Gene detection of staphylococcal enterotoxins in production strain of staphylococcin injection and superantigenic activity of rSEK and rSEQ

ORIGINAL PAPER

Gene detection of staphylococcal enterotoxins in production strainof staphylococcin injection and superantigenic activity of rSEKand rSEQ

Ding Ding • Peng Huang • Ying-Qiu Pan •

Shu-Qing Chen

Received: 20 January 2011 / Accepted: 7 May 2011 / Published online: 19 May 2011

� Springer Science+Business Media B.V. 2011

Abstract In China, staphylococcin injection has been

commonly used in the combined treatment of cancer to

enhance the systemic immune response and reduce the

toxicities associated with chemotherapy and radiation

therapy. It is claimed that the main active component in the

injection is staphylococcal enterotoxin C2 (SEC2). To

determine whether other serological types of staphylococ-

cal enterotoxins (SEs) could also be present in the injection

products, in this study, the distribution of se genes (from

sea to see, from seg to seu) in the one and only production

strain of Staphylococcus aureus from one manufacturing

company was analyzed by PCR method. In addition, sek

and seq genes were cloned from the strain and the corre-

sponding recombinant proteins, rSEK and rSEQ, were

expressed in Escherichia coli and purified by affinity

chromatography and anion-exchange chromatography. The

superantigenic properties of the two recombinant proteins

were then measured by MTT method. The PCR results

showed that seven se genes are harbored by the production

strain. However, sec2 gene was not detected. The results of

MTT assay showed that rSEK and rSEQ could elicit strong

stimulatory effects on proliferation and cytotoxicity of

murine splenocytes in vitro. Overall, the results in this

study indicated that one or a plurality of the seven SEs may

be present in the related products, and that the two

recombinant SEs are promising candidates as immuno-

modulatory agents for cancer therapy.

Keywords Staphylococcin injection �Staphylococcal entertoxin � SEK � SEQ � Superantigen

Abbreviations

GST Glutathione S-transferase

PCR Polymerase chain reaction

rSEK Recombinant staphylococcal enterotoxin K

rSEQ Recombinant staphylococcal enterotoxin Q

spa Staphylococcal protein A

Introduction

Staphylococcal enterotoxins (SEs) produced by Staphylo-

coccus aureus belong to the large family of staphylococcal

and streptococcal pyrogenic toxin superantigens (PTSAgs)

(Dinges et al. 2000). More than twenty serological types

of SEs have been identified to date, including classical SEs

and several newly-described types (Kuroda et al. 2001;

Letertre et al. 2003; Omoe et al. 2003, 2005b). Unlike

conventional T-cell antigens, SEs bind as unprocessed

proteins to major histocompatibility complex (MHC) class

II molecules on antigen presenting cells (APCs) and T-cell

receptors (TCR) on T cells (Sundberg et al. 2002; Petersson

et al. 2004). As a consequence, SEs at concentrations of pg-

ng/mL can elicit massive proliferation of host T-cells and

release of cytokines both in vivo and in vitro (Muller-Alouf

et al. 2001; Proft and Fraser 2003), which suggest their

potential as immunomodularoty reagents for cancer ther-

apy (Dohlsten et al. 1991; Brodin et al. 1998). Several

preclinical studies and clinical trials have shown that the

tumor-targeted superantigens are promising candidates for

cancer immunotherapy (Hansson et al. 1997; Forsberg

et al. 2001; Shaw et al. 2007).

