/6 mice with aptamers. Untreated cells served as a positive control for tumour

implantation. Animals were sacrificed 21 days post implantation. (B) Photographs

illustrating the presence of MC38.CEA tumour nodules in the peritoneal cavity at Day 21

post-implantation. (C) Cumulative tumour volumes in each group of mice (n=5) after 21

days. (D) The number of tumour nodules in the peritoneal cavity in each treatment group

(n=5) after 21 days post-implantation.

89

3.3.5. Aptamers specific to the CEA N domain are not cytotoxic and aptamer N54

does not activate an innate immune response

Cytotoxicity studies on MC38.CEA cells treated with aptamers and rCEA N were

conducted using the sulforhodamine B cell viability assay to determine if the decrease in

tumour implantation seen was due to a cytotoxic effect of the aptamers (Matthews et al.,

1987). MC38.CEA cells were incubated in DMEM complete media for 24 hours in the

presence of either 250 µg/ml of aptamer (100 µl; 10 µM, same as used for in vitro

experiments) or 2.5 mg/ml (100 µl; 100 µM), which represented the concentration of

aptamer pretreated MC38.CEA cells prior to tumour implantation (Figure 3.7A). None of

the aptamers incubated with MC38.CEA cells led to a loss of cell viability at these

concentrations, which suggests that the reduction in tumour implantation observed for

N54 and N56 was not due to aptamer-based cytotoxicity towards MC38.CEA cells.

In view of its potency as an inhibitor of CEA-mediated cell adhesion, we also

tested whether aptamer N54 could induce an innate immune response similar to

oligodeoxynucleotides containing CpG motifs, which promote Th1 responses by

signaling through TLR9. Mice received an i.p. injection of 100 µg (200 µl; 20 µM) of

control aptamer (cApt), aptamer N54 or 10 µg (100 µl; 500 nM) of a known TLR9 ligand

CpG ODN and the amount of TNFα and mouse IL-8 present in their serum was

quantified after 3 hours. Activation of TLR9 with the CpG ODN increased the serum

levels of mouse IL-8 by ~45-fold while aptamers cApt N54 yielded statistically non-

significant increases in serum IL-8 (Figure 3.7B). Similar results were observed in terms

of increased production of serum TNFα by CpG ODN but not by aptamers cApt and N54

(Figure 7C). These results suggest that N54 does not activate an in vivo innate immune

response associated with the secretion of inflammatory cytokines.

90

Figure 3.7. Aptamer N54 is noncytotoxic and does not activate innate immune

responses. (A) A sulforhodamine B cell viability assay was performed on MC38.CEA

cells treated with DNA aptamers or rCEA N at the concentration used for in vivo studies

(white bars) or at a 10-fold higher concentration (black bars). Aptamer N54, cApt or CpG

(positive control) were injected intraperitoneally into C57/BL6 mice. The animals were

sacrificed after 3 hours for analysis of TLR-9 dependent activation of (B) IL-8 and (C)

TNF-α secretion (n=3).

91

3.4. Discussion

Cancer cells typically display molecular signatures on their surface which have been

exploited more recently as targets for aptamers to chaperone therapeutic cargos into cells

(Orava et al., 2010). In the present study, functional DNA aptamers were developed

against the key homotypic binding domain of CEA generated from E. coli. We selected

DNA aptamers, as opposed to RNA aptamers, because they are more stable [less

susceptible to hydrolysis], less expensive and more easily derived by SELEX approaches

than RNA aptamers. Functional aptamers acting as mimics of molecules linked to

cellular signalling pathways have been reported and in some instances shown to block

events as diverse as angiogenesis, thrombosis, viral replication and inflammatory

responses (Bless et al., 1997; Bock et al., 1992; Boiziau et al., 1999; Chou et al., 2005;

Muller et al., 2009; Ng et al., 2006; Paborsky et al., 1993; Schneider et al., 1995). In the

context of adhesion, several aptamers have previously been reported which bind to a

group cell surface glycoproteins known as selectins (Huang et al., 1997; Schmidmaier

and Baumann, 2008).

Specifically, a phosphorothioate-modified aptamer to E-selectin named ESTA-1

bound with nanomolar affinity and inhibited over 75% of sialyl lewis X positive cells

from adhering to endothelial cells overexpressing E-selectin in vitro (Mann et al., 2010).

As well, an RNA aptamer to P-selectin known as ARC5690 which contained 2’-fluoro

pyrimidine and 2’-methoxy purines inhibited the adhesion of sickle red blood cells and

leukocytes to endothelial cells by 90% and 80% respectively in a sickle cell disease

model in vivo (Gutsaeva et al., 2010). Furthermore, a DNA aptamer to L-selectin

inhibited L-selectin-mediated rolling of lymphocyte and neutrophils on activated

endothelial cells in vitro as well as blocking lymphocyte trafficking to the lymph nodes in

92

vivo (Hicke et al., 1996). The present study highlights functional DNA aptamers able to

specifically inhibit CEA-expressing tumour cells from forming metastastic tumour foci.

Importantly, CEA plays a key role in tumour progression and the establishment of

metastatic foci by CEA-expressing tumours (Berinstein, 2002). CEA has been shown to

function as an intercellular adhesion molecule, as a function of reciprocal homophilic

binding between N and A3 domains (Jessup et al., 1993a; Taheri et al., 2000; Zhou et al.,

1993), an attribute that contributes to its tumourigenicity (Camacho-Leal and Stanners,

2008; Samara et al., 2007). Specifically, its involvement in homotypic and heterotypic

interactions correlates with the level of implantation and proliferation of CEA-expressing

tumours at distal sites such as the lungs, liver and peritoneal cavity (Asao et al., 1991;

Samara et al., 2007; Zhou et al., 1993; Zimmer and Thomas, 2001). CEA molecules bind

in a homotypic manner by virtue of the interaction between their N and A3 domains of

opposing CEA molecules, events which results in the formation of a network of

homophilic cellular contacts between CEA-expressing cells causing cell aggregation,

implantation and invasion of organs (Hostetter et al., 1990; Jessup et al., 1993b; Zhou et

al., 1993; Zimmer and Thomas, 2001). CEA has also been shown to heterotypically

interact with additional binding partners (Benchimol et al., 1989; Oikawa et al., 1989).

We hypothesized that blocking the homotypic binding of CEA would represent an

effective strategy for inhibiting its adhesive behaviour.

Using the CEA IgV-like N domain as a target for aptamer selection using the

SELEX process, we identified two unique 25-base long aptamers, termed N54 and N56

that possess the ability to inhibit CEA-mediated homotypic interactions (Figure 3.1). Of

the two aptamers, N54 displayed a moderately greater ability to inhibit these interactions

that was comparable to tumour-neutralizing antisera derived from mice vaccinated with

93

the rCEA N domain (Abdul-Wahid et al., 2012). Addition of N54 significantly inhibited

the binding of murine CEA-expressing MC38.CEA cells to wells coated with rCEA N

domain yet had no effect on CEA- MC38 cells adhering to plates coated with rCEA N

(Figure 3.2A and 3. 2B). These results demonstrate that aptamers N54 and N56 are able

to effectively block the homotypic interaction between the CEA N domains and CEA N

domain to rCEA A3B3.

Aptamers N54 and N56 differ greatly in the minimal regions needed to inhibit

homophilic cellular adhesion. Aptamer N54 requires both its primer and variable regions

as the deletion of a total of 18 bases from its 3`and 5` ends resulted in a loss of its

inhibition of CEA-mediated cell adhesion from ~50% to ~16% relative to the full length

sequence (Figure 3A and 3B). However, aptamer N56 can be truncated from 75 bases

down to 32 bases while retaining its inhibitory function (Figure 3.3A and 3.3B). Further

deletions to N56 however resulted in a loss of its inhibition of CEA cell adhesion

function.

Several members of the CEACAM family have been shown to be involved in

cell-cell interactions sharing a high level of sequence identity within their N domain with

CEA. Yet, aptamers N54 and N56 were able to uniquely bind to the N domain of CEA

(Figures 3.4 and 3.5). Structurally, the N domain of CEACAM1, CEAMCAM3, CEA,

CEACAM6 and CEACAM8 adopt an identical Ig V-like fold displaying defined faces.

The N domain of CEACAMs displays two faces: an ABED face and an opposite CFG

face (Korotkova et al., 2008; Taheri et al., 2000). The CFG interface of CEACAMs has

been shown to mediate CEACAM-CEACAM interactions (Figure 3.4 C) (Markel et al.,

2004). Furthermore, peptides to residues 42 to 46 (NRQII) and residues 80 to 84

(QNDTG) on CEA were found to modestly block CEA-mediated cellular aggregation

94

(Taheri et al., 2000) at concentrations >150-fold higher than aptamers N54 and N56.

Both of these peptide sequences are found on the CFG face of CEA (Taheri et al., 2000).

Interestingly, the peptide NRQII corresponding to residues 42 to 46 is unique to CEA

while the sequence QNDTG is found in CEACAM1 and CEACAM6. In view of the

specificity of aptamers N54 and N56 in binding to CEA, it would suggest that these

aptamers might interact with residues in the vicinity of peptide NRQII on the CFG face

of the CEA N domain.

One issue facing the use DNA aptamers as therapeutics is their short half-life in

vivo due to nuclease degradation and their rapid clearance through the kidneys (based on

their low molecular weights). The circulation half-lives of aptamers can be increased by

conjugating them to polyethylene glycol (PEG) moieties. As well, the stability in serum

can be increased by substituting nucleotides with modifications of either sugar residues

(eg. 2’ OH group with 2’-amino, 2’-fluoro 2’-O-methyl), the phosphate (eg.

Phosphorothioate) or of the base (2’-thiopyrimidine, methyl or trifluoromethyl) (Healy et

al., 2004; Latham et al., 1994; Mayer, 2009; Schoetzau et al., 2003; Willis et al., 1998).

Also, Locked Nucleic acids (LNA) have been introduced within their structures to

increase stability (Barciszewski et al., 2009). However, the in vivo tumour implantation

mouse model used in this study to assess the ability of aptamers N54 and N56 to inhibit

the adhesion and proliferation of murine MC38.CEA cells in the peritoneal cavity of

mice were performed with no modification to the aptamer structure. Both of these

aptamers were effective in inhibiting tumour implantation in the peritoneal model (Figure

3.6B). Interestingly, an RNA aptamer to CEA has recently been reported that prevents

hepatic metastasis (Lee et al., 2012). However, this RNA aptamer differs from the present

DNA apamers N54 and N56 in two key aspects. First, this RNA aptamer prevents the

95

binding of CEA to death receptor 5 (DR5), thus contributing to the prevention hepatic

metastasis by inducing anoikis. In contrast, aptamers N54 and N56 are non-cytotoxic

towards MC38.CEA cells and the treatment of MC38.CEA cells with aptamers N54 and

N56 did not lead to growth arrest/reduction (SRB cell viability assay) in relation to

untreated cells (Figure 3.7A). Secondly, the reported RNA aptamer to CEA was shown to

bind the PELPK motif present at residues 108-122 of CEA. This motif is present on

CEACAM1 and CEACAM 6: two broadly-expressed CEACAMs on normal tissues,

suggesting that this aptamer may not be specific for CEA (possible off-target effects). In

contrast, aptamers N54 and N56 showed specific binding to CEA suggesting that their

anti-adhesive effects focus on the specific inhibition of homotypic CEA interactions

(Figure 3.4). Importantly, the murine cell line MC38.CEA used for both in vitro and in

vivo studies, does not express other human CEACAM members on its surface. In view of

the specificity of aptamer N54 and N56 for the N domain of CEA only, these aptamers

are not expected to inhibit possible homophilic cellular interactions involving other

CEACAM members present on tumour cells.

Finally, DNA aptamers are generally considered to be non-immunogenic (Foy et

al., 2007; Yu et al., 2009). However, to confirm that aptamer N54, as an example, did not

generate an inflammatory innate immune response as seen for CpG ODN (a ligand for

TLR-9), mice were given via an intraperitoneal injection, a bolus of either an irrelevant

aptamer (cApt), aptamer N54 or a positive control CpG ODN, and their sera analyzed

after 3 hours for the production of inflammatory cytokines IL-8 and TNFα (Figure 3.7B

and C). As projected, aptamer N54 did not generate a serum increase in CpG ODN-

associated cytokines suggesting that this aptamer is non-immunogenic.

In summary, this study reports the identification of two DNA aptamers that are

96

able to specifically recognize the N domain of the cancer-associated antigen CEA and

block its homophilic adhesive properties. These aptamers specifically bound to the IgV-

like N domain of CEA, with a dissociation constant in the nanomolar range and

significantly inhibited tumour implantation of murine MC38.CEA cells by virtue of their

antiadhesive properties. As well, aptamer N54 displayed no cytotoxicity towards

MC38.CEA cells and did not trigger a TLR-9 dependent innate immune response.

97

Chapter 4

Aptamer-targeted liposomes for the computed tomography (CT)

imaging of breast cancer tumours

Erik W. Orava, Michael Dunne, Jinzi Zheng, Huang Huang, Christine Allen,

Jean Gariépy

Author Contributions:

Erik Orava, Dr. Jean Gariépy and Dr. Christine Allen designed experiments, analyzed the

data and prepared a manuscript.

Erik Orava contributed Figure 4.1, 4.2, 4.3, 4.4

Michael Dunne and Dr. Jinzi Zheng helped prepare the liposomes used in this study as

well as perform the animal imaging study at STTARR (Table 4.1).

Huang Huang was involved in preliminary experiments in characterizing aptamer

liposome conjugation.

98

4.0. Abstract

The in vivo targeting of nanoparticles such as pegylated liposomes to tumour cells can be

enhanced by introducing tumour marker-specific DNA aptamers on their surface. We

have recently generated DNA aptamers that specifically recognize either the mucin

MUC1 protein tandem repeat (40-base long MUC1-VR) or the N domain of the

carcinoembryonic antigen CEA (75-base long N54), both markers being aberrantly and

abundantly expressed on the surface of a broad range of epithelial cancer cells (breast,

colon, lung, ovarian, pancreatic and prostate). These DNA aptamers were conjugated via

an amino group to cyanur-PEG2000-DPSE and incorporated into preformed liposomes

(~50 aptamers/liposome) containing the contrast agent Omnipaque 350™. The level of

incorporation of aptamer was quantified using Cy5-labeled aptamers and found to be ~

95%. MUC1 and CEA surface antigens are internalized by cancer cells at different rates.

We report that a previously developed and characterized multimodal pegylated

liposomes loaded with the contrast agent for use in computed tomography (CT) imaging

modified to display these aptamers can either increase the binding to cells and

internalization. In vivo studies in mice have shown that the incorporation of these

aptamers on the liposome surface does not significantly alter the pharmacokinetic profile

of these nanoparticles. Current studies are underway to determine the extent of tumour

accumulation and internalization of the MUC1 and CEA targeted liposomes using an

MDA MB 231 orthotopic tumour model.

99

4.1. Introduction

A number of approaches are being employed to increase the selective toxicity of

anticancer agents. The discovery and application of single pathway-based cancer-targeted

drugs have showed some clinical promise, although their overall antitumour efficacy

being often temporary (Hanahan and Weinberg, 2011). One approach that is being

extensively investigated is the identification and use of interactome-based drugs to

interfere with newly identified cancer specific pathways (Roukos, 2012). Multimodal,

nanomaterial-based formulations offer the potential of delivering anticancer drugs and

contrast agents in a more directed fashion for guided in vivo imaging and therapeutic

approaches (Huang et al., 2012).

In theory, the best approach to improve the quality of life in patients with cancer

is to detect diseases as early as possible so that the timely initiation of therapy can

maximize the efficacy of the treatment. In the past decade, the field of nanomaterial-

based technologies has made fundamental advancements in the detection of diseases in

early stages as well as the delivery of drugs (Ryu et al., 2012; Taruttis and Ntziachristos,

2012). Magnetic nanoparticles incorporating inorganic nanocrystals as their magnetic

cores and composed of metals, alloys and metal oxides have been reported (Laurent et

al., 2008). The surfaces of these nanoparticles have also been modified with layers of

organic polymer or inorganic metal or oxide surfaces making them suitable for the

conjugation to biomolecules (Berry et al., 2003) with the resulting nanoparticles being

used for magnetic resonance imaging (MRI) and drug delivery (Fang and Zhang, 2009;

Veiseh et al., 2010). Metal nanoparticles have also been used by generating gold and

silver nanoparticles, which display excellent plasmonic properties advancing the use of

surface-enhanced Raman-spectroscopy (Ando et al., 2011; Sathuluri et al., 2011). Silica-

100

based nanoparticles have also been useful for encapsulating proteins such as the green

fluorescence protein (Cai et al., 2011) for cellular applications, in light of their nonporous

structure which protects GFP in terms of photo-stability and their versatile surface for

conjugating targeting moieties (Qhobosheane et al., 2001; Wittenberg and Haynes, 2009).

