1

G Lu et al. Nature 000, 1-5 (2013) doi:10.1038/nature12328 Identification of the MERS-CoV RBD.

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

Download PPT Report

Upload
onofre
View
47
Download
0

Tags:

merscov rbd

Embed Size (px)

DESCRIPTION

Identification of the MERS-CoV RBD. G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328. - PowerPoint PPT Presentation

Citation preview

Page 1: G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

G Lu et al. Nature 000, 1-5 (2013) doi:10.1038/nature12328

Identification of the MERS-CoV RBD.

B Nystedt et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 12211

B Nystedt et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 12211

Documents

$Nature Biotechnology: doi:10.1038/nbt...sensitivity to detect MS indels decreases markedly at low allele fractions. Nature Biotechnology: doi:10.1038/nbt.3966 log 10 (KS t est ) log$

Nature Biotechnology: doi:10.1038/nbt...sensitivity to detect MS indels decreases markedly at low allele fractions. Nature Biotechnology: doi:10.1038/nbt.3966 log 10 (KS t est ) log

Documents

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

Documents

Nature Neuroscience: doi:10.1038/nn · Nature Neuroscience: doi:10.1038/nn.4463. Supplementary Figure 2 AT1a-positive neurons in area postrema and PVN were not activated under the

Nature Neuroscience: doi:10.1038/nn · Nature Neuroscience: doi:10.1038/nn.4463. Supplementary Figure 2 AT1a-positive neurons in area postrema and PVN were not activated under the

Documents

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

Documents

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Documents

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Documents

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

Documents

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

Documents

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Documents

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Documents

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Documents

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

Documents

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt

Documents

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

Documents

DWJ Thompson et al. Nature 491 , 692-697 (2012) doi:10.1038/nature 11579

DWJ Thompson et al. Nature 491 , 692-697 (2012) doi:10.1038/nature 11579

Documents

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

Documents

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

Documents

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Documents

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Documents

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

Documents

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

Documents

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Documents

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Documents

Nature Biotechnology: doi:10.1038/nbtruminant host shown on individual circles around the tree. Nature Biotechnology: doi:10.1038/nbt.4110 Author Andrew Gordon Created Date 3/12/2018

Nature Biotechnology: doi:10.1038/nbtruminant host shown on individual circles around the tree. Nature Biotechnology: doi:10.1038/nbt.4110 Author Andrew Gordon Created Date 3/12/2018

Documents

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Documents

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Documents

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

Documents