D. Ding � P. Huang � Y.-Q. Pan � S.-Q. Chen (&)

Institute of Pharmacology and Toxicology and Biochemical

Pharmaceutics, College of Pharmaceutical Sciences,

Zi-Jin-Gang Campus, Zhejiang University,

388# Yu-Hang-Tang Road, Hangzhou 310058, Zhejiang

Province, People’s Republic of China

e-mail: [email protected]

123

World J Microbiol Biotechnol (2011) 27:2957–2967

DOI 10.1007/s11274-011-0779-2

In China, staphylococcin injection prepared from fer-

mentation broth of Staphylococcus aureus has been com-

monly used as a biological response modifier in combined

therapy for cancer in the last decade. The immunomodula-

tory properties of staphylococcin injection were confirmed

in most clinical reports. The injection is able to induce sig-

nificant increases in CD4? cells, CD4?/CD8? T cell ratio,

and percentage of NK cells in the treated patients (Tian et al.

2001; Wu et al. 2005; Song et al. 2008; Yan et al. 2008). In

addition, the toxicities associated with the chemotherapy

and radiation therapy were markedly reduced in the injec-

tion-treated patients (He and Wu 1998; Chen et al. 1999;

Tian et al. 2001; Song et al. 2008; Yan et al. 2008). Both

short-term efficacy and long-term survival benefits from the

injection were observed in many clinical studies (He and Wu

1998; Chen et al. 1999; Wu et al. 2005; Yan et al. 2008). The

most frequent side effect encountered in patients treated

with staphylococcin injection is mild to moderate fever,

which seems to reflect the systemic immune response (He

and Wu 1998; Chen et al. 1999; Song et al. 2008; Yan et al.

2008). Generally, staphylococcin injection is well tolerated

and the toxicity is transient and easily managed.

Observations from clinical reports demonstrated that the

anti-tumor effect of the injection is relevant to its strong

immunomodulatory capacity, indicating that staphylococ-

cal superantigen may play an important role in the thera-

peutic effect of the injection. It is claimed that the main

effective component in staphylococcin injection is staphy-

lococcal enterotoxin C2 (SEC2). Nevertheless, results in

our previous study indicated that SEC2 only accounts for

less than 0.1% of the total protein in the injection products

from three different manufacturing companies (Ding et al.

2009). As many S. aureus strains carry multiple se genes

and produce one or more types of SEs (Sharma et al. 2000;

Omoe et al. 2002; Morandi et al. 2007), whether SEC2 is the

only superantigen in the products remains to be determined.

In this study, the distribution of se genes (from sea to see

and from seg to seu) in the one and only production strain

from one manufacturing company was analyzed by normal

PCR method to determine whether other possible SEs could

also be present in the injection. In addition, sek and seq

genes were cloned from the production strain, and the

superantigenic activities of the corresponding recombinant

proteins, rSEK and rSEQ, were evaluated and compared

with that of the injection solution by MTT method.

Materials and methods

Animals and cell lines

Male ICR mice weighing 20 ± 2 g were purchased from

the animal research center in Academy of Medical Science

at Zhejiang province, China. The animals were housed in

an air-conditioned room, with temperature 23 ± 2�C, rel-

ative humidity 50–60%, controlled illumination of a 12 h

light–dark cycle. All procedures described in this study

were reviewed and approved by the ethics committee for

the use of experimental animals at Zhejiang University,

China. Anti-adriamycin (ADM) human chronic myeloge-

nous leukemia cell line (K562-ADM) and murine mela-

noma cell line (B16) were cultured in RPMI 1640 medium

(Invitrogen, Grand Island, NY, USA) supplemented with

10% fetal bovine serum (FBS, Invitrogen, Grand Island,

NY, USA) at 37�C in a humidified CO2 incubator (Model

3111, Thermo Forma, Marietta, Ohio, USA).

Bacterial strains and reagents

Six reference strains of S. aureus (Table 1) used to evaluate

the specificity of the PCR primer pairs were preserved in

our lab. The production strain of the injection and the

injection products (Lot No. 20080705) were provided by

one manufacturing company. Concanavalin A (Con A),

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bro-

mide (MTT) and thrombin were purchased from Sigma–

Aldrich, Co. (St. Louis, MO, USA). Native SEC2 (nSEC2)

and recombinant GST (rGST) were purified and preserved

in our lab.