Hydrogels represent another category of nanomaterials composed of crosslinked polymer

structures that can retain large amounts of water or biological fluids within their matrix

and have found numerous medical and pharmaceutical applications due to their ability to

provide a slow controlled release of their cargo (Kashyap et al., 2005; Miyata et al.,

1999). Carbon-based nanomaterials, such as carbon nanotubes, fullerenes and recently

graphene and graphene oxide have shown promise in the field of cellular imaging and

drug delivery (Hong et al., 2012; Liu et al., 2011; Peng et al., 2010). More recently,

studies have shown these compounds are toxic at higher concentrations as MTT assays

failed to predict toxicity of graphene oxide and graphene sheets because of the reduction

of MTT by graphene resulting in a false positive signal (Liao et al., 2011). These

nanomaterials have been investigated due to their beneficial characteristics such as their

high surface area, mechanical strength, electrical and thermal conductivity and

photoluminescence. As such they have shown promise as sensors but also for imaging

applications (Ajayan, 1999).

Liposomes have had the greatest clinical impact as they have been used as a drug

delivery system for over 40 years (Bangham et al., 1965). These lipid-based

nanomaterials allow for retention of their cargo until they reach their intended target

organ. They can be modified with the addition of polyethyleneglycol (PEG), to enhance

their circulation time (Gregoriadis, 1995) and will accumulate at newly vascularized

tumour sites as a consequence of the enhanced permeability and retention (EPR) effect

101

(Maeda, 2001). At least twelve liposome-based drugs have now been approved for

clinical use the US Food and Drug Administration (FDA), four of which are for the

treatment of cancers and over twenty more liposomal formulations are currently in

clinical trials (Chang and Yeh, 2012). Importantly, antibodies, peptides, aptamers and

small molecular weight ligands have been introduced on the surface of nanoparticles to

target them to diseased tissues (Kumar et al., 2012).

In the present study, we report the incorporation of aptamer-lipid conjugates into

pegylated liposomes loaded with a contrast agent with a view to guide their delivery and

imaging of MDA -MB-231tumour xenografts implanted in athymic CD-1 mice (Figure

4.1). Aptamers are short single-stranded DNA or RNA oligonucleotides selected using a

PCR-based in vitro iterative process termed SELEX (Ellington and Szostak, 1990; Tuerk

and Gold, 1990). The identified aptamers bind to their target with high specificity and

affinity. DNA aptamers have been derived that can behave as sensors, therapeutics,

regulators of cellular processes or as cellular delivery agents (Holthoff and Bright, 2007;

Kaur and Roy, 2008; Orava et al., 2010; Toulme et al., 2004). DNA aptamers, unlike

antibodies, are not immunogenic, are easy to synthesize and to couple to nanoparticles,

and can be reversibly denatured (Yang et al., 2011). There are currently a dozen aptamers

in clinical trials with the anti-VEGF aptamer Pegaptanib (Macugen) approved since 2004

for age-related macular degeneration (Bunka et al., 2010; D'Amico et al., 2006).

Aptamer-functionalized nanomaterials are now being investigated in multiple fields of

research (Xing et al., 2012; Yang et al., 2011).

102

Figure 4.1. Proposed in vivo routing of mucin MUC1directed DNA aptamers

coupled to pegylated liposomes filled with the CT contrast agent Omnipaque 350.

The liposomes accumulate within the interstitium of a solid tumour by virtue of the

Enhanced Permeability and Retention (EPR) effect. The aptamer-decorated

liposomes are then subsequently internalized into MUC1-expressing tumour cells

(modified from Peer et al. 2007).

103

The DNA aptamers N54 and MUC1-VR used in the present study were respectively

derived against two established tumour markers, namely the carcinoembryonic antigen

(CEA) and the mucin MUC1. CEA is a 180 kDa GPI-linked cell glycoprotein that is also

a member of the immunoglobulin cell adhesion molecule superfamily (CEACAMs)(Gold

and Freedman, 1965a). It is aberrantly over-expressed on the surface of colon, breast,

lung and other epithelial cancer cells (Hammarstrom, 1999). Antibodies against CEA are

slowly internalized by CEA-expressing cells at a rate comparable to their metabolic

turnover rate suggesting that CEA may be a suitable target for tumour targeting (Schmidt

et al., 2008). The derivation of the CEA-specific aptamer N54 was described in Chapter

3. In contrast to CEA, the mucin MUC1 membrane glycoprotein is highly expressed and

aberrantly glycosylated in more than 90% of primary and metastatic breast cancers

(McGuckin et al., 1995) with mucin MUC1 underglycosylated forms such as the Tn

antigen being rapidly endocytosed by cells (Altschuler et al., 2000). Our group has

previously identified aptamers to the Tn antigen of MUC1 (Ferreira et al., 2009). A

second generation, 40-base long DNA aptamer MUC1-VR1 was derived for the present

study.

4.2. Materials and Methods

4.2.1. MUC1 expression, purification and glycosylation

A recombinant mucin MUC1 peptide composed of five 20-residue long MUC1 tandem

repeats was expressed in E.coli and purified to homogeneity by Ni-NTA chromatography

as previously reported (Brokx et al., 2003). The purity and sequence of the MUC1

peptide were confirmed by SDS-PAGE and mass spectrometry. The peptide was stored at

104

-20°C. Fifteen GalNac sugars (Tn antigens) were enzymatically introduced on the

hydroxyl side chain group of serines and threonines within each MUC1 tandem repeat

using a recombinant secreted form of the human glycosyltransferase ppGalNAc-T1

expressed in Pichia pastoris as previously described (Brokx et al, 2003). The level of

glycosylation was confirmed by SDS PAGE and mass spectrometry (Appendix 6).

4.2.2. Identification of MUC1 binding aptamers using the SELEX process

The initial ssDNA library contained a central randomized sequence of 40 nucleotides

flanked by two primer regions with the sequence 5’ GAC GAT AGC GGT GAC GGC

ACA GAC G-(25N)-CGT ATG CCG CTT CCG TCC GTC GCT C 3’. The forward

primer 5’ GAC GAT AGC GGT GAC GGC ACA GAC G 3’ and reverse primer 5’ GAG

CGA CGG ACG GAA GCG GCA TAC G 3’ were used for selection and cloning (IDT

Technologies, Inc.). A 50 nmol aliquot of the library was first counter-selected against

Ni-NTA agarose beads prior to selection against the GalNAc-modified MUC1 peptide

(Tn antigen) in order to remove DNA species that non-specifically bound to Ni-NTA

agarose itself. The resulting sub-library was then exposed to 5 µg of His-tagged

glycosylated MUC1 peptide dissolved in 200 µl of PBS, 10 µg/ml salmon sperm DNA

and 10 µg/ml BSA (selection buffer) for 30 min then added to a column containing 200

µl of Ni-NTA agarose beads (Qiagen Inc.). Unbound DNA sequences were washed away

with a 10-fold column volume excess of the selection buffer. DNA-protein complexes

were eluted from the beads with selection buffer containing 240mM imidazole. The

ssDNA component was precipitated with sodium perchlorate/isopropanol and recaptured

using a silica membrane-based purification system (Qiagen Inc., Mississauga, Ontario).

The DNA aptamers were then amplified by asymmetrical PCR using a 10-fold excess of

105

forward primer. After every second round of selection, the amount of target (Tn antigen

MUC1 peptide) was reduced in half to capture the tightest binding aptamers against the

MUC1 target. The bound sequences were amplified by PCR after 10 rounds of selection

to produce double stranded products, cloned into a pCR4-TOPO TA vector (Invitrogen)

and sequences were analyzed using BioEdit sequence alignment editor software (Ibis

Therapeutics, Carlsbad, USA).

4.2.3. MUC1 Aptamer binding and internalization

To determine if the identified MUC1 aptamers were able to specifically bind MUC1 on

MUC1+

cells, FITC-labeled MUC1-VR1, MUC1-VR4, MUC1-VR7 and MUC1-VR

were synthesized (IDT technologies) and incubated for 1 hour in 1 ml of DMEM + 10%

FBS with the human breast cancer cell line (MUC1+) MDA-MB-231 (Gilbey et al., 2004;

McGuckin et al., 1995) or the MUC1- human cell line HeLa at a density of 10

6 cells/ml at

4°C or 37°C with or without the addition of trypan blue to quench aptamer fluorescence.

Cells were subsequently placed on ice, washed three times with cold PBS (-MgCl2/-

CaCl2) and analyzed by flow cytometry for the binding of fluorescent MUC1 aptamers

(FACScan, BD Biosciences, Franklin Lakes, NJ). Experiments were repeated in triplicate

and averages were reported as mean fluorescence intensity + S.E.M.

4.2.4. Binding kinetics of MUC1 aptamers determined by surface plasmon

resonance

All experiments were performed using the ProteOn XPR36 surface plasmon resonance

instrument (Bio-Rad Laboratories, Inc.). The amine reactive ProteOn GLC sensor chip

was washed and activated according to manufacturer’s protocols. MUC1 and

106

glycosylated MUC1 peptides were diluted to 100 µg/ml in PBS-T (0.05% (v/v) Tween-

20), pH 7.4 and injected for 120 seconds at 30 µl/min. After the loading phase of protein

~100 and 150 RUs of protein was bound respectively. Control aptamer (cApt) used for

subsequent experiments was a 40 base sequence of AGTC repeats, 5’ AGT CAG TCA

GTC AGT CAG TCA GTC AGT CAG TCA GTC AGT C 3’. Subsequently aptamers

MUC1-VR1, MUC1-FL1 and cApt were diluted as a series of two-fold dilutions ranging

from 2µM to 3.9nM in PBS-T (0.05% (v/v) Tween-20) pH 7.4. Aptamer concentrations

and a buffer control were injected in the analyte channel with a contact time of 200 sec,

dissociation time of 800 sec, and a flow rate of 100 µl/min. The ligand channels were

regenerated with a 30 sec injection of 1M H3PO4 followed by a 30 sec injection of 1 M

NaCl. All experiments were performed at 25°C and repeated in duplicate. Sensorgrams

were then double-referenced by subtracting the buffer response and using the interspot

reference. The sensorgrams were fitted globally to a 1:1 Langmuir binding model and the

kinetic parameters for the association (ka), dissociation rates (kd), and binding constant

(KD) were derived from the fitted curves (MUC1-VR1 and MUC1-FL1 fitted to MUC1

and glycosylated MUC1 had χ2

> 0.93).

4.2.5. Synthesis of Aptamer-PEG2000-DSPE conjugates

Aptamers were synthesized with a C6 spacer 5’ Amino group (IDT Technologies) and

incubated in a 1:1 molar ratio with a cyanur-PEG2000-DPSE (Avanti Polar Lipids) in 0.1M

boric acid (pH 8.8) for 24 hours. Unconjugated aptamer was separated by dialysis

(MWCO 13 000) in 0.01M HEPES buffer (pH 7.4). The concentration of DNA in the

samples was measured at 260/280 nm using a nanodrop spectrophotometer. The coupling

yield of aptamers to cyanur-PEG2000-DPSE was 80%.

107

4.2.6. Liposome preparation

The liposomes were prepared as previously described (Zheng et al., 2006). Briefly,

DPPC, cholesterol, and DSPE-PEG2000 were dissolved in ethanol (250mM) at 70C at a

percent molar ratio of 55:40:5 DPPC:CH:DSPE-PEG2000. Omnipaque® (300mg/ml of

Iodine, GE Healthcare, Mississauga, ON) was added to yield a final lipid concentration

of 100 mM after ethanol removal and the mixture was kept at 70C for 6 h with

intermittent vortexing. The resulting multilamellar vesicles were then extruded at 70C

through a 10-mL Lipex Extruder (Northern Lipids Inc, Vancouver, British Columbia,

Canada) with five passages through two stacked 200 nm pore size polycarbonate filters

and five passages through two stacked 80 nm polycarbonate filters (Nucleopore; Track-

Etch Membrane, Whatman Inc., Clifton, NJ). Unencapsulated contrast agent was

removed by dialysis overnight (MWCO 8000) against HEPES buffered saline (HBS, pH

7.4). The liposome formulation was then concentrated to a final iodine concentration of

40mg/mL using a MidJet membrane separation system with a 750,000 NMWC MidGee

cross flow cartridge (GE Healthcare, Mississauga, ON). Targeted and untargeted

liposomes were generated by adding a specific aptamer-PEG2000-DSPE conjugate

(~2.5mg/250mM of lipid resulting in ~50 aptamers per liposome assuming a

homogenous size distribution) or a control PEG2000-DSPE conjugate to a liposome

suspension and each mixture was stirred at 37C for 5 hours following by stirring at

room temperature for 18 hours.

108

4.2.7. Efficiency of aptamer-DSPE-PEG insertion into liposomes

Aptamers were synthesized with a 5’ Cy5 fluorophore and a 3’ amino group (IDT

Technologies) and conjugated to cyanur-PEG2000-DPSE as previously described. The

fluorescence signal of Cy5-labeled aptamer-PEG2000-DPSE solutions (excitation 625 nm;

emission 670 nm) was measured prior to adding Cy5-aptamer-PEG2000-DPSE (from 30

µg to 2mg) to 25 mM of lipids for 30 minutes at 37°C then overnight at room

temperature (Ishida et al., 1999; Moreira et al., 2002). Unincorporated Cy5-aptamer-

PEG2000-DPSE conjugates were removed by dialysis (MWCO 30,000) in 0.01M HEPES

buffer (pH 7.4). The fluorescence signal of aliquots from each liposome formulation was

then measured and compared to our standard curve. Close to 95% of each evaluated Cy5-

aptamer-PEG2000-DPSE conjugate was incorporated into liposomes. Assuming that a 100

nm diameter [d] liposome contains ~80,000 lipids, the total number of lipids [Ntot] in

solution was calculated as follows Ntot = 17.69 × [ (d/2)2 + (d/2 – 5)

2 (Pidgeon and Hunt,

1981) with the number of liposomes (Nlipo) estimated to be equal to (Mlipid × NA) / (Ntot ×

1000) wherein Mlipid is the molar concentration of lipid and NA is Avogadro’s number

(6.02×1023

mol−1

). The estimated average number of aptamers per liposome was then

calculated by dividing the total number of aptamers by the total number of liposomes

assuming a homogeneous distribution of the aptamers on the liposomes and the near

complete integration of the Cy5-aptamer-PEG2000-DPSE conjugate added (as discussed

above).

4.2.8. Aptamer-liposome characterization in vitro

The human breast cancer cell lines MCF-7 and MDA-MB-231 as well as the human

cervical adenocarcinoma cell line HeLa, murine fibroblast cell line L929 and rat

109

gliosarcoma cell line 9L were cultured at 37ºC, 5.0% CO2 in Dulbecco’s modified Eagle’s

medium supplemented with 10% fetal bovine serum, penicillin (100 U/mL) and

dihydrostreptomycin (100 µg/mL). MDA-MB-231 or HeLa cells at a final density of 107

cells/ml in 100 µl of DMEM were treated to a final concentration of 20 µM of either Tn

antigen-directed, CEA-directed, cApt-directed aptamer-liposomes or non-targeted

liposomes for 1 hour at 4°C to reduce internalization. The cells were then washed three

times with cold PBS and analyzed by flow cytometry. For aptamer-liposome

concentration studies, MDA-MB-231 and HeLa cells at a final density of 107 cells/ml in

100 µl of DMEM, were exposed to increasing two-fold concentrations (from 5-80 µM)

of aptamer-liposomes displaying ~50 aptamers per liposome or to non-targeted

liposomes for 1 hour at 4°C.

For internalization studies, MDA-MB-231 or HeLa cells [107 cells/ml in 100 µl

DMEM] were incubated with 20 µM aptamer-liposomes (~50 aptamers/liposome) or

non-targeted liposomes at 4°C or 37°C, for 0.5, 1, 2, 4, 8 and 24 hours. All studies were

repeated in triplicate and averages are represented as mean fluorescence intensity ±

S.E.M.