Detection of se genes in the production strain

The isolation of genomic DNA from the production strain

and the reference strains was performed as described pre-

viously (Pan et al. 2007a). The primers for the detection of

se genes (from sea to see and from seg to seu) were given

in Table 2. Each amplification reaction was performed to

detect one kind of se genes. The primers designed to detect

femA and femB genes were used as internal positive con-

trols in PCR reactions. Each reaction mixture contained 1

lL of isolated template DNA, 1 lL of each primer for one

type of se genes, 1 lL of each primer for either femA or

Table 1 Reference strains of S. aureus used in this study

Strain SE genotype Reference

FRI 326 see, seq Omoe et al. (2005a)

FRI 569 seh Omoe et al. (2005a)

S6 sea, seb, sek, seq Omoe et al. (2005a)

FRI 137 seu Holtfreter et al. (2007)

FRI 361 sec, sed, seg, sei, sej, sel,sem, sen, seo, ser

Hwang et al. (2007)

N315 sec, seg, sei, sel, sem, sen,

seo, sepHwang et al. (2007)

2958 World J Microbiol Biotechnol (2011) 27:2957–2967

123

Table 2 Primers for detection of se genes and cloning of sek and seq

Gene Primer Oligonucleotide sequence (5’ ? 3’) Size (bp) of PCR product Reference

Primer for detection of se gene

sea sea-fw CCTTTGGAAACGGTTAAAACG 127 Becker et al. (1998)

sea-rv TCTGAACCTTCCCATCAAAAAC

seb seb-fw TCGCATCAAACTGACAAACG 477 Becker et al. (1998)

seb-rv GCAGGTACTCTATAAGTGCCTGC

seca sec-fw CTCAAGAACTAGACATAAAAGCTAGG 271 Becker et al. (1998)

sec-rv TCAAAATCGGATTAACATTATCC

sed sed-fw CTAGTTTGGTAATATCTCCTTTAAACG 319 Becker et al. (1998)

sed-rv TTAATGCTATATCTTATAGGGTAAACATC

see see-fw CAGTACCTATAGATAAAGTTAAAACAAGC 178 Becker et al. (1998)

see-rv TAACTTACCGTGGACCCTTC

seg seg-fw AAGTAGACATTTTTGGCGTTCC 287 Omoe et al. (2002)

seg-rv AGAACCATCAAACTCGTATAGC

seh seh-fw GTCTATATGGAGGTACAACACT 213 Omoe et al. (2002)

seh-rv GACCTTTACTTATTTCGCTGTC

sei sei-fw GGCCACTTTATCAGGACA 328 Bania et al. (2006)

sei-rv AACTTACAGGCAGTCCA

sej sej-fw ATAGCATCAGAACTGTTGTTCCG 152 Omoe et al. (2005a)

sej-rv CTTTCTGAATTTTACCACCAAAGG

sek sek-fw TAGGTGTCTCTAATAATGCCA 293 Omoe et al. (2005a)

sek-rv TAGATATTCGTTAGTAGCTG

sel sel-fw TAACGGCGATGTAGGTCCAGG 383 Omoe et al. (2005a)

sel-rv CATCTATTTCTTGTGCGGTAAC

sem sem-fw GGATAATTCGACAGTAACAG 379 Omoe et al. (2005a)

sem-rv TCCTGCATTAAATCCAGAAC

sen sen-fw TATGTTAATGCTGAAGTAGAC 282 Omoe et al. (2005a)

sen-rv ATTTCCAAAATACAGTCCATA

seo seo-fw TGTGTAAGAAGTCAAGTGTAG 214 Omoe et al. (2005a)

seo-rv TCTTTAGAAATCGCTGATGA

sep sep-fw TGATTTATTAGTAGACCTTGG 396 Omoe et al. (2005a)

sep-rv ATAACCAACCGAATCACCAG

seq seq-fw AATCTCTGGGTCAATGGTAAGC 122 Omoe et al. (2005a)

seq-rv TTGTATTCGTTTTGTAGGTATTTTCG

ser ser-fw GGATAAAGCGGTAATAGCAG 166 Omoe et al. (2005a)

ser-rv GTATTCCAAACACATCTAAC

seu seu-fw AATGGCTCTAAAATTGATGG 215 Holtfreter et al. (2007)

seu-rv ATTTGATTTCCATCATGCTC

femAb femA-fw AAAAAAGCACATAACAAGCG 134 Omoe et al. (2005a)

femA-rv GATAAAGAAGAAACCAGCAG

femBb femB-fw TTACAGAGTTAACTGTTACC 651 Omoe et al. (2005a)

femB-rv ATACAAATCCAGCACGCTCT

Primer for cloning of sek and seq

sekc sek-fw ACGGATCCCAAGGTGATATAGGAA 684 This study

sek-rv CACTCGAGTAATAGGTTTATTTTGTT

seqc seq-fw ATGGATCCGATGTAGGGGTAATC 667 This study

seq-rv GCCTCGAGTTATTCAGTTTTCTCAT

a The primer pair for the detection of sec gene covers all three subtypes of SECb The primers used to detect femA gene were included in the reactions for the detection of seb, sel and sep genes, and the primers used to detect femB gene

were included in the reactions for the detection of the other se genesc The restriction sites of BamH I (GGATCC) and Xho I (CTCGAG) are underlined

World J Microbiol Biotechnol (2011) 27:2957–2967 2959

123

femB gene (the primers used to detect femA gene were

included in the reactions for the detection of seb, sel and

sep genes, and the primers used to detect femB gene were

included in the reactions for the detection of the other se

genes), 5 lL of 109 buffer for KOD-plus-DNA polymer-

ase (TOYOBO, Osaka, Japan), 1 mmol MgSO4, 200 lmol

each of deoxynucleoside triphosphates (dNTPs) and 1.0

Unit of KOD-plus-DNA polymerase (TOYOBO, Osaka,

Japan). The final volume of the mixture was adjusted to 50

lL with sterile water. The PCR reaction was performed by

using a Mastercycler gradient (Eppendorf AG, Hamburg,

Germany) as follows: 94�C for 5 min, 36 repetitions of

94�C for 30 s, 55�C for 30 s and 72�C for 1 min, followed

by a final extension step at 72�C for 10 min.

Cloning of sek and seq genes and construction

of expression vectors for rGST-SEK and rGST-SEQ

Primers containing recognition sequences for the restric-

tion enzymes BamH I (Fermentas, Hanover, MD, USA)

and Xho I (Fermentas, Hanover, MD, USA) were designed

to amplify the DNA fragments that code for the mature

forms of SEK and SEQ (Table 2) (Orwin et al. 2001;

Orwin et al. 2002). The PCR reaction mixtures in a final

volume of 50 lL contained 1 lL of the isolated template

DNA from the production strain, 1 lL of each primer, 5 lL

of 109 buffer for KOD-plus-DNA polymerase (TOYOBO,

Osaka, Japan), 1 mmol MgSO4, 200 lmol each of dNTPs

and 1.0 Unit of KOD-plus-DNA polymerase (TOYOBO,

Osaka, Japan). The PCR reaction was performed in a

Mastercycler gradient (Eppendorf AG, Hamburg, Ger-

many) as follows: 94�C for 5 min, 36 cycles of 94�C for

30 s, 55�C for 30 s, and 72�C for 1 min, followed by a

single extension step at 72�C for 10 min. The DNA frag-

ments amplified by PCR for sek and seq genes were then

cloned into the pGEM-T vector (Promega, Madison, WI,

USA). The ligation products were transformed into com-

petent E. coli DH5a cells and the nucleotide sequences of

the DNA fragments inserted in the constructed plasmids

(pGEM-T-sek and pGEM-T-seq) were determined by

Shanghai Sangon Biological Engineering Technology &

Services Co., Ltd. (Shanghai, China). The DNA fragments

of sek and seq genes were then subcloned to pGEX-4T-1

expression vectors (Promega, Madison, WI, USA), using

the restriction enzymes BamH I and Xho I. The resulting

plasmids pGEX-4T-SEK and pGEX-4T-SEQ were trans-

formed into competent E. coli BL21 (DE3) cells for the

expression of the corresponding recombinant proteins.