4.2.9. Physio-chemical characterization of aptamer-liposome formulations

The hydrodynamic particle diameter and zeta potential of aptamer-liposome formulations

as well as non-targeted liposomes were determined by dynamic light scattering (DLS)

using a Zetasizer nano ZS (Malvern Instruments Ltd.).

110

4.2.10. Aptamer-liposome pharmacokinetic profile

The liposome preparations (0.35g/kg iodine and 1.8g/kg lipid) were injected into athymic

female CD-1 mice via the tail vein. The animals were subsequently anaesthetized using

2% isoflurane and full body, 16-second anatomical micro-CT scans (GE Locus Ultra

micro-CT, GE Healthcare, Waunakee, WI) were recorded prior to liposome

administration and at 5 min, 2h, 4h, 8h, 24h, 48h and 72 hours post-injection intervals.

CT images were acquired at 80kVp and 70mA with a voxel size of 0.15mm x 0.15mm x

0.15mm and a field of view of 0.57cm x 0.57cm x 10.5cm.

CT images were analyzed using MicroView v2.2 (GE Healthcare, Waunakee, WI).

Briefly, the mean iodine concentrations in selected organs were determined through

contouring the desired region on multiple 2D slices to generate a 3D volume and

calculating the mean voxel intensity (expressed in CT attenuation Hounsfield Units, or

HU) for each volume. Iodine concentrations in blood were determined by contouring the

aorta.

4.2.11. Statistical methods and data analysis

Data sets derived from individual groups of mice were compared using student’s t-test

and grouped data sets were analyzed by ANOVA. Statistical analyses and graphs were

assembled using GraphPad PRISM (version 5.01, GraphPad software for Science, San

Diego, CA). P values ≤ 0.05 were considered significant unless otherwise indicated.

Flow cytometry statistics were analyzed using WinMDI (version 2.8, Windows multiple

document interface for flow cytometry, Scripps Research Institute).

111

4.3. Results

4.3.1. Identification and characterization of MUC1-VR1, a MUC1-binding

aptamer

The target used to identify MUC1-binding DNA aptamers generated using a SELEX

approach, was a recombinant MUC1 peptide corresponding to five consecutive 20-

residue long tandem repeats of the mucin MUC1 protein extracellular domain. This

peptide was enzymatically modified with the human glycosyltransferase ppGalNAc-T1

to harbor up to 15 GalNAc sugars known as Tn antigens (Brokx et al. 2006). Forty

recovered oligonucleotide inserts from the SELEX search were sequenced yielding 37

DNA aptamer sequences that could be regrouped into 4 unique sequences (Figure 4.2A).

In particular, MUC1-VR1 (40-base long variable region) and MUC1-FL1 (primers and

the same 40-base long variable region) accounted for 86% of identified aptamer

sequences. All 4 DNA aptamer sequences were then synthesized with a 5’ biotin group to

confirm their binding to the MUC1 Tn antigen using a modified ELISA protocol

(Appendix 7) (Orava et al., 2012). The ELISA binding assay confirmed that of the 4

identified sequences, 3 of the 40-base aptamers specifically bound to the Tn antigen

MUC1 peptide, namely MUC1-VR1, MUC1-VR4 and MUC1-7.

The ability and specificity of these aptamers to bind to Tn antigen-containing mucin

MUC1 on the surface of cancer cells was subsequently assessed using FITC-labeled

MUC1 aptamers as well as the FITC-labeled CEA-binding aptamer N54 (5’ GAC GAT

AGC GGT GAC GGC ACA GAC GTC CCG CAT CCT CCG CCG TGC CGA CCC

GTA TGC CGC TTC CGT CCG TCG CTC 3’; Orava et al. 2013). The MUC1-VR1, -

VR4 and -VR7 aptamers all bound to the CEA+/MUC1

+ cell lines MDA MB 231 (Gilbey

et al., 2004; McGuckin et al., 1995) and MCF-7 while none of these fluorescent aptamers

112

recognized CEA-/MUC1

- cell lines 9L, L929 and HeLa (Appendix 8 and 9). MUC1

expression on cells was confirmed using the anti-MUC1 M23 antibody (Linsley et al.,

1988) and a FITC-labeled mouse anti-human secondary antibody (Appendix 10).

Although MUC1-VR1, MUC1-VR4 and MUC1-7 bound to Tn antigen MUC1 peptide

using ELISA-based method and flow cytometry showed binding to MUC1+

cells, only

MUC1-VR1 and its full length MUC1-FL1 homolog showed binding to the MUC1

peptide and its Tn antigen MUC1 variant by SPR. The binding constant of MUC1-VR

and MUC1-FL aptamers were determined by surface plasmon resonance by coupling

unglycosylated MUC1 peptide and the Tn antigen-containing MUC1 peptide variant to

an amine reactive chip. Of the three aptamers tested, aptamer MUC1-VR1 showed no

significant difference in binding affinity between the MUC1 peptide and Tn antigen form

(410 ± 130 nM and 380 ± 90 nM). Interestingly, the MUC1-FL1 aptamer was ~7-more

avid to the MUC1 peptide relative to the Tn antigen-labeled MUC1 peptide (230 ± 60

nM vs. 1600 ± 400 nM) (Figure 4.2 B). Since there was no significant difference between

the binding constants of MUC1-VR1 and MUC1-FL1 to the Tn antigen-labeled MUC1

peptide we chose to continue our studies using the smaller shorter MUC1-VR1 aptamer.

113

Figure 4.2. Identification of MUC1-specific DNA aptamers and the ability of

MUC1+ MDA-MB-231 cells to internalize FITC-labeled aptamer MUC1-VR1. (A)

DNA aptamers identified from the SELEX screen against a Tn antigen-modified MUC1

peptide and their frequency of occurrence in the final selection pool. (B) Calculated

dissociation constants (KD) for MUC1-FL1 and MUC1-VR1 binding to the glycosylated

and unglycosylated form of the MUC1 peptide as determined using surface plasmon

resonance. (C) Mean fluorescence intensities of FITC-labeled MUC1-VR1 bound to cells

at 4°C after one hour then treated with trypan blue (TB) showing a reduction in

fluorescence intensity down to the background fluorescence signal of the control aptamer

cApt suggesting that the aptamer MUC1-VR1 is not internalized by cells at 4°C. (D)

Mean fluorescence intensities of FITC-labeled MUC1-VR1 bound to cells after one hour

at 37°C then treated with trypan blue indicating that this aptamer is rapidly taken up by

MDA MB-231 cells at 37°C. Each bar represents the average + SEM (n=3). P-value

>0.05 using a Welch corrected two-tail unpaired t-test was considered non-significant.

114

The internalization of FITC-labeled MUC1-VR1 aptamer into cells was measured

by FACS analysis at 37°C (surface binding and internalized components) and 4°C

(surface binding only), after a 1-hour incubation period. The mean fluorescence

intensities (MFI) from aptamer bound to the surface of cells was quenched with trypan

blue prior to FACS experiments. Cells treated with trypan blue at 4°C showed a

significant decrease in fluorescence signal when compared to MUC1-VR1 with no

quenching but no such difference in MFIs was observed for the control FITC-labeled

aptamer cApt which does not bind the MDA MB 231. Importantly, cells treated with

trypan blue after binding and internalization at 37°C showed no significant decrease in

MFI when compared to cells treated with MUC1-VR1 alone suggesting that the aptamer

was being internalized into target cells.

4.3.2. Optimization of MUC1-VR1 and N54 aptamer-targeted liposomes in vitro

Cy5-labeled MUC1-VR1, N54 and cApt (control) aptamers were conjugated via their 3’

end amino group to cyanur-PEG2000-DPSE. The resulting conjugates were incorporated

into preformed pegylated liposomes. Greater than 95% of the Cy5-labeled aptamer-PEG

lipid constructs were inserted into liposomes up to a density of 320 aptamers per

liposome (Appendix 11) (Moreira et al., 2002). As well, the binding of Cy-5 labeled

aptamer N54 was confirmed by FACS on MCF-7 and MDA-MB-231 cells before

incorporation (Appendix 12). At the lowest aptamer concentration tested (10 aptamers

per liposome) there was ~2-fold increase in MFIs of MDA-MB-231 cells treated with

MUC1-VR1 and N54 as compared to the control aptamer (Figure 4.3A). At a

concentration of ~40 aptamers per liposome, MUC1-VR1- and N54-modified liposomes

respectively showed a 7-fold and 5-fold increase in cell surface-associated fluorescence

115

intensities as compared to cApt liposomes.

The effect of aptamer-liposomes concentration on cell surface association to

MDA-MB-231 and HeLa cells at 4°C was monitored by FACS analysis using a loading

of 50 Cy5-labeled aptamers per liposome. At the lowest concentration tested of 5 µM, the

MUC1-VR1 and N54 liposomes showed ~3-fold and 2.5-fold increase in MFIs as

compared to the cApt and non-targeted liposomes on CEA+/MUC1

+ MDA-MB-231 cells

(Figure 4.3C). Interestingly, at concentrations at or above 20 µM, there was a significant

increase in MUC1-VR1 liposomes binding (MFIs) to CEA+/MUC1

+ MDA-MB-231 cells

as compared to the N54-tagged liposomes. As expected, no significant difference in MFIs

was observed between aptamer groups on CEA-/MUC1

- HeLa cells although a small

increase in nonspecific binding (MFIs) occurred for non-targeted liposomes at

concentrations ≥ 40 µM (Figure 4.3D).

116

Figure 4.3. Liposome internalization into CEA+/MUC1+ MDA-MB-231 cells is

dependent on the number of DNA aptamers present on the surface of liposomes. (A)

Increasing amounts of Cy5-labeled MUC1-VR1 aptamer (triangles), CEA N54 aptamer

(inverted triangles) or control aptamer cApt (squares) were incorporated into pegylated

liposomes. Mean fluorescence intensities of liposomes bound to the cell surface of

MDA-MB-231 cells after a 1-hour exposure at 4°C were measured by FACS analysis.

(B) Lack of binding of targeted and untargeted liposomes to MUC1-/CEA

- HeLa cells.

(C) Increasing concentrations of aptamer targeted Cy5-liposomes or non-targeted

(circles) bound to (C) CEA+/MUC1

+ MDA-MB-231 or (D) CEA

-/MUC1

- HeLa cells

after a 1-hour incubation period at 4°C. (E) Physicochemical properties of targeted and

non-targeted liposome formulations.

117

4.3.3. Aptamer-Liposome internalization in MDA-MB-231 cells

Cellular uptake and recycling of surface markers takes place at 37°C. The effect of

temperature on the binding and cellular uptake of Cy5-labeled MUC1-VR1, N54 or

cApt-tagged aptamer-liposomes into MDA-MB-231 and HeLa cells was monitored by

FACS analysis at 4°C (surface binding) and 37°C (binding and internalization) using a

loading of 50 Cy5-labeled aptamers per liposome. At 4°C, both N54- and MUC1-VR1

liposomes reached a maximum fluorescence signal within the first 2 hours of incubation

with MDA-MB-231 cells with no significant difference in MFI being observed after a

24-hour incubation period (Figure 4.4A). The same aptamer liposomes did not

significantly bind to MUC1-/CEA

- HeLa cells even after 24 hours (Figure 4.4C). At

37°C, fluorescence signals associated with both N54- and MUC1-VR1 liposomes

increase with time although the uptake of MUC1-VR1 was significantly more rapid

reaching a plateau at 4 hours as opposed to the CEA N54-labeled liposome preparation

which led to increased MFI values only after 24 hours (Figure 4.4B). Their uptake levels

into HeLa cells at 37°C were comparable to that of untargeted liposomes (Figure 4.4D).

Although comparable to fluorescence values observed at 4°C, the nonspecific uptake of

cApt-labeled or untargeted liposomes by MDA-MB-231 and HeLa cells showed a slight

increase in MFI values with time at 37°C (Panels 4.4B and 4.4D).

118

Figure 4.4. Binding and internalization of targeted liposome formulations in vitro.

(A) Mean fluorescence intensities (MFI) of CEA+/MUC1

+ MDA-MB-231 cells

maintained at 4°C and treated with either MUC1-VR1-liposomes (triangles), CEA N54-

liposomes (inverted triangles), cApt-liposomes (squares) or non-targeted liposomes

(circles) reached a plateau after 2 hours (B) MDA-MB-231 cells incubated at 37°C

display a pronounced increase in MFI (internalization event) as a function of time when

treated with Cy5-labeled MUC1 and CEA liposome preparations when compared to MFI

values recorded at 4°C. CEA-/MUC1

- HeLa cells treated with the same liposome

formulations at (C) 4°C and (D) 37°C showed no significant increase in MFI.

119

4.3.4. Aptamer-Liposome physicochemical properties and stability in vivo

Liposome preparations formulated with aptamers were analyzed by light scattering

[Zetasizer] to define their hydrodynamic diameter and zeta-potential in relation to non-

targeted liposome formulations. The incorporation of MUC1-VR1 and N54 into

liposomes resulted in ~10% and ~20% larger liposome diameter as expected from the

fact that the CEA aptamer N54 has 35 more bases than the 40-base long MUC1-VR1

aptamer (Figure 4.3E). The incorporation of aptamers decreased the surface potential of

the liposomes by ~10% as compared to non-targeted liposomes although these changes

were not statistically significant.

To determine whether the incorporation of aptamers MUC1-VR1, N54 and cApt

would significantly affect the stability of the liposomes, preparations were injected via

the tail vein into CD1 mice and imaged at time intervals of 0, 0.5, 1, 2, 4, 8, 24, 48 and

72 hours. Images were examined at the different time points and the descending aorta

was contoured to determine the amount of liposomes in the blood by quantifying the

amount of contrast agent. The results showed that there was no significant difference in

the elimination half-life of the aptamer-liposomes compared to the non-targeted

formulation suggesting that the incorporation of the DNA aptamers did not alter the

stability of the liposomes (student’s t-test, p>0.05) (Table 4.1).

Table 0.1. Pharmacokinetics of different Omnipaque encapsulated non-targeted and

aptamer targeted liposome preparations in CD1 mice (n=5 per group).

T1/2 (h) in blood # Aptamers per liposome Aptamer size

Non-targeted Liposome 39.10 ± 6.22 0 N/A

cApt Lipsome 38.44 ± 4.03 ~50±10 40 b (~13 kDa)

MUC1 Liposome 35.90 ± 2.35 ~50±10 40 b (~13 kDa)

CEA Liposome 37.69 ± 3.12 ~50±10 75 b (~24.6kDa)

120

4.4. Discussion

The targeting of nanoparticles and nanomaterials with aptamers offers the

potential to increase their accumulation at tumour sites by binding specifically to unique

cancer markers.

For instance, the aptamer TTA1 directed at Tenascin-C, an extracellular matrix

protein that is expressed during tissue remodeling and notably tumour growth was

radiolabeled with 99M

-Tc and reported to display good tumour penetration and a high

tumour-to-blood ratio most likely due to its rapid clearance (Hicke et al., 2006).

Aptamers have recently been derived to the mucin MUC1 protein (Ferreira et al., 2009);

a well-known tumour marker that is overexpressed and underglycosylated on epithelial

cancers. Studies have shown that MUC1-directed aptamers are capable of delivering

cytotoxic agents or as targeting agents in the context of PLGA nanoparticles in vitro (Hu

et al., 2012; Yu et al., 2011). The biodistribution of a PEGylated MUC1 aptamer as well

as their ability to target quantum-dot-doxorubicin conjugates in vivo studies have also

been reported (Da Pieve et al., 2012; Savla et al., 2011). To date, no studies have shown

the utility of an aptamer recognizing CEA as a targeting agent.

In the present studies, we show that a loading of >80 MUC1-VR1 or CEA N54

aptamers per liposome is not essential for the maximal in vitro uptake of such

formulations into the CEA+/MUC1

+ human breast cancer MDA-MB-231 cells (Figure

4.3A). This level of aptamer loading is comparable to the density of 34-60 VEGF

aptamers per liposome for 50 nm nanoparticles reported in the past (Willis et al., 1998)

but less than the loading of 500 aptamers per liposome required to achieve a pronounced

targeting effect for an aptamer directed at E-selectin (Mann et al., 2011).

We did observe that the MUC1 aptamer MUC1-VR1 had a greater amount of cell

121

association as compared to our CEA N54 aptamer (Figure 4.4A). Since the CEA aptamer

had a higher reported binding constant than MUC1-VR1 for its target (~45 nM vs. ~400

nM), the lower amount of cell association may reflect a lower level of CEA expression

on the cell surface of MDA-MB-231 cells or could be that surface CEA is being shed

from cells.