Production and purification of rSEK and rSEQ

The E. coli BL21 (DE3) cells harboring each of the plas-

mids pGEX-4T-SEK and pGEX-4T-SEQ were grown in

29 YT broth plus ampicillin (100 lg/mL) at 37�C with

shaking to an A600 of 0.4–0.6, induced with 0.5 mmol/L

isopropyl-D-thiogalactoside (IPTG, Genview, Houston,

TX, USA) for 8–10 h at 25�C. Cells were harvested by

centrifugation at 8,000 r/min for 10 min at 4�C and then

lysed by using a FRENCH� press (Thermo IEC, Needham

Heights, MA, USA) in resuspension buffer (PBS with 2%

glycerol, pH 7.4). Insoluble cellular debris in the lysate was

separated by centrifugation, and the supernatants were fil-

tered by using a 0.22-lm-pore-size membrane. The cleared

solutions containing soluble recombinant GST-tagged

proteins (rGST-SEK and rGST-SEQ) were applied to

a GSTrapTM FF column (GE Healthcare Bio-Sciences

AB, Uppsala, Sweden). The recombinant GST-fused SEs

(rGST-SEK and rGST-SEQ) were eluted with 10 mmol/L

glutathione (Sigma–Aldrich, St. Louis, MO, USA) in

50 mmol/L Tris–HCl (pH 8.0) buffer, and the rGST-SE-

containing fractions were then pooled and applied to a

HiPrepTM 26/10 Desalting column (GE Healthcare Bio-

Sciences AB, Uppsala, Sweden) equilibrated with the

cleavage buffer (50 mmol/L Tris–HCl, 0.15 mol/L NaCl,

2.5 mmol/L CaCl2, pH 7.5) for thrombin digestion. Mature

forms of rSEK and rSEQ were released by thrombin

digestion for 8–12 h at room temperature. The GST tag in

the thrombin-treated solution was removed after a second

round of affinity chromatography on the GSTrapTM FF

column. The flow-through fraction containing the rSE

proteins was then loaded on a HiPrepTM 26/10 Desalting

column (GE Healthcare Bio-Sciences AB, Uppsala, Swe-

den) equilibrated with the loading buffer (50 mmol/L Tris–

HCl, pH 8.5) for anion-exchange chromatography. Then,

the solution from the desalting column was applied to

a HiPrepTM 16/10 Q XL column (GE Healthcare Bio-

Sciences AB, Uppsala, Sweden). The column was washed

with the loading buffer for 10-column volume, and bound

proteins were eluted at a flow rate of 3.0 mL/min with

a 0–50% linear gradient of eluent buffer (50 mmol/L

Tris–HCl, 1 mol/L NaCl, pH 8.5). Fractions from anion-

exchange chromatography were analyzed by SDS–PAGE.

Only those containing a single band of rSE are pooled.

The concentrations of the purified recombinant proteins

were determined using a bicinchoninic acid (BCA) assay

kit (Beyotime, Jiangsu Province, China).

Ultrafiltration of the injection solution

The solution of the injection products from the manufac-

turing company was concentrated approximately 40-fold

by ultrafiltration (Biomax-5 K NMWL, Millipore, Bedford,

MA, USA). The concentration of SEC2 in the concentrated

solution was then determined by the ELISA method

developed in our previously study (Ding et al. 2009).