Importantly, the rates of internalization of CEA and mucin MUC1 by MDA-MB-

231 cells showed significant differences. At 37°C, the MUC1-VR1 aptamer displays an

estimated internalization rate of <1 hour which is consistent with the published recycling

rate of MUC1 on cells (Altschuler et al., 2000) (Figure 4.4B). However, MDA-MB-231

cells significantly accumulate CEA N54-tagged liposomes over a period of 24 hours

(Figure 4.4B). There was no significant difference in mean fluorescence intensities at 8

hours between 4°C and 37°C exposure of CEA-targeted liposomes to MDA-MB-231

cells, suggesting that the CEA liposomes were being internalized after this time point.

This finding is consistent with the metabolic turnover rate of CEA on cells of between

~10 – 17 hours using monoclonal antibodies to CEA (Schmidt et al., 2008). As expected,

no significant difference in cell-associated fluorescence was observed for CEA-/ MUC1

-

HeLa cells treated with MUC1-VR1- or N54-liposomes at either 4°C or 37°C as

compared to the non-targeted and cApt (control) liposome (Figure 4.4C, 4.4D).

These aptamer-targeted pegylated liposomes were loaded with the contrast agent

and injected intravenously (tail vein) into mice to establish their circulatory half-life in

the blood over a period of 72 hours. CT results confirmed that the incorporation of

aptamers into pegylated liposomes did not significantly alter their stability and

circulation half-life (Table 4.1). Interestingly, the non-targeted liposomes were

considered to possess a very negative zeta potential (-36 ± 4 mV) and it was thought the

122

incorporation of aptamers would make the formulation significantly more negative.

However, it was found that the average zeta potential of these pegylated liposome

preparations were not statistically different, being comparable to that of non-targeted

pegylated liposomes (Figure 4.3E).

Although tumour accumulation studies have not yet been completed, the affinity

difference in these aptamers and their respective targets on cancer cells should allow for

an interesting comparative study. Recently, studies using HER2-specific antibodies as

targeting agents demonstrated that differing avidities can affect the level of tumour

penetration and internalization in solid tumours (Rudnick et al., 2011). This finding

would suggest that MUC1-VR1 aptamer liposomes may accumulate to a greater degree

in the tumour than untargeted liposome formulations. As well, it was shown in a

comparative study that the in vitro internalization and in vivo distribution of fast-

internalizing and slow-internalizing receptors showed a significant difference in tumour

accumulation patterns (Bryan et al., 2005). This study would suggest that targeting a non-

or slow-internalizing receptor such as CEA might yield better tumour accumulation than

a rapidly internalizing receptor such as MUC1. As well, characterizing the ability of

these aptamers to target this liposome formulation encapsulating a contrast agent for

imaging would allow an easy transition to engineering similar liposomes with a variety

of chemotherapeutic drugs.

We have shown in vitro that CEA and MUC1 aptamer targeted pegylated

liposomes are able to bind and be internalized by CEA+/MUC1

+ MDA-MB-231 cells but

not by MUC1-/CEA

- HeLa cells. The incorporation of these aptamers into pegylated

liposomes did not affect their stability in vivo or their circulatory half-life of ~ 36 hours.

Studies are currently underway to determine that biodistribution and internalizing rates of

123

these aptamer-targeted liposomes in vivo.

124

Chapter 5

Overall Thesis Conclusions and Future Research

125

5.1. Thesis Conclusions

The main focus of my thesis was to derive functional aptamers to targets that could

functionally inhibit their function in vitro and in vivo. The rationale for pursuing such an

objective was that therapeutic targets such as TNFα and CEA can have a therapeutic

advantage in blocking binding to their cognate receptors as well as their adhesive

properties. In chapter 2, I described how one can successfully identify a DNA aptamer

able to block TNFα and confirmed this in vitro by monitoring the blocking of the

downstream signaling in NfKB (Figure 2.1) as well as blocking TNFα induced

cytotoxicity (Figure 2.2). The inhibitory aptamer VR11 and aptamer VR20 both bound to

TNFα with low nanomolar affinities and did not bind to the closest known homolog

TNFβ (Figure 2.3). Aptamer VR11 was also able to reduce TNFα dependant NO

production in macrophages (Figure 2.4). Circular dichroism spectroscopy also suggests

that VR11 does not fold into a G-quadruplex structure however there may exist a

secondary structure that aids in binding and blocking TNFα (Figure 2.5). Lastly, it was

also determined that VR11 does induce an innate immune response via TLR9 in

C57BL/6 mice despite harbouring two possible CpG motifs (Figure 2.6).

In Chapter 3, the homotypic binding domain (N domain) of the human

carcinoembryonic antigen (CEA) was selected as a target for aptamer searches since

cancer cells expressing CEA have been shown to aggregate and promote tumour foci

formation. There is a need to develop new concepts and therapies that can halt or control

the establishment or expansion of secondary tumour foci. Thus, the identification of

aptamers able to block such intercellular interactions could in theory halt the formation

of tumour metastasis. CEA represents a logical target for designing new therapies as it is

over-expressed on many epithelial cancer tissues and serves key roles in cellular

126

aggregation processes and attachment to extracellular matrix elements. We initially

identified aptamers, specifically N54 and N56, were able to block the homotypic and

heterotypic binding of recombinant N and A3B3 domains (Figure 3.1). Subsequently we

confirmed the ability of these aptamers to block the adhesion of the CEA expressing

murine cell line MC38.CEA to rCEA and r A3B3 immoblized on wells (Figure 3.2). The

truncations of aptamer N54 resulted in a loss of anti-adhesive properties while aptamer

N56 could be truncated to a 32-base sequence without any loss of its inhibitory properties

relative to the full-length sequence (Figure 3.3). Despite a high level of homology

between the N domain of CEACAMs (Figure 3.4), Cy5-labelled aptamers N54 and N56

did not bind by FACS to other CEACAMs known to be involved in cellular adhesion

processes suggesting these aptamers are specific to CEA (CEACAM5) (Figure 3.5). Most

importantly, it was shown that pretreatment of MC38.CEA cells with aptamer N54 and

N56 prevented the tumour implantation in an intraperitoneal model (Figure 3.6). This

was not due to an induction of apoptosis or an innate immune response caused by the

aptamers (Figure 3.7). This study provided the first, direct evidence that aptamer-based,

CEA-directed, anti-adhesive strategies can block metastatic foci formation in vivo.

Since DNA aptamers are small molecules displaying short circulating half lives in

vivo, I explored in Chapter 4, the design and construction of long-circulating pegylated

liposomes decorated on their surface with aptamers. DNA aptamers directed at two well-

known tumour markers, namely CEA and the mucin protein MUC1 were derivatized

with a pegylated lipid tail and inserted into pegylated liposomes commonly used to

deliver imaging agents and therapeutic drugs to tumour xenografts in

immunocompromised mice. I explored the design of pegylated liposomes decorated with

aptamers. In 2012, approximately 26 percent of all cancer cases in Canadian women

127

were breast cancer and represents the second leading cause of cancer deaths and third

leading cause of death. This year there will be an estimated 22700 more Canadian

women diagnosed with breast cancer however breast cancer deaths have decreased nearly

40 percent since its peak in 1986 partially attributed to more advanced screaning

technology and improved treatments (Jemal et al., 2008). Targeting unique cancer marker

such as CEA and MUC1 represents a novel strategy to increase detection of breast cancer

tumours by delivering contrast agent encapsulated liposomes. We have shown in vitro

that these aptamers can recognize several breast cancer cell lines and appear to have

effect on binding to CEA-/MUC

- cells. These aptamers also had no effect on the

pharmacokinetic profile of the previously reported liposome formulations. Our data

suggest that these formulations may have the ability to increase tumour accumulation or

internalization into breast cancer cells.

5.2. Future Directions

5.2.1. Modification of aptamer VR11 for in vivo

Single-stranded DNA aptamers themselves cannot be used in in vivo studies that require

them to circulate longer without modifications to stabilize them from degradation.

Without modification previous studies have shown that the circulation time of these

aptamers are only a few minutes (Healy et al., 2004). It has previously been shown that

modifications such as conjugation to polyethylene glycol (PEG) groups allow for the

prolonged circulation time of aptamers in mice (Boomer et al., 2005). This study

demonstrated that DNA aptamers, when conjugated to a 20kDa or 40kDa PEG group

were able to achieve therapeutic concentrations at the sites of inflammation. Another

128

mode of prolonging circulation is by conjugation to liposomes by conjugating the

aptamers to PEG-lipid groups and inserting into preformed liposomes (as described in

Chapter 4). In the case of the TNFα aptamer VR11, the VR11 conjugated liposomes

would significantly increase the circulatory half-life of the aptamer as well as passively

target them to the sites of inflammation (Boomer et al., 2005)

5.2.2. Determine the ability of aptamer N54 as a detection and targeting agent

Our study has shown that the aptamer N54 and to a lesser extent aptamer N56 are able to

block the adhesive properties of CEA. Our animal data also showed that pretreating

colon cancer cells expressing CEA and no other CEACAMs with these aptamers was

able to prevent the formation of tumour foci in vivo. This suggested that CEA homotypic

binding is an important event in the attachment and establishment of tumour foci.

However, CEA has been shown to interact with other CEACAMs and these interactions

may contribute to the metastatic potential of cancer cells. As such, a treatment targeting

only CEA in a combination therapy could be advantageous in preventing metastatis

during chemotherapy. These aptamers may also be used in pathology for detecting CEA-

positive tumours in tissue biopsies or as a delivery agent to target therapeutic cargos to

CEA-expressing cancers.

5.2.3. Determine the ability of MUC1 and CEA aptamer to target liposomes

A major challenge associated with chemotherapeutic agents remains their toxicity

towards normal tissues. This challenge limits their use to suboptimal doses and

ultimately leads to disease re-occurrence. Therapeutic cargos linked to antibodies and

129

proteins are being developed to specifically deliver chemotherapeutic agents to cancer

cells (Dillman, 2011). Yet, protein-guided therapies come with major limiting factors

including their size, cost and immunogenicity. Accordingly, simpler targeting agents are

needed to focus the delivery of useful cargos to cancer cells. Since their inception in

1990, short DNA/RNA aptamers have been developed to recognize therapeutically

important molecular targets such as VEGF, thrombin and HIV. More importantly,

aptamers can serve as cellular delivery vehicles by targeting cell surface markers that are

internalized by cancer cells, allowing for the intracellular localization of therapeutic

cargoes. Aptamers can be rapidly developed through SELEX screens, are easily

synthesized, are typically non-immunogenic and are readily amenable to modifications

leading to increased circulation times and stability. Aptamers directed at internalized

surface markers can be conjugated directly to drugs, RNA/DNA, radionuclides, proteins

and nanostructures to serve as tumour selective diagnostic and therapeutic agents. Future

studies will reveal the potential of CEA and MUC1 aptamers as targeting agents and their

ability to increase the accumulation and internalization of drugs in tumours.

Biodistribution analysis from imaging studies and examination of tumours by FACS

should determine if either of these formulations is able to increase the amount of

liposomes internalized into cancer cells. These anticipated results would suggest that

aptamers may enhance the therapeutic potential of drug-loaded liposomes such as

Doxil®.

130

Appendix

Appendix 1. Inhibition of TNFα-induced cytotoxicity in murine fibroblasts with

truncations of aptamer VR11. (A) L929 cells were treated with a 10 nM concentration

of TNFα alone or in the presence of either the inhibitory anti-TNFα MAb (20 µg/ml) or a

2µM concentration of aptamer cApt (VR), VR20, VR4, VR11 or truncations of aptamer

VR11. (B) Table of aptamer sequences used to perform the cytotoxicity assay. Each point

represents the average percent survival value ± SEM (n=4). Asterisk denotes statistical

significance (P<0.05; student-t-test).

131

Appendix 2. Displacement of biotinylated VR aptamers bound to immobilized

recombinant TNFα by an anti-TNF mAb. Biotinylated VR aptamers (1µg/well) were

bound to immobilized recombinant TNFα overnight then dilutions of anti-TNFα MAb

was added for 1 hour and the remaining bound aptamer was detected using streptavidin-

HRP. Each point represents the average ELISA signal ± SEM (n=4).

132

Appendix 3. Commercial and recombinantly purified human TNFα are both active.

Cytotoxicity in murine fibroblast L929 cells pretreated with Actinomycin D (1 µg/ml)

and increasing concentrations of commercial recombinant human TNFα supplied by

Bioclone Inc. (●) or recombinant human TNFα expressed and purified as described in

Materials and Methods section (■). Each point represents the average percent survival ±

SEM (n=4).

133

Appendix 4. Representative Cell association curves generated by the Xcelligence system

measuring cell index every minute for (A) MC38 cells adhering to wells coated with

BSA, (B) MC38 cells adhering to wells coated with rCEA N-domain, (C) MC38.CEA

cells adhering to wells coated with BSA and (D) MC38.CEA cells adhering to wells with

rCEA N-domain. Wells and cells were treated with either Aptamer N54 (green), N56

(Red), cApt (Turquoise) or BSA (Blue). Association curves for untreated cells are shown

in purple. Time points indicate an average of n=5.

134

Appendix 5. Endogenously expressing CEA cancer lines (A) BxPC3 (human primary

pancreatic adenocarcinoma) grown in RPMI-1640 + 10% FBS, (B) HT29 (human colon

carcinoma) grown in McCoy’s 5A + 10% FBS and (C) MCF-7 (human breast cancer

cells) grown in DMEM + 10% FBS. Cells stained with the COL-1 anti-CEA antibody

(Green) and Cy-labeled aptamers N54 (red) and N56 (blue).

135

Appendix 6. 4-12% SDS PAGE gel confirming the purity of Ni-NTA purified MUC1

peptide and the mass shift confirming the glycosylation of the MUC1 peptide.

136

0 500 1000 1500 20000.0

0.1

0.2

0.3

0.4

0.5MUC1-1

MUC1-4

MUC1-7

cApt

strep-HRP

Aptamer [nM]

OD

45

0n

m

Appendix 7. Binding of the 40 base variable region (VR) biotinylated MUC1 aptamers

to glycosylated MUC1 immobilized on 96-well ELISA plates. Control aptamer (cApt)

gave a signal comparable to streptavidin-HRP treatment alone. Each bar represents the

average + SEM (n=4).

137

Appendix 8. Histograms showing the binding after 1 hour of the MUC1 polyclonal

antibody M23 detected with a FITC-labelled secondary antibody and FITC-labelled

MUC1-VR aptamers to the MUC1+ and CEA+ cell line MDA-MB-231.

138

9L L929 HeLa MCF-7

Appendix 9. Histograms showing the binding after 1 hour of FITC-labelled MUC1-VR1

(Green), MUC1-VR4 (Purple), MUC1-VR7 (purple) and CEA aptamer N54 (blue) to

MUC1- and CEA- cell lines 9L, L929 and HeLa as well as MUC1+ and CEA+ MCF-7

cells.

139

Appendix 10. MUC1 antibody M23 and CEA antibody COL-1 was used to confirm

there was no expression on CEA-/MUC1- cell lines L929, 9L and HeLa as well as

confirm the expression of MUC1 and CEA on CEA+/MUC1+ cells MCF-7 and MDA-

MB-231. COL-1 staining was shown in Chapter 3.

140

0 200 400 600 800 10000

2000

4000

6000

8000

Aptamer Concentration (nM)

Re

lati

ve

Flu

ore

sc

en

ce

Un

its

Appendix 11. Standard curve of Cy5 fluorescence measured as function of aptamer

concentration using a fluorescent plate reader. Each point represents the average + SEM

(n=3).

141

Appendix 12. Histograms showing the binding of cy5-labeled Aptamer N54 (blue) and

control aptamer (green) to (left) MCF-7 and (right) MDA MB 231 cells. Aptamer N54

did not bind to HeLa cells (Chapter 3).

142

References

2012. Biologic drugs set to top 2012 sales. Nat Med 18, 636.

Abdul-Wahid, A., Huang, E.H., Lu, H., Flanagan, J., Mallick, A.I., Gariepy, J., 2012. A

focused immune response targeting the homotypic binding domain of the

carcinoembryonic antigen blocks the establishment of tumor foci in vivo. Int J Cancer.

Adams, G.P., Schier, R., McCall, A.M., Simmons, H.H., Horak, E.M., Alpaugh, R.K.,

Marks, J.D., Weiner, L.M., 2001. High affinity restricts the localization and tumor

penetration of single-chain fv antibody molecules. Cancer Res 61, 4750-4755.