123

Stimulatory effects of rSEK and rSEQ on proliferation

of murine splenocytes in vitro

The stimulatory effects of rSEK and rSEQ on proliferation

of murine splenocytes were measured by MTT assay.

Briefly, freshly isolated murine splenocytes were incubated

in triplicate wells in 96-well microplates (Greiner bio-one,

Frickenhausen, Germany) at 5 9 105 cells per well in the

culture medium (RPMI-1640 medium containing 10%

FBS) supplemented with serial concentrations (10, 100 and

1,000 ng/mL) of purified rSE. After incubating for 44 h at

37�C in a humidified CO2 incubator (Model 3111, Thermo

Forma, Marietta, Ohio, USA), the cell cultures were sup-

plemented with filter-sterilized MTT (a final concentration

of 0.5 mg/mL) and further incubated at 37�C for 4 h. The

supernatants of the cell cultures were then removed, and

the dark blue crystals of formazan at the bottom of each

well were dissolved with 120 lL of dimethyl sulfoxide

(DMSO). The plates were read on a microplate reader

(Model 680, Bio-Rad, Japan) with a test wavelength of

570 nm and a reference wavelength of 630 nm. The pro-

liferation rates of the murine splenocytes induced by rSE

were presented as the average stimulation index of three

separate experiments, where stimulation index = (A570–630

of the treated group—A570–630 of the background)/

(A570–630 of the control group—A570–630 of the back-

ground) (Table 3). Con A (10 lg/mL) and nSEC2 were

served as positive controls and rGST (10 lg/mL) was

served as a negative control in the method. For comparison,

the stimulatory properties of the injection solution on the

murine splenocytes were also determined by the MTT

method. Since the label amount of SEC2 in the injection

products is 10 ng/mL, an appropriate volume of the con-

centrated injection solution was added to the cell cultures

and the final concentration of SEC2 was 10 ng/mL in the

injection group.

Inhibition effects of rSEK- and rSEQ-stimulated

murine splenocytes on growth of tumor cells in vitro

The inhibition effects of the murine splenocytes that were

stimulated by rSEK and rSEQ on growth of tumor cells

were also assessed using MTT method. K562-ADM cells

and B16 cells were served as target cells and murine

splenocytes were used as effector cells. Briefly, 2.5 9 104

target cells per well were incubated with effector cells at a

20:1 effector-to-target ratio in the culture medium sup-

plemented with graded doses (10, 100 and 1,000 ng/mL) of

purified rSE in triplicate wells in 96-well microplates

(Greiner bio-one, Frickenhausen, Germany) for 44 h at

37�C in a humidified CO2 incubator (Model 3111, Thermo

Forma, Marietta, Ohio, USA). Cell cultures were then

added with filter-sterilized MTT (a final concentration of

0.5 mg/mL) and incubated for additional 4 h. The resulting

crystals of formazan were solubilized as described above.

The plates were read on a microplate reader (Model 680,

Bio-Rad, Japan) with a test wavelength of 570 nm and

a reference wavelength of 630 nm. The superantigen-

induced cellular cytotoxicity of murine splenocytes was

calculated as follows: % growth inhibition of target

cells = {1 - [(A570–630 of the treated group - A570–630

of the background) - (A570–630 of the blank group -

A570–630 of the background)]/(A570–630 of the control

group - A570–630 of the background)} 9 100% (Table 3).

The results were presented as the average inhibition rate of

three separate experiments. Con A (10 lg/mL) and nSEC2

were used as positive controls and rGST (10 lg/mL) was

used as a negative control in the assay. For comparison, the

stimulatory effects of the staphylococcin injection on the

cytotoxicity of murine splenocytes were also measured by

the MTT method. In the injection group, the cell cultures

were supplemented with the concentrated injection solu-

tion, and the final concentration of SEC2 was 10 ng/mL.