Ajayan, P.M., 1999. Nanotubes from Carbon. Chem Rev 99, 1787-1800.

Altschuler, Y., Kinlough, C.L., Poland, P.A., Bruns, J.B., Apodaca, G., Weisz, O.A.,

Hughey, R.P., 2000. Clathrin-mediated endocytosis of MUC1 is modulated by its

glycosylation state. Mol Biol Cell 11, 819-831.

Ando, J., Fujita, K., Smith, N.I., Kawata, S., 2011. Dynamic SERS imaging of cellular

transport pathways with endocytosed gold nanoparticles. Nano Lett 11, 5344-5348.

Andrews, R.G., Takahashi, M., Segal, G.M., Powell, J.S., Bernstein, I.D., Singer, J.W.,

1986. The L4F3 antigen is expressed by unipotent and multipotent colony-forming cells

but not by their precursors. Blood 68, 1030-1035.

Andrews, R.G., Torok-Storb, B., Bernstein, I.D., 1983. Myeloid-associated differentiation

antigens on stem cells and their progeny identified by monoclonal antibodies. Blood 62,

124-132.

Asao, T., Fukuda, T., Yazawa, S., Nagamachi, Y., 1991. Carcinoembryonic antigen levels

in peritoneal washings can predict peritoneal recurrence after curative resection of gastric

cancer. Cancer 68, 44-47.

Aurup, H., Williams, D.M., Eckstein, F., 1992. 2'-Fluoro- and 2'-amino-2'-

deoxynucleoside 5'-triphosphates as substrates for T7 RNA polymerase. Biochemistry

31, 9636-9641.

Bagalkot, V., Farokhzad, O.C., Langer, R., Jon, S., 2006. An aptamer-doxorubicin

physical conjugate as a novel targeted drug-delivery platform. Angew Chem Int Ed Engl

45, 8149-8152.

Bagalkot, V., Zhang, L., Levy-Nissenbaum, E., Jon, S., Kantoff, P.W., Langer, R.,

Farokhzad, O.C., 2007. Quantum dot-aptamer conjugates for synchronous cancer

imaging, therapy, and sensing of drug delivery based on bi-fluorescence resonance

energy transfer. Nano Lett 7, 3065-3070.

Bangham, A.D., Standish, M.M., Watkins, J.C., 1965. Diffusion of univalent ions across

the lamellae of swollen phospholipids. J Mol Biol 13, 238-252.

Barciszewski, J., Medgaard, M., Koch, T., Kurreck, J., Erdmann, V.A., 2009. Locked

nucleic acid aptamers. Methods Mol Biol 535, 165-186.

Bates, P.J., Kahlon, J.B., Thomas, S.D., Trent, J.O., Miller, D.M., 1999. Antiproliferative

activity of G-rich oligonucleotides correlates with protein binding. J Biol Chem 274,

26369-26377.

Behr, T.M., Liersch, T., Greiner-Bechert, L., Griesinger, F., Behe, M., Markus, P.M.,

Gratz, S., Angerstein, C., Brittinger, G., Becker, H., Goldenberg, D.M., Becker, W., 2002.

Radioimmunotherapy of small-volume disease of metastatic colorectal cancer. Cancer

94, 1373-1381.

Benchimol, S., Fuks, A., Jothy, S., Beauchemin, N., Shirota, K., Stanners, C.P., 1989.

Carcinoembryonic antigen, a human tumor marker, functions as an intercellular adhesion

143

molecule. Cell 57, 327-334.

Berinstein, N.L., 2002. Carcinoembryonic antigen as a target for therapeutic anticancer

vaccines: a review. J Clin Oncol 20, 2197-2207.

Bernstein, I.D., 2000. Monoclonal antibodies to the myeloid stem cells: therapeutic

implications of CMA-676, a humanized anti-CD33 antibody calicheamicin conjugate.

Leukemia 14, 474-475.

Berry, C.C., Wells, S., Charles, S., Curtis, A.S., 2003. Dextran and albumin derivatised

iron oxide nanoparticles: influence on fibroblasts in vitro. Biomaterials 24, 4551-4557.

Beutler, B.A., 1999. The role of tumor necrosis factor in health and disease. J Rheumatol

Suppl 57, 16-21.

Blank, M., Weinschenk, T., Priemer, M., Schluesener, H., 2001. Systematic evolution of a

DNA aptamer binding to rat brain tumor microvessels. selective targeting of endothelial

regulatory protein pigpen. J Biol Chem 276, 16464-16468.

Bless, N.M., Smith, D., Charlton, J., Czermak, B.J., Schmal, H., Friedl, H.P., Ward, P.A.,

1997. Protective effects of an aptamer inhibitor of neutrophil elastase in lung

inflammatory injury. Curr Biol 7, 877-880.

Blumenthal, R.D., Hansen, H.J., Goldenberg, D.M., 2005. Inhibition of adhesion,

invasion, and metastasis by antibodies targeting CEACAM6 (NCA-90) and CEACAM5

(Carcinoembryonic Antigen). Cancer Res 65, 8809-8817.

Bock, L.C., Griffin, L.C., Latham, J.A., Vermaas, E.H., Toole, J.J., 1992. Selection of

single-stranded DNA molecules that bind and inhibit human thrombin. Nature 355, 564-

566.

Bode, W., Turk, D., Karshikov, A., 1992. The refined 1.9-A X-ray crystal structure of D-

Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis,

overall structure, electrostatic properties, detailed active-site geometry, and structure-

function relationships. Protein Sci 1, 426-471.

Boiziau, C., Dausse, E., Yurchenko, L., Toulme, J.J., 1999. DNA aptamers selected

against the HIV-1 trans-activation-responsive RNA element form RNA-DNA kissing

complexes. J Biol Chem 274, 12730-12737.

Boomer, R.M., Lewis, S.D., Healy, J.M., Kurz, M., Wilson, C., McCauley, T.G., 2005.

Conjugation to polyethylene glycol polymer promotes aptamer biodistribution to healthy

and inflamed tissues. Oligonucleotides 15, 183-195.

Borish, L.C., Steinke, J.W., 2003. 2. Cytokines and chemokines. J Allergy Clin Immunol

111, S460-475.

Boucher, D., Cournoyer, D., Stanners, C.P., Fuks, A., 1989. Studies on the control of gene

expression of the carcinoembryonic antigen family in human tissue. Cancer Res 49, 847-

852.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72,

248-254.

Brennan, F.M., Chantry, D., Jackson, A., Maini, R., Feldmann, M., 1989. Inhibitory

effect of TNF alpha antibodies on synovial cell interleukin-1 production in rheumatoid

arthritis. Lancet 2, 244-247.

Brokx, R.D., Revers, L., Zhang, Q., Yang, S., Mal, T.K., Ikura, M., Gariepy, J., 2003.

Nuclear magnetic resonance-based dissection of a glycosyltransferase specificity for the

mucin MUC1 tandem repeat. Biochemistry 42, 13817-13825.

Bryan, J.N., Jia, F., Mohsin, H., Sivaguru, G., Miller, W.H., Anderson, C.J., Henry, C.J.,

Lewis, M.R., 2005. Comparative uptakes and biodistributions of internalizing vs.

144

noninternalizing copper-64 radioimmunoconjugates in cell and animal models of colon

cancer. Nucl Med Biol 32, 851-858.

Bunka, D.H., Platonova, O., Stockley, P.G., 2010. Development of aptamer therapeutics.

Curr Opin Pharmacol 10, 557-562.

Burge, S., Parkinson, G.N., Hazel, P., Todd, A.K., Neidle, S., 2006. Quadruplex DNA:

sequence, topology and structure. Nucleic Acids Res 34, 5402-5415.

Cai, Z., Ye, Z., Yang, X., Chang, Y., Wang, H., Liu, Y., Cao, A., 2011. Encapsulated

enhanced green fluorescence protein in silica nanoparticle for cellular imaging.

Nanoscale 3, 1974-1976.

Camacho-Leal, P., Stanners, C.P., 2008. The human carcinoembryonic antigen (CEA)

GPI anchor mediates anoikis inhibition by inactivation of the intrinsic death pathway.

Oncogene 27, 1545-1553.

Cao, Z., Tong, R., Mishra, A., Xu, W., Wong, G.C., Cheng, J., Lu, Y., 2009. Reversible

cell-specific drug delivery with aptamer-functionalized liposomes. Angew Chem Int Ed

Engl 48, 6494-6498.

Carswell, E.A., Old, L.J., Kassel, R.L., Green, S., Fiore, N., Williamson, B., 1975. An

endotoxin-induced serum factor that causes necrosis of tumors. Proc Natl Acad Sci U S A

72, 3666-3670.

Ceriani, R.L., Chan, C.M., Baratta, F.S., Ozzello, L., DeRosa, C.M., Habif, D.V., 1992.

Levels of expression of breast epithelial mucin detected by monoclonal antibody BrE-3

in breast-cancer prognosis. Int J Cancer 51, 343-354.

Chang, H.I., Yeh, M.K., 2012. Clinical development of liposome-based drugs:

formulation, characterization, and therapeutic efficacy. Int J Nanomedicine 7, 49-60.

Chang, S.S., Reuter, V.E., Heston, W.D., Bander, N.H., Grauer, L.S., Gaudin, P.B., 1999.

Five different anti-prostate-specific membrane antigen (PSMA) antibodies confirm

PSMA expression in tumor-associated neovasculature. Cancer Res 59, 3192-3198.

Charbonneau, J., Stanners, C.P., 1999. Role of carbohydrate structures in CEA-mediated

intercellular adhesion. Cell Adhes Commun 7, 233-244.

Chen, C.H., Chernis, G.A., Hoang, V.Q., Landgraf, R., 2003. Inhibition of heregulin

signaling by an aptamer that preferentially binds to the oligomeric form of human

epidermal growth factor receptor-3. Proc Natl Acad Sci U S A 100, 9226-9231.

Chen, P., Wang, J., Hope, K., Jin, L., Dick, J., Cameron, R., Brandwein, J., Minden, M.,

Reilly, R.M., 2006. Nuclear localizing sequences promote nuclear translocation and

enhance the radiotoxicity of the anti-CD33 monoclonal antibody HuM195 labeled with

111In in human myeloid leukemia cells. J Nucl Med 47, 827-836.

Cheng, J., Teply, B.A., Sherifi, I., Sung, J., Luther, G., Gu, F.X., Levy-Nissenbaum, E.,

Radovic-Moreno, A.F., Langer, R., Farokhzad, O.C., 2007. Formulation of functionalized

PLGA-PEG nanoparticles for in vivo targeted drug delivery. Biomaterials 28, 869-876.

Chevallier, P., Robillard, N., Ayari, S., Guillaume, T., Delaunay, J., Mechinaud, F., Avet-

Loiseau, H., Mohty, M., Harousseau, J.L., Garand, R., 2008. Persistence of CD33

expression at relapse in CD33(+) acute myeloid leukaemia patients after receiving

Gemtuzumab in the course of the disease. Br J Haematol 143, 744-746.

Chevinsky, A.H., 1991. CEA in tumors of other than colorectal origin. Semin Surg Oncol

7, 162-166.

Chou, S.H., Chin, K.H., Wang, A.H., 2003. Unusual DNA duplex and hairpin motifs.

Nucleic Acids Res 31, 2461-2474.

Chou, S.H., Chin, K.H., Wang, A.H., 2005. DNA aptamers as potential anti-HIV agents.

Trends Biochem Sci 30, 231-234.

145

Choy, E.H., Hazleman, B., Smith, M., Moss, K., Lisi, L., Scott, D.G., Patel, J., Sopwith,

M., Isenberg, D.A., 2002. Efficacy of a novel PEGylated humanized anti-TNF fragment

(CDP870) in patients with rheumatoid arthritis: a phase II double-blinded, randomized,

dose-escalating trial. Rheumatology (Oxford) 41, 1133-1137.

Chu, T.C., Marks, J.W., 3rd, Lavery, L.A., Faulkner, S., Rosenblum, M.G., Ellington,

A.D., Levy, M., 2006a. Aptamer:toxin conjugates that specifically target prostate tumor

cells. Cancer Res 66, 5989-5992.

Chu, T.C., Shieh, F., Lavery, L.A., Levy, M., Richards-Kortum, R., Korgel, B.A.,

Ellington, A.D., 2006b. Labeling tumor cells with fluorescent nanocrystal-aptamer

bioconjugates. Biosens Bioelectron 21, 1859-1866.

Collie, G.W., Parkinson, G.N., 2011. The application of DNA and RNA G-quadruplexes

to therapeutic medicines. Chem Soc Rev 40, 5867-5892.

Conrad, R., Keranen, L.M., Ellington, A.D., Newton, A.C., 1994. Isozyme-specific

inhibition of protein kinase C by RNA aptamers. J Biol Chem 269, 32051-32054.

D'Amico, D.J., Masonson, H.N., Patel, M., Adamis, A.P., Cunningham, E.T., Jr., Guyer,

D.R., Katz, B., 2006. Pegaptanib sodium for neovascular age-related macular

degeneration: two-year safety results of the two prospective, multicenter, controlled

clinical trials. Ophthalmology 113, 992-1001 e1006.

Da Pieve, C., Blackshaw, E., Missailidis, S., Perkins, A.C., 2012. PEGylation and

biodistribution of an anti-MUC1 aptamer in MCF-7 tumor-bearing mice. Bioconjug

Chem 23, 1377-1381.

Dapic, V., Bates, P.J., Trent, J.O., Rodger, A., Thomas, S.D., Miller, D.M., 2002.

Antiproliferative activity of G-quartet-forming oligonucleotides with backbone and sugar

modifications. Biochemistry 41, 3676-3685.

Dhar, S., Gu, F.X., Langer, R., Farokhzad, O.C., Lippard, S.J., 2008. Targeted delivery of

cisplatin to prostate cancer cells by aptamer functionalized Pt(IV) prodrug-PLGA-PEG

nanoparticles. Proc Natl Acad Sci U S A 105, 17356-17361.

Dillman, R.O., 2011. Cancer immunotherapy. Cancer Biother Radiopharm 26, 1-64.

Ding, A.H., Nathan, C.F., Stuehr, D.J., 1988. Release of reactive nitrogen intermediates

and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of

activating cytokines and evidence for independent production. J Immunol 141, 2407-

2412.

Dinndorf, P.A., Andrews, R.G., Benjamin, D., Ridgway, D., Wolff, L., Bernstein, I.D.,

1986. Expression of normal myeloid-associated antigens by acute leukemia cells. Blood

67, 1048-1053.

Duffy, M.J., 2006. Serum tumor markers in breast cancer: are they of clinical value? Clin

Chem 52, 345-351.

Eaton, B.E., Gold, L., Hicke, B.J., Janjic, N., Jucker, F.M., Sebesta, D.P., Tarasow, T.M.,

Willis, M.C., Zichi, D.A., 1997. Post-SELEX combinatorial optimization of aptamers.

Bioorg Med Chem 5, 1087-1096.

Ehlers, S., 2005. Tumor necrosis factor and its blockade in granulomatous infections:

differential modes of action of infliximab and etanercept? Clin Infect Dis 41 Suppl 3,

S199-203.

Ellington, A.D., Szostak, J.W., 1990. In vitro selection of RNA molecules that bind

specific ligands. Nature 346, 818-822.

Fang, C., Zhang, M., 2009. Multifunctional Magnetic Nanoparticles for Medical Imaging

Applications. J Mater Chem 19, 6258-6266.

Farokhzad, O.C., Cheng, J., Teply, B.A., Sherifi, I., Jon, S., Kantoff, P.W., Richie, J.P.,

146

Langer, R., 2006. Targeted nanoparticle-aptamer bioconjugates for cancer chemotherapy

in vivo. Proc Natl Acad Sci U S A 103, 6315-6320.

Farokhzad, O.C., Jon, S., Khademhosseini, A., Tran, T.N., Lavan, D.A., Langer, R., 2004.

Nanoparticle-aptamer bioconjugates: a new approach for targeting prostate cancer cells.

Cancer Res 64, 7668-7672.

Fedarovich, A., Tomberg, J., Nicholas, R.A., Davies, C., 2006. Structure of the N-

terminal domain of human CEACAM1: binding target of the opacity proteins during

invasion of Neisseria meningitidis and N. gonorrhoeae. Acta Crystallogr D Biol

Crystallogr 62, 971-979.

Feldmann, M., Brennan, F.M., Foxwell, B.M., Taylor, P.C., Williams, R.O., Maini, R.N.,

2005. Anti-TNF therapy: where have we got to in 2005? J Autoimmun 25 Suppl, 26-28.

Feldmann, M., Brennan, F.M., Williams, R.O., Cope, A.P., Gibbons, D.L., Katsikis, P.D.,

Maini, R.N., 1992. Evaluation of the role of cytokines in autoimmune disease: the

importance of TNF alpha in rheumatoid arthritis. Prog Growth Factor Res 4, 247-255.

Feldmann, M., Charles, P., Taylor, P., Maini, R.N., 1998. Biological insights from clinical

trials with anti-TNF therapy. Springer Semin Immunopathol 20, 211-228.

Feldmann, M., Maini, R.N., 2001. Anti-TNF alpha therapy of rheumatoid arthritis: what

have we learned? Annu Rev Immunol 19, 163-196.

Feldmann, M., Maini, R.N., Bondeson, J., Taylor, P., Foxwell, B.M., Brennan, F.M.,

2001. Cytokine blockade in rheumatoid arthritis. Adv Exp Med Biol 490, 119-127.

Feldmann, M., Maini, S.R., 2008. Role of cytokines in rheumatoid arthritis: an education

in pathophysiology and therapeutics. Immunol Rev 223, 7-19.

Ferreira, C.S., Cheung, M.C., Missailidis, S., Bisland, S., Gariepy, J., 2009. Phototoxic

aptamers selectively enter and kill epithelial cancer cells. Nucleic Acids Res 37, 866-876.

Fidler, I.J., 2003. The pathogenesis of cancer metastasis: the 'seed and soil' hypothesis

revisited. Nat Rev Cancer 3, 453-458.

Ford, C.H., Tsaltas, G.C., Osborne, P.A., Addetia, K., 1996. Novel flow cytometric

analysis of the progress and route of internalization of a monoclonal anti-

carcinoembryonic antigen (CEA) antibody. Cytometry 23, 228-240.

Foy, J.W., Rittenhouse, K., Modi, M., Patel, M., 2007. Local tolerance and systemic

safety of pegaptanib sodium in the dog and rabbit. J Ocul Pharmacol Ther 23, 452-466.

Freeman, S.D., Kelm, S., Barber, E.K., Crocker, P.R., 1995. Characterization of CD33 as

a new member of the sialoadhesin family of cellular interaction molecules. Blood 85,

2005-2012.

Furst, D.E., Wallis, R., Broder, M., Beenhouwer, D.O., 2006. Tumor necrosis factor

antagonists: different kinetics and/or mechanisms of action may explain differences in

the risk for developing granulomatous infection. Semin Arthritis Rheum 36, 159-167.

Gendler, S., Taylor-Papadimitriou, J., Duhig, T., Rothbard, J., Burchell, J., 1988. A highly

immunogenic region of a human polymorphic epithelial mucin expressed by carcinomas

is made up of tandem repeats. J Biol Chem 263, 12820-12823.

Gilbert, D.E., Feigon, J., 1999. Multistranded DNA structures. Curr Opin Struct Biol 9,

305-314.

Gilbey, A.M., Burnett, D., Coleman, R.E., Holen, I., 2004. The detection of circulating

breast cancer cells in blood. J Clin Pathol 57, 903-911.

Girvan, A.C., Teng, Y., Casson, L.K., Thomas, S.D., Juliger, S., Ball, M.W., Klein, J.B.,

Pierce, W.M., Jr., Barve, S.S., Bates, P.J., 2006. AGRO100 inhibits activation of nuclear

factor-kappaB (NF-kappaB) by forming a complex with NF-kappaB essential modulator

(NEMO) and nucleolin. Mol Cancer Ther 5, 1790-1799.

147

Gold, P., Freedman, S.O., 1965a. Demonstration of Tumor-Specific Antigens in Human

Colonic Carcinomata by Immunological Tolerance and Absorption Techniques. J Exp

Med 121, 439-462.

Gold, P., Freedman, S.O., 1965b. Specific carcinoembryonic antigens of the human

digestive system. J Exp Med 122, 467-481.

Goldenberg, D.M., 2002. Targeted therapy of cancer with radiolabeled antibodies. J Nucl

Med 43, 693-713.

Goldenberg, D.M., Sharkey, R.M., Primus, F.J., 1976. Carcinoembryonic antigen in

histopathology: immunoperoxidase staining of conventional tissue sections. J Natl

Cancer Inst 57, 11-22.

Goldmacher, V.S., Scott, C.F., Lambert, J.M., McIntyre, G.D., Blattler, W.A., Collnhson,

A.R., Stewart, J.K., Chong, L.D., Cook, S., Slayter, H.S., et al., 1989. Cytotoxicity of

gelonin and its conjugates with antibodies is determined by the extent of their

endocytosis. J Cell Physiol 141, 222-234.

Goldstein, M.J., Mitchell, E.P., 2005. Carcinoembryonic antigen in the staging and

follow-up of patients with colorectal cancer. Cancer Invest 23, 338-351.

Graff, C.P., Wittrup, K.D., 2003. Theoretical analysis of antibody targeting of tumor

spheroids: importance of dosage for penetration, and affinity for retention. Cancer Res

63, 1288-1296.

Gregoriadis, G., 1995. Engineering liposomes for drug delivery: progress and problems.

Trends Biotechnol 13, 527-537.

Griffin, J.D., Linch, D., Sabbath, K., Larcom, P., Schlossman, S.F., 1984. A monoclonal

antibody reactive with normal and leukemic human myeloid progenitor cells. Leuk Res

8, 521-534.

Gutsaeva, D.R., Parkerson, J.B., Yerigenahally, S.D., Kurz, J.C., Schaub, R.G., Ikuta, T.,

Head, C.A., 2010. Inhibition of cell adhesion by anti-P-selectin aptamer: a new potential

therapeutic agent for sickle cell disease. Blood 117, 727-735.

Gutsaeva, D.R., Parkerson, J.B., Yerigenahally, S.D., Kurz, J.C., Schaub, R.G., Ikuta, T.,

Head, C.A., 2011. Inhibition of cell adhesion by anti-P-selectin aptamer: a new potential

therapeutic agent for sickle cell disease. Blood 117, 727-735.

Hale, S.P., Schimmel, P., 1996. Protein synthesis editing by a DNA aptamer. Proc Natl

Acad Sci U S A 93, 2755-2758.

Hamann, P.R., Hinman, L.M., Beyer, C.F., Lindh, D., Upeslacis, J., Flowers, D.A.,

Bernstein, I., 2002. An anti-CD33 antibody-calicheamicin conjugate for treatment of

acute myeloid leukemia. Choice of linker. Bioconjug Chem 13, 40-46.

Hammarstrom, S., 1999. The carcinoembryonic antigen (CEA) family: structures,

suggested functions and expression in normal and malignant tissues. Semin Cancer Biol

9, 67-81.

Hamula, C.L., Zhang, H., Guan, L.L., Li, X.F., Le, X.C., 2008. Selection of aptamers

against live bacterial cells. Anal Chem 80, 7812-7819.

Hanahan, D., Weinberg, R.A., 2000. The hallmarks of cancer. Cell 100, 57-70.

Hanahan, D., Weinberg, R.A., 2011. Hallmarks of cancer: the next generation. Cell 144,

646-674.

Hanisch, F.G., Muller, S., 2000. MUC1: the polymorphic appearance of a human mucin.

Glycobiology 10, 439-449.

Hanisch, F.G., Stadie, T.R., Deutzmann, F., Peter-Katalinic, J., 1996. MUC1 glycoforms

in breast cancer--cell line T47D as a model for carcinoma-associated alterations of 0-

glycosylation. Eur J Biochem 236, 318-327.

148

Hardin, C.C., Henderson, E., Watson, T., Prosser, J.K., 1991. Monovalent cation induced

structural transitions in telomeric DNAs: G-DNA folding intermediates. Biochemistry

30, 4460-4472.

Hardin, C.C., Watson, T., Corregan, M., Bailey, C., 1992. Cation-dependent transition

between the quadruplex and Watson-Crick hairpin forms of d(CGCG3GCG).

Biochemistry 31, 833-841.

Harris, L., Fritsche, H., Mennel, R., Norton, L., Ravdin, P., Taube, S., Somerfield, M.R.,

Hayes, D.F., Bast, R.C., Jr., 2007. American Society of Clinical Oncology 2007 update of

recommendations for the use of tumor markers in breast cancer. J Clin Oncol 25, 5287-

5312.

Healy, J.M., Lewis, S.D., Kurz, M., Boomer, R.M., Thompson, K.M., Wilson, C.,

McCauley, T.G., 2004. Pharmacokinetics and biodistribution of novel aptamer

compositions. Pharm Res 21, 2234-2246.

Hehlgans, T., Pfeffer, K., 2005. The intriguing biology of the tumour necrosis

factor/tumour necrosis factor receptor superfamily: players, rules and the games.

Immunology 115, 1-20.

Henderikx, P., Coolen-van Neer, N., Jacobs, A., van der Linden, E., Arends, J.W.,

Mullberg, J., Hoogenboom, H.R., 2002. A human immunoglobulin G1 antibody

originating from an in vitro-selected Fab phage antibody binds avidly to tumor-

associated MUC1 and is efficiently internalized. Am J Pathol 160, 1597-1608.

Hicke, B.J., Marion, C., Chang, Y.F., Gould, T., Lynott, C.K., Parma, D., Schmidt, P.G.,

Warren, S., 2001. Tenascin-C aptamers are generated using tumor cells and purified

protein. J Biol Chem 276, 48644-48654.

Hicke, B.J., Stephens, A.W., Gould, T., Chang, Y.F., Lynott, C.K., Heil, J., Borkowski, S.,

Hilger, C.S., Cook, G., Warren, S., Schmidt, P.G., 2006. Tumor targeting by an aptamer. J

Nucl Med 47, 668-678.

Hicke, B.J., Watson, S.R., Koenig, A., Lynott, C.K., Bargatze, R.F., Chang, Y.F.,

Ringquist, S., Moon-McDermott, L., Jennings, S., Fitzwater, T., Han, H.L., Varki, N.,

Albinana, I., Willis, M.C., Varki, A., Parma, D., 1996. DNA aptamers block L-selectin

function in vivo. Inhibition of human lymphocyte trafficking in SCID mice. J Clin Invest

98, 2688-2692.

Holthoff, E.L., Bright, F.V., 2007. Molecularly templated materials in chemical sensing.

Anal Chim Acta 594, 147-161.

Hong, B.J., Compton, O.C., An, Z., Eryazici, I., Nguyen, S.T., 2012. Successful

stabilization of graphene oxide in electrolyte solutions: enhancement of

biofunctionalization and cellular uptake. ACS Nano 6, 63-73.

Hostetter, R.B., Augustus, L.B., Mankarious, R., Chi, K.F., Fan, D., Toth, C., Thomas, P.,

Jessup, J.M., 1990. Carcinoembryonic antigen as a selective enhancer of colorectal

cancer metastasis. J Natl Cancer Inst 82, 380-385.

Hu, Y., Duan, J., Zhan, Q., Wang, F., Lu, X., Yang, X.D., 2012. Novel MUC1 aptamer

selectively delivers cytotoxic agent to cancer cells in vitro. PLoS One 7, e31970.

Huang, Y., He, S., Cao, W., Cai, K., Liang, X.J., 2012. Biomedical nanomaterials for

imaging-guided cancer therapy. Nanoscale 4, 6135-6149.

Huang, Y.F., Chang, H.T., Tan, W., 2008. Cancer cell targeting using multiple aptamers

conjugated on nanorods. Anal Chem 80, 567-572.

Huang, Y.F., Shangguan, D., Liu, H., Phillips, J.A., Zhang, X., Chen, Y., Tan, W., 2009.

Molecular assembly of an aptamer-drug conjugate for targeted drug delivery to tumor

cells. Chembiochem 10, 862-868.

149

Huang, Y.W., Baluna, R., Vitetta, E.S., 1997. Adhesion molecules as targets for cancer

therapy. Histol Histopathol 12, 467-477.

Ishida, T., Iden, D.L., Allen, T.M., 1999. A combinatorial approach to producing

sterically stabilized (Stealth) immunoliposomal drugs. FEBS Lett 460, 129-133.

Jellinek, D., Green, L.S., Bell, C., Janjic, N., 1994. Inhibition of receptor binding by

high-affinity RNA ligands to vascular endothelial growth factor. Biochemistry 33, 10450-

10456.

Jellinek, D., Green, L.S., Bell, C., Lynott, C.K., Gill, N., Vargeese, C., Kirschenheuter,

G., McGee, D.P., Abesinghe, P., Pieken, W.A., et al., 1995. Potent 2'-amino-2'-

deoxypyrimidine RNA inhibitors of basic fibroblast growth factor. Biochemistry 34,

11363-11372.

Jellinek, D., Lynott, C.K., Rifkin, D.B., Janjic, N., 1993. High-affinity RNA ligands to

basic fibroblast growth factor inhibit receptor binding. Proc Natl Acad Sci U S A 90,

11227-11231.

Jemal, A., Siegel, R., Ward, E., Hao, Y., Xu, J., Murray, T., Thun, M.J., 2008. Cancer

statistics, 2008. CA Cancer J Clin 58, 71-96.

Jessup, J.M., Kim, J.C., Thomas, P., Ishii, S., Ford, R., Shively, J.E., Durbin, H.,

Stanners, C.P., Fuks, A., Zhou, H., et al., 1993a. Adhesion to carcinoembryonic antigen

by human colorectal carcinoma cells involves at least two epitopes. Int J Cancer 55, 262-

268.

Jessup, J.M., Laguinge, L., Lin, S., Samara, R., Aufman, K., Battle, P., Frantz, M.,

Edmiston, K.H., Thomas, P., 2004. Carcinoembryonic antigen induction of IL-10 and IL-

6 inhibits hepatic ischemic/reperfusion injury to colorectal carcinoma cells. Int J Cancer

111, 332-337.

Jessup, J.M., Petrick, A.T., Toth, C.A., Ford, R., Meterissian, S., O'Hara, C.J., Steele, G.,

Jr., Thomas, P., 1993b. Carcinoembryonic antigen: enhancement of liver colonisation

through retention of human colorectal carcinoma cells. Br J Cancer 67, 464-470.

Kaneda, Y., 2000. Virosomes: evolution of the liposome as a targeted drug delivery

system. Adv Drug Deliv Rev 43, 197-205.

Kashyap, N., Kumar, N., Kumar, M.N., 2005. Hydrogels for pharmaceutical and

biomedical applications. Crit Rev Ther Drug Carrier Syst 22, 107-149.

Kaur, G., Roy, I., 2008. Therapeutic applications of aptamers. Expert Opin Investig Drugs

17, 43-60.

Keefe, A.D., Cload, S.T., 2008. SELEX with modified nucleotides. Curr Opin Chem Biol

12, 448-456.

Keefe, A.D., Pai, S., Ellington, A., 2010. Aptamers as therapeutics. Nat Rev Drug Discov

9, 537-550.

Kikin, O., D'Antonio, L., Bagga, P.S., 2006. QGRS Mapper: a web-based server for

predicting G-quadruplexes in nucleotide sequences. Nucleic Acids Res 34, W676-682.

Kitsuki, H., Katano, M., Morisaki, T., Torisu, M., 1995. CEA-mediated homotypic

aggregation of human colorectal carcinoma cells in a malignant effusion. Cancer Lett 88,

7-13.

Komatsu, M., Kobayashi, D., Saito, K., Furuya, D., Yagihashi, A., Araake, H., Tsuji, N.,

Sakamaki, S., Niitsu, Y., Watanabe, N., 2001. Tumor necrosis factor-alpha in serum of

patients with inflammatory bowel disease as measured by a highly sensitive immuno-

PCR. Clin Chem 47, 1297-1301.

Korotkova, N., Yang, Y., Le Trong, I., Cota, E., Demeler, B., Marchant, J., Thomas, W.E.,

Stenkamp, R.E., Moseley, S.L., Matthews, S., 2008. Binding of Dr adhesins of

150

Escherichia coli to carcinoembryonic antigen triggers receptor dissociation. Mol

Microbiol 67, 420-434.

Kourlas, H., Abrams, P., 2007. Ranibizumab for the treatment of neovascular age-related

macular degeneration: a review. Clin Ther 29, 1850-1861.

Krieg, A.M., 2002. CpG motifs in bacterial DNA and their immune effects. Annu Rev

Immunol 20, 709-760.

Krop-Watorek, A., Klopocki, A.G., Czerwinski, M., Lisowska, E., 2002. Adhesive

properties of carcinoembryonic antigen glycoforms expressed in glycosylation-deficient

Chinese hamster ovary cell lines. Acta Biochim Pol 49, 273-283.

Krug, A., Rothenfusser, S., Hornung, V., Jahrsdorfer, B., Blackwell, S., Ballas, Z.K.,

Endres, S., Krieg, A.M., Hartmann, G., 2001. Identification of CpG oligonucleotide

sequences with high induction of IFN-alpha/beta in plasmacytoid dendritic cells. Eur J

Immunol 31, 2154-2163.

Kumar, P., Gulbake, A., Jain, S.K., 2012. Liposomes a vesicular nanocarrier: potential

advancements in cancer chemotherapy. Crit Rev Ther Drug Carrier Syst 29, 355-419.

Latham, J.A., Johnson, R., Toole, J.J., 1994. The application of a modified nucleotide in

aptamer selection: novel thrombin aptamers containing 5-(1-pentynyl)-2'-deoxyuridine.

Nucleic Acids Res 22, 2817-2822.

Laurent, S., Forge, D., Port, M., Roch, A., Robic, C., Vander Elst, L., Muller, R.N., 2008.

Magnetic iron oxide nanoparticles: synthesis, stabilization, vectorization,

physicochemical characterizations, and biological applications. Chem Rev 108, 2064-

2110.

Lee, Y.J., Han, S.R., Kim, N.Y., Lee, S.H., Jeong, J.S., Lee, S.W., 2012. An RNA aptamer

that binds carcinoembryonic antigen inhibits hepatic metastasis of colon cancer cells in

mice. Gastroenterology 143, 155-165 e158.

Liao, K.H., Lin, Y.S., Macosko, C.W., Haynes, C.L., 2011. Cytotoxicity of graphene

oxide and graphene in human erythrocytes and skin fibroblasts. ACS Appl Mater

Interfaces 3, 2607-2615.

Linsley, P.S., Brown, J.P., Magnani, J.L., Horn, D., 1988. Monoclonal antibodies reactive

with mucin glycoproteins found in sera from breast cancer patients. Cancer Res 48,

2138-2148.

Litvinov, S.V., Hilkens, J., 1993. The epithelial sialomucin, episialin, is sialylated during

recycling. J Biol Chem 268, 21364-21371.

Liu, H., Rajasekaran, A.K., Moy, P., Xia, Y., Kim, S., Navarro, V., Rahmati, R., Bander,

N.H., 1998. Constitutive and antibody-induced internalization of prostate-specific

membrane antigen. Cancer Res 58, 4055-4060.

Liu, J., Cao, Z., Lu, Y., 2009a. Functional nucleic acid sensors. Chem Rev 109, 1948-

1998.

Liu, K., Zhang, J.J., Wang, C., Zhu, J.J., 2011. Graphene-assisted dual amplification

strategy for the fabrication of sensitive amperometric immunosensor. Biosens

Bioelectron 26, 3627-3632.

Liu, Y., Kuan, C.T., Mi, J., Zhang, X., Clary, B.M., Bigner, D.D., Sullenger, B.A., 2009b.

Aptamers selected against the unglycosylated EGFRvIII ectodomain and delivered

intracellularly reduce membrane-bound EGFRvIII and induce apoptosis. Biol Chem 390,

137-144.

Locksley, R.M., Killeen, N., Lenardo, M.J., 2001. The TNF and TNF receptor

superfamilies: integrating mammalian biology. Cell 104, 487-501.

Long, S.B., Long, M.B., White, R.R., Sullenger, B.A., 2008. Crystal structure of an RNA

151

aptamer bound to thrombin. RNA 14, 2504-2512.

Lupold, S.E., Hicke, B.J., Lin, Y., Coffey, D.S., 2002. Identification and characterization

of nuclease-stabilized RNA molecules that bind human prostate cancer cells via the

prostate-specific membrane antigen. Cancer Res 62, 4029-4033.

Maas, S., 2011. Base modification RNA editing: information recoding on the fly. Semin

Cell Dev Biol 23, 243.

Macaya, R.F., Schultze, P., Smith, F.W., Roe, J.A., Feigon, J., 1993. Thrombin-binding

DNA aptamer forms a unimolecular quadruplex structure in solution. Proc Natl Acad Sci

U S A 90, 3745-3749.

Maeda, H., 2001. The enhanced permeability and retention (EPR) effect in tumor

vasculature: the key role of tumor-selective macromolecular drug targeting. Adv Enzyme

Regul 41, 189-207.

Maini, R.N., Brennan, F.M., Williams, R., Chu, C.Q., Cope, A.P., Gibbons, D., Elliott,

M., Feldmann, M., 1993. TNF-alpha in rheumatoid arthritis and prospects of anti-TNF

therapy. Clin Exp Rheumatol 11 Suppl 8, S173-175.

Mamaghani, S., Patel, S., Hedley, D.W., 2009. Glycogen synthase kinase-3 inhibition

disrupts nuclear factor-kappaB activity in pancreatic cancer, but fails to sensitize to

gemcitabine chemotherapy. BMC Cancer 9, 132.

Mamot, C., Drummond, D.C., Greiser, U., Hong, K., Kirpotin, D.B., Marks, J.D., Park,

J.W., 2003. Epidermal growth factor receptor (EGFR)-targeted immunoliposomes

mediate specific and efficient drug delivery to EGFR- and EGFRvIII-overexpressing

tumor cells. Cancer Res 63, 3154-3161.

Mann, A.P., Bhavane, R.C., Somasunderam, A., Liz Montalvo-Ortiz, B., Ghaghada, K.B.,

Volk, D., Nieves-Alicea, R., Suh, K.S., Ferrari, M., Annapragada, A., Gorenstein, D.G.,

Tanaka, T., 2011. Thioaptamer conjugated liposomes for tumor vasculature targeting.

Oncotarget 2, 298-304.

Mann, A.P., Somasunderam, A., Nieves-Alicea, R., Li, X., Hu, A., Sood, A.K., Ferrari,

M., Gorenstein, D.G., Tanaka, T., 2010. Identification of thioaptamer ligand against E-

selectin: potential application for inflamed vasculature targeting. PLoS One 5.

Marchand, C., Pourquier, P., Laco, G.S., Jing, N., Pommier, Y., 2002. Interaction of

human nuclear topoisomerase I with guanosine quartet-forming and guanosine-rich

single-stranded DNA and RNA oligonucleotides. J Biol Chem 277, 8906-8911.

Markel, G., Gruda, R., Achdout, H., Katz, G., Nechama, M., Blumberg, R.S., Kammerer,

R., Zimmermann, W., Mandelboim, O., 2004. The critical role of residues 43R and 44Q

of carcinoembryonic antigen cell adhesion molecules-1 in the protection from killing by

human NK cells. J Immunol 173, 3732-3739.

Matrone, M.A., Whipple, R.A., Thompson, K., Cho, E.H., Vitolo, M.I., Balzer, E.M.,

Yoon, J.R., Ioffe, O.B., Tuttle, K.C., Tan, M., Martin, S.S., 2010. Metastatic breast

tumors express increased tau, which promotes microtentacle formation and the

reattachment of detached breast tumor cells. Oncogene 29, 3217-3227.

Matsumura, Y., Maeda, H., 1986. A new concept for macromolecular therapeutics in

cancer chemotherapy: mechanism of tumoritropic accumulation of proteins and the

antitumor agent smancs. Cancer Res 46, 6387-6392.

Matthews, N., Neale, M.L., Jackson, S.K., Stark, J.M., 1987. Tumour cell killing by

tumour necrosis factor: inhibition by anaerobic conditions, free-radical scavengers and

inhibitors of arachidonate metabolism. Immunology 62, 153-155.

Mayer, G., 2009. The chemical biology of aptamers. Angew Chem Int Ed Engl 48, 2672-

2689.

152

McGuckin, M.A., Walsh, M.D., Hohn, B.G., Ward, B.G., Wright, R.G., 1995. Prognostic

significance of MUC1 epithelial mucin expression in breast cancer. Hum Pathol 26, 432-

439.

McNamara, J.O., 2nd, Andrechek, E.R., Wang, Y., Viles, K.D., Rempel, R.E., Gilboa, E.,

Sullenger, B.A., Giangrande, P.H., 2006. Cell type-specific delivery of siRNAs with

aptamer-siRNA chimeras. Nat Biotechnol 24, 1005-1015.

McNamara, J.O., Kolonias, D., Pastor, F., Mittler, R.S., Chen, L., Giangrande, P.H.,

Sullenger, B., Gilboa, E., 2008. Multivalent 4-1BB binding aptamers costimulate CD8+

T cells and inhibit tumor growth in mice. J Clin Invest 118, 376-386.

Mierau, M., Schoels, M., Gonda, G., Fuchs, J., Aletaha, D., Smolen, J.S., 2007. Assessing

remission in clinical practice. Rheumatology (Oxford) 46, 975-979.

Miyata, T., Asami, N., Uragami, T., 1999. A reversibly antigen-responsive hydrogel.

Nature 399, 766-769.

Mohler, K.M., Torrance, D.S., Smith, C.A., Goodwin, R.G., Stremler, K.E., Fung, V.P.,

Madani, H., Widmer, M.B., 1993. Soluble tumor necrosis factor (TNF) receptors are

effective therapeutic agents in lethal endotoxemia and function simultaneously as both

TNF carriers and TNF antagonists. J Immunol 151, 1548-1561.

Moreira, J.N., Ishida, T., Gaspar, R., Allen, T.M., 2002. Use of the post-insertion

technique to insert peptide ligands into pre-formed stealth liposomes with retention of

binding activity and cytotoxicity. Pharm Res 19, 265-269.

Morris, K.N., Jensen, K.B., Julin, C.M., Weil, M., Gold, L., 1998. High affinity ligands

from in vitro selection: complex targets. Proc Natl Acad Sci U S A 95, 2902-2907.

Mount, C., Featherstone, J., 2005. Rheumatoid arthritis market. Nat Rev Drug Discov 4,

11-12.

Muller, J., Isermann, B., Ducker, C., Salehi, M., Meyer, M., Friedrich, M., Madhusudhan,

T., Oldenburg, J., Mayer, G., Potzsch, B., 2009. An exosite-specific ssDNA aptamer

inhibits the anticoagulant functions of activated protein C and enhances inhibition by

protein C inhibitor. Chem Biol 16, 442-451.

Mussi, A., Bonifati, C., Carducci, M., D'Agosto, G., Pimpinelli, F., D'Urso, D., D'Auria,

L., Fazio, M., Ameglio, F., 1997. Serum TNF-alpha levels correlate with disease severity

and are reduced by effective therapy in plaque-type psoriasis. J Biol Regul Homeost

Agents 11, 115-118.

Neidle, S., Parkinson, G.N., 2003. The structure of telomeric DNA. Curr Opin Struct Biol

13, 275-283.

Ng, E.W., Shima, D.T., Calias, P., Cunningham, E.T., Jr., Guyer, D.R., Adamis, A.P.,

2006. Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease. Nat Rev

Drug Discov 5, 123-132.

Nicholson, T.B., Stanners, C.P., 2006. Specific inhibition of GPI-anchored protein

function by homing and self-association of specific GPI anchors. J Cell Biol 175, 647-

659.

Ohuchi, S.P., Ohtsu, T., Nakamura, Y., 2005. A novel method to generate aptamers

against recombinant targets displayed on the cell surface. Nucleic Acids Symp Ser (Oxf),

351-352.

Oikawa, S., Inuzuka, C., Kuroki, M., Matsuoka, Y., Kosaki, G., Nakazato, H., 1989. Cell

adhesion activity of non-specific cross-reacting antigen (NCA) and carcinoembryonic

antigen (CEA) expressed on CHO cell surface: homophilic and heterophilic adhesion.

Biochem Biophys Res Commun 164, 39-45.

Orava, E.W., Cicmil, N., Gariepy, J., 2010. Delivering cargoes into cancer cells using

153

DNA aptamers targeting internalized surface portals. Biochim Biophys Acta 1798, 2190-

2200.

Orava, E.W., Jarvik, N., Shek, Y.L., Sidhu, S.S., Gariepy, J., 2012. A short DNA aptamer

that recognizes TNF-alpha and blocks its activity in vitro. ACS Chem Biol.

Ordonez, C., Screaton, R.A., Ilantzis, C., Stanners, C.P., 2000. Human carcinoembryonic

antigen functions as a general inhibitor of anoikis. Cancer Res 60, 3419-3424.

Paborsky, L.R., McCurdy, S.N., Griffin, L.C., Toole, J.J., Leung, L.L., 1993. The single-

stranded DNA aptamer-binding site of human thrombin. J Biol Chem 268, 20808-20811.

Padilla, R., Sousa, R., 1999. Efficient synthesis of nucleic acids heavily modified with

non-canonical ribose 2'-groups using a mutantT7 RNA polymerase (RNAP). Nucleic

Acids Res 27, 1561-1563.

Padmanabhan, K., Padmanabhan, K.P., Ferrara, J.D., Sadler, J.E., Tulinsky, A., 1993. The

structure of alpha-thrombin inhibited by a 15-mer single-stranded DNA aptamer. J Biol

Chem 268, 17651-17654.

Paludan, S.R., 2000. Synergistic action of pro-inflammatory agents: cellular and

molecular aspects. J Leukoc Biol 67, 18-25.

Peng, C., Hu, W., Zhou, Y., Fan, C., Huang, Q., 2010. Intracellular imaging with a

graphene-based fluorescent probe. Small 6, 1686-1692.

Peng, C.G., Damha, M.J., 2007. G-quadruplex induced stabilization by 2'-deoxy-2'-

fluoro-D-arabinonucleic acids (2'F-ANA). Nucleic Acids Res 35, 4977-4988.

Phan, A.T., Kuryavyi, V., Ma, J.B., Faure, A., Andreola, M.L., Patel, D.J., 2005. An

interlocked dimeric parallel-stranded DNA quadruplex: a potent inhibitor of HIV-1

integrase. Proc Natl Acad Sci U S A 102, 634-639.

Pidgeon, C., Hunt, C.A., 1981. Calculating number and surface area of liposomes in any

suspension. J Pharm Sci 70, 173-176.

Putti, M.C., Rondelli, R., Cocito, M.G., Arico, M., Sainati, L., Conter, V., Guglielmi, C.,

Cantu-Rajnoldi, A., Consolini, R., Pession, A., Zanesco, L., Masera, G., Biondi, A.,

Basso, G., 1998. Expression of myeloid markers lacks prognostic impact in children

treated for acute lymphoblastic leukemia: Italian experience in AIEOP-ALL 88-91

studies. Blood 92, 795-801.

Qhobosheane, M., Santra, S., Zhang, P., Tan, W., 2001. Biochemically functionalized

silica nanoparticles. Analyst 126, 1274-1278.

Rajendran, M., Ellington, A.D., 2008. Selection of fluorescent aptamer beacons that light

up in the presence of zinc. Anal Bioanal Chem 390, 1067-1075.

Randazzo, A., Spada, G.P., Silva, M.W., 2012. Circular Dichroism of Quadruplex

Structures. Top Curr Chem.

Robak, E., Sysa-Jedrzejewska, A., Dziankowska, B., Torzecka, D., Chojnowski, K.,

Robak, T., 1998. Association of interferon gamma, tumor necrosis factor alpha and

interleukin 6 serum levels with systemic lupus erythematosus activity. Arch Immunol

Ther Exp (Warsz) 46, 375-380.

Robbins, P.F., Kantor, J.A., Salgaller, M., Hand, P.H., Fernsten, P.D., Schlom, J., 1991.

Transduction and expression of the human carcinoembryonic antigen gene in a murine

colon carcinoma cell line. Cancer Res 51, 3657-3662.

Ross, J.S., Sheehan, C.E., Fisher, H.A., Kaufman, R.P., Jr., Kaur, P., Gray, K., Webb, I.,

Gray, G.S., Mosher, R., Kallakury, B.V., 2003. Correlation of primary tumor prostate-

specific membrane antigen expression with disease recurrence in prostate cancer. Clin

Cancer Res 9, 6357-6362.

Roukos, D.H., 2012. Disrupting cancer cells' biocircuits with interactome-based drugs: is

154

'clinical' innovation realistic? Expert Rev Proteomics 9, 349-353.

Rudnick, S.I., Lou, J., Shaller, C.C., Tang, Y., Klein-Szanto, A.J., Weiner, L.M., Marks,

J.D., Adams, G.P., 2011. Influence of affinity and antigen internalization on the uptake

and penetration of Anti-HER2 antibodies in solid tumors. Cancer Res 71, 2250-2259.

Russo Krauss, I., Merlino, A., Giancola, C., Randazzo, A., Mazzarella, L., Sica, F., 2011.

Thrombin-aptamer recognition: a revealed ambiguity. Nucleic Acids Res 39, 7858-7867.

Ryu, J.H., Koo, H., Sun, I.C., Yuk, S.H., Choi, K., Kim, K., Kwon, I.C., 2012. Tumor-

targeting multi-functional nanoparticles for theragnosis: new paradigm for cancer

therapy. Adv Drug Deliv Rev 64, 1447-1458.

Samara, R.N., Laguinge, L.M., Jessup, J.M., 2007. Carcinoembryonic antigen inhibits

anoikis in colorectal carcinoma cells by interfering with TRAIL-R2 (DR5) signaling.

Cancer Res 67, 4774-4782.

Santulli-Marotto, S., Nair, S.K., Rusconi, C., Sullenger, B., Gilboa, E., 2003. Multivalent

RNA aptamers that inhibit CTLA-4 and enhance tumor immunity. Cancer Res 63, 7483-

7489.

Sathuluri, R.R., Yoshikawa, H., Shimizu, E., Saito, M., Tamiya, E., 2011. Gold

nanoparticle-based surface-enhanced Raman scattering for noninvasive molecular

probing of embryonic stem cell differentiation. PLoS One 6, e22802.

Savla, R., Taratula, O., Garbuzenko, O., Minko, T., 2011. Tumor targeted quantum dot-

mucin 1 aptamer-doxorubicin conjugate for imaging and treatment of cancer. J Control

Release 153, 16-22.

Scheinberg, D.A., Tanimoto, M., McKenzie, S., Strife, A., Old, L.J., Clarkson, B.D.,

1989. Monoclonal antibody M195: a diagnostic marker for acute myelogenous leukemia.

Leukemia 3, 440-445.

Schmidmaier, R., Baumann, P., 2008. ANTI-ADHESION evolves to a promising

therapeutic concept in oncology. Curr Med Chem 15, 978-990.

Schmidt, M.M., Thurber, G.M., Wittrup, K.D., 2008. Kinetics of anti-carcinoembryonic

antigen antibody internalization: effects of affinity, bivalency, and stability. Cancer

Immunol Immunother 57, 1879-1890.

Schneider, D.J., Feigon, J., Hostomsky, Z., Gold, L., 1995. High-affinity ssDNA

inhibitors of the reverse transcriptase of type 1 human immunodeficiency virus.

Biochemistry 34, 9599-9610.

Schoetzau, T., Langner, J., Moyroud, E., Roehl, I., Vonhoff, S., Klussmann, S., 2003.

Aminomodified nucleobases: functionalized nucleoside triphosphates applicable for

SELEX. Bioconjug Chem 14, 919-926.

Screaton, R.A., DeMarte, L., Draber, P., Stanners, C.P., 2000. The specificity for the

differentiation blocking activity of carcinoembryonic antigen resides in its

glycophosphatidyl-inositol anchor. J Cell Biol 150, 613-626.

Screaton, R.A., Penn, L.Z., Stanners, C.P., 1997. Carcinoembryonic antigen, a human

tumor marker, cooperates with Myc and Bcl-2 in cellular transformation. J Cell Biol 137,

939-952.

Sen, R., Baltimore, D., 1986. Inducibility of kappa immunoglobulin enhancer-binding

protein Nf-kappa B by a posttranslational mechanism. Cell 47, 921-928.

Sheehan, J.P., Sadler, J.E., 1994. Molecular mapping of the heparin-binding exosite of

thrombin. Proc Natl Acad Sci U S A 91, 5518-5522.

Shih, L.B., Goldenberg, D.M., Xuan, H., Lu, H.W., Mattes, M.J., Hall, T.C., 1994.

Internalization of an intact doxorubicin immunoconjugate. Cancer Immunol Immunother

38, 92-98.

155

Siddiqui-Jain, A., Grand, C.L., Bearss, D.J., Hurley, L.H., 2002. Direct evidence for a G-

quadruplex in a promoter region and its targeting with a small molecule to repress c-

MYC transcription. Proc Natl Acad Sci U S A 99, 11593-11598.

Silverman, S.K., 2009. Deoxyribozymes: selection design and serendipity in the

development of DNA catalysts. Acc Chem Res 42, 1521-1531.

Skehan, P., Storeng, R., Scudiero, D., Monks, A., McMahon, J., Vistica, D., Warren, J.T.,

Bokesch, H., Kenney, S., Boyd, M.R., 1990. New colorimetric cytotoxicity assay for

anticancer-drug screening. J Natl Cancer Inst 82, 1107-1112.

Smolen, J.S., Aletaha, D., Koeller, M., Weisman, M.H., Emery, P., 2007. New therapies

for treatment of rheumatoid arthritis. Lancet 370, 1861-1874.

Soeth, E., Wirth, T., List, H.J., Kumbhani, S., Petersen, A., Neumaier, M., Czubayko, F.,

Juhl, H., 2001. Controlled ribozyme targeting demonstrates an antiapoptotic effect of

carcinoembryonic antigen in HT29 colon cancer cells. Clin Cancer Res 7, 2022-2030.

Soontornworajit, B., Wang, Y., 2011. Nucleic acid aptamers for clinical diagnosis: cell

detection and molecular imaging. Anal Bioanal Chem 399, 1591-1599.

Spicer, A.P., Rowse, G.J., Lidner, T.K., Gendler, S.J., 1995. Delayed mammary tumor

progression in Muc-1 null mice. J Biol Chem 270, 30093-30101.

Sporn, M.B., 1996. The war on cancer. Lancet 347, 1377-1381.

Stein, R., Juweid, M., Mattes, M.J., Goldenberg, D.M., 1999. Carcinoembryonic antigen

as a target for radioimmunotherapy of human medullary thyroid carcinoma: antibody

processing, targeting, and experimental therapy with 131I and 90Y labeled MAbs.

Cancer Biother Radiopharm 14, 37-47.

Stribling, W.K., Slaughter, T.F., Houle, T.T., Sane, D.C., 2007. Beyond the platelet count:

heparin antibodies as independent risk predictors. Am Heart J 153, 900-906.

Su, S.L., Huang, I.P., Fair, W.R., Powell, C.T., Heston, W.D., 1995. Alternatively spliced

variants of prostate-specific membrane antigen RNA: ratio of expression as a potential

measurement of progression. Cancer Res 55, 1441-1443.

Taheri, M., Saragovi, U., Fuks, A., Makkerh, J., Mort, J., Stanners, C.P., 2000. Self

recognition in the Ig superfamily. Identification of precise subdomains in

carcinoembryonic antigen required for intercellular adhesion. J Biol Chem 275, 26935-

26943.

Taruttis, A., Ntziachristos, V., 2012. Translational optical imaging. AJR Am J Roentgenol

199, 263-271.

Taylor-Papadimitriou, J., Burchell, J., Miles, D.W., Dalziel, M., 1999. MUC1 and cancer.

Biochim Biophys Acta 1455, 301-313.

Teng, Y., Girvan, A.C., Casson, L.K., Pierce, W.M., Jr., Qian, M., Thomas, S.D., Bates,

P.J., 2007. AS1411 alters the localization of a complex containing protein arginine

methyltransferase 5 and nucleolin. Cancer Res 67, 10491-10500.

Terstappen, L.W., Safford, M., Konemann, S., Loken, M.R., Zurlutter, K., Buchner, T.,

Hiddemann, W., Wormann, B., 1992. Flow cytometric characterization of acute myeloid

leukemia. Part II. Phenotypic heterogeneity at diagnosis. Leukemia 6, 70-80.

Thompson, J.A., Grunert, F., Zimmermann, W., 1991. Carcinoembryonic antigen gene

family: molecular biology and clinical perspectives. J Clin Lab Anal 5, 344-366.

Tong, G.J., Hsiao, S.C., Carrico, Z.M., Francis, M.B., 2009. Viral capsid DNA aptamer

conjugates as multivalent cell-targeting vehicles. J Am Chem Soc 131, 11174-11178.

Toulme, J.J., Di Primo, C., Boucard, D., 2004. Regulating eukaryotic gene expression

with aptamers. FEBS Lett 567, 55-62.

Townshend, B., Aubry, I., Marcellus, R.C., Gehring, K., Tremblay, M.L., 2010. An RNA

156

aptamer that selectively inhibits the enzymatic activity of protein tyrosine phosphatase

1B in vitro. Chembiochem 11, 1583-1593.

Tsimberidou, A.M., Giles, F.J., Estey, E., O'Brien, S., Keating, M.J., Kantarjian, H.M.,

2006. The role of gemtuzumab ozogamicin in acute leukaemia therapy. Br J Haematol

132, 398-409.

Tuerk, C., Gold, L., 1990. Systematic evolution of ligands by exponential enrichment:

RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505-510.

van den Berg, W.B., 2001. Anti-cytokine therapy in chronic destructive arthritis. Arthritis

Res 3, 18-26.

van der Velden, V.H., Boeckx, N., Jedema, I., te Marvelde, J.G., Hoogeveen, P.G.,

Boogaerts, M., van Dongen, J.J., 2004. High CD33-antigen loads in peripheral blood

limit the efficacy of gemtuzumab ozogamicin (Mylotarg) treatment in acute myeloid

leukemia patients. Leukemia 18, 983-988.

van Vollenhoven, R.F., 2007. Switching between anti-tumour necrosis factors: trying to

get a handle on a complex issue. Ann Rheum Dis 66, 849-851.

Veiseh, O., Gunn, J.W., Zhang, M., 2010. Design and fabrication of magnetic

nanoparticles for targeted drug delivery and imaging. Adv Drug Deliv Rev 62, 284-304.

Vester, B., Wengel, J., 2004. LNA (locked nucleic acid): high-affinity targeting of

complementary RNA and DNA. Biochemistry 43, 13233-13241.

Wagner, A., Platzgummer, M., Kreismayr, G., Quendler, H., Stiegler, G., Ferko, B.,

Vecera, G., Vorauer-Uhl, K., Katinger, H., 2006. GMP production of liposomes--a new

industrial approach. J Liposome Res 16, 311-319.

Wakeman, C.A., Winkler, W.C., Dann, C.E., 3rd, 2007. Structural features of metabolite-

sensing riboswitches. Trends Biochem Sci 32, 415-424.

Wallis, R.S., Ehlers, S., 2005. Tumor necrosis factor and granuloma biology: explaining

the differential infection risk of etanercept and infliximab. Semin Arthritis Rheum 34, 34-

38.

Walter, R.B., Raden, B.W., Kamikura, D.M., Cooper, J.A., Bernstein, I.D., 2005.

Influence of CD33 expression levels and ITIM-dependent internalization on gemtuzumab

ozogamicin-induced cytotoxicity. Blood 105, 1295-1302.

Wang, K.Y., Krawczyk, S.H., Bischofberger, N., Swaminathan, S., Bolton, P.H., 1993.

The tertiary structure of a DNA aptamer which binds to and inhibits thrombin determines

activity. Biochemistry 32, 11285-11292.

White, R.R., Sullenger, B.A., Rusconi, C.P., 2000. Developing aptamers into

therapeutics. J Clin Invest 106, 929-934.

Williamson, J.R., 1994. G-quartet structures in telomeric DNA. Annu Rev Biophys

Biomol Struct 23, 703-730.

Willis, M.C., Collins, B.D., Zhang, T., Green, L.S., Sebesta, D.P., Bell, C., Kellogg, E.,

Gill, S.C., Magallanez, A., Knauer, S., Bendele, R.A., Gill, P.S., Janjic, N., 1998.

Liposome-anchored vascular endothelial growth factor aptamers. Bioconjug Chem 9,

573-582.

Willner, D., Trail, P.A., Hofstead, S.J., King, H.D., Lasch, S.J., Braslawsky, G.R.,

Greenfield, R.S., Kaneko, T., Firestone, R.A., 1993. (6-Maleimidocaproyl)hydrazone of

doxorubicin--a new derivative for the preparation of immunoconjugates of doxorubicin.

Bioconjug Chem 4, 521-527.

Wittenberg, N.J., Haynes, C.L., 2009. Using nanoparticles to push the limits of detection.

Wiley Interdiscip Rev Nanomed Nanobiotechnol 1, 237-254.

Woo, J., Chiu, G.N., Karlsson, G., Wasan, E., Ickenstein, L., Edwards, K., Bally, M.B.,

157

2008. Use of a passive equilibration methodology to encapsulate cisplatin into preformed

thermosensitive liposomes. Int J Pharm 349, 38-46.

Xing, H., Wong, N.Y., Xiang, Y., Lu, Y., 2012. DNA aptamer functionalized

nanomaterials for intracellular analysis, cancer cell imaging and drug delivery. Curr Opin

Chem Biol 16, 429-435.

Xu, X., Hamhouyia, F., Thomas, S.D., Burke, T.J., Girvan, A.C., McGregor, W.G., Trent,

J.O., Miller, D.M., Bates, P.J., 2001. Inhibition of DNA replication and induction of S

phase cell cycle arrest by G-rich oligonucleotides. J Biol Chem 276, 43221-43230.

Yang, L., Zhang, X., Ye, M., Jiang, J., Yang, R., Fu, T., Chen, Y., Wang, K., Liu, C., Tan,

W., 2011. Aptamer-conjugated nanomaterials and their applications. Adv Drug Deliv Rev

63, 1361-1370.

Yu, C., Hu, Y., Duan, J., Yuan, W., Wang, C., Xu, H., Yang, X.D., 2011. Novel aptamer-

nanoparticle bioconjugates enhances delivery of anticancer drug to MUC1-positive

cancer cells in vitro. PLoS One 6, e24077.

Yu, D., Wang, D., Zhu, F.G., Bhagat, L., Dai, M., Kandimalla, E.R., Agrawal, S., 2009.

Modifications incorporated in CpG motifs of oligodeoxynucleotides lead to antagonist

activity of toll-like receptors 7 and 9. J Med Chem 52, 5108-5114.

Zhang, L., Radovic-Moreno, A.F., Alexis, F., Gu, F.X., Basto, P.A., Bagalkot, V., Jon, S.,

Langer, R.S., Farokhzad, O.C., 2007. Co-delivery of hydrophobic and hydrophilic drugs

from nanoparticle-aptamer bioconjugates. ChemMedChem 2, 1268-1271.

Zhang, Y., Chen, Y., Han, D., Ocsoy, I., Tan, W., 2010. Aptamers selected by cell-SELEX

for application in cancer studies. Bioanalysis 2, 907-918.

Zheng, C., Feng, J., Lu, D., Wang, P., Xing, S., Coll, J.L., Yang, D., Yan, X., 2011. A

novel anti-CEACAM5 monoclonal antibody, CC4, suppresses colorectal tumor growth

and enhances NK cells-mediated tumor immunity. PLoS One 6, e21146.

Zheng, J., Perkins, G., Kirilova, A., Allen, C., Jaffray, D.A., 2006. Multimodal contrast

agent for combined computed tomography and magnetic resonance imaging applications.

Invest Radiol 41, 339-348.

Zhou, H., Fuks, A., Alcaraz, G., Bolling, T.J., Stanners, C.P., 1993. Homophilic adhesion

between Ig superfamily carcinoembryonic antigen molecules involves double reciprocal

bonds. J Cell Biol 122, 951-960.

Zhou, J., Swiderski, P., Li, H., Zhang, J., Neff, C.P., Akkina, R., Rossi, J.J., 2009.

Selection, characterization and application of new RNA HIV gp 120 aptamers for facile

delivery of Dicer substrate siRNAs into HIV infected cells. Nucleic Acids Res 37, 3094-

3109.

Zhu, M.Z., Marshall, J., Cole, D., Schlom, J., Tsang, K.Y., 2000. Specific cytolytic T-cell

responses to human CEA from patients immunized with recombinant avipox-CEA

vaccine. Clin Cancer Res 6, 24-33.

Zimmer, R., Thomas, P., 2001. Mutations in the carcinoembryonic antigen gene in

colorectal cancer patients: implications on liver metastasis. Cancer Res 61, 2822-2826.