Results

Detection of se genes in the production strain

The specificity of the primer pairs was tested by using the

reference strains. The sizes of the amplicons obtained from

the reference strains corresponded to their expected sizes

(data not shown). No bands were observed in any of the

reactions when sterile water was used as a negative control.

As a positive control, the PCR products of either femA

or femB gene were successfully observed in each of the

reactions, validating the amplification conditions. The PCR

Table 3 Group summary of the MTT assay

Group Composition

Murine splenocytes growth stimulation assay

Background Culture medium

Control group Culture medium, murine splenocytes

Treated group Culture medium, murine splenocytes,

test proteinsa

Tumor cell growth inhibition assay

Background Culture medium

Blank group Culture medium, murine splenocytes,

test proteinsa

Control group Culture medium, murine splenocytes,

tumor cells

Treated group Culture medium, murine splenocytes,

tumor cells, test proteinsa

a Test proteins: Con A, nSEC2, rGST, rSEK, rSEQ, or staphylo-

coccin injection solution


123

results showed that the production strain of staphylococcin

injection is positive for seven se genes (seg, sei, sek, sem,

sen, seo and seq) (Fig. 1). However, the PCR results

showed that the production strain is negative for sec2 gene,

and the negative results were confirmed by using another

two primer pairs for the detection of sec2 gene (data not

shown).

Construction of pGEX-4T-SEK and pGEX-4T-SEQ

vectors

The sek and seq genes encoding the mature proteins were

amplified by PCR method from the genomic DNA of the

production strain and then inserted into the pGEM-T vec-

tor. The nucleotide sequences of the inserted DNA frag-

ments were identical to those of sek and seq previously

reported, respectively (Orwin et al. 2001, 2002). The sek

and seq genes were then cloned in the pGEX-4T-1 vectors,

generating the plasmids of pGEX-4T-SEK and pGEX-4T-

SEQ. The constructs were verified by restriction digestion

with BamH I and Xho I (data not shown).

Expression of rGST-SEK and rGST-SEQ

The recombinant expression vectors pGEX-4T-SEK and

pGEX-4T-SEQ were introduced into E. coli BL21 (DE3)

cells. Different expression conditions (induction tempera-

ture, induction time and concentration of IPTG) were tested

to optimize the yield of the target proteins, and the typical

yield of the soluble GST-fused proteins (rGST-SEK and

rGST-SEQ) was 60–80 mg per liter of E. coli culture as

determined by densitometry after SDS–PAGE.

Purification of rSEK and rSEQ

The recombinant GST-fused proteins (rGST-SEK and

rGST-SEQ) in the supernatants from E. coli lysates were

purified by affinity chromatography. The purity of the

recombinant GST-fused proteins after affinity chromatog-

raphy was over 80% as calculated by densitometric anal-

ysis of the bands on the stained SDS–PAGE gels, with an

estimated recovery of 70–80%. The GST tag was then

released from the fusion proteins by thrombin digestion

and removed by an additional round of affinity chroma-

tography. The recombinant proteins (rSEK and rSEQ) were

further purified by anion-exchange chromatography. The

rSEK and rSEQ proteins were eluted from the HiPrepTM

16/10 Q XL column at a NaCl concentration range of

0.20–0.24 and 0.04–0.08 mol/L, respectively. The final

yield of both rSEK and rSEQ was 10–12 mg per liter of the

initial E. coli culture as determined by BCA assay, with a

purity of greater than 95% (Fig. 2).

Stimulatory effects of rSEK and rSEQ on proliferation

of murine splenocyts in vitro

The MTT assay was performed to determine the stimula-

tory effects of rSEK and rSEQ on proliferation of murine

splenocytes. Con A and nSEC2 were served as positive

controls and rGST was served as a negative control in the

assay. The results of the MTT assay exhibited that both

rSEK and rSEQ in serial concentrations of 10, 100 and

1,000 ng/mL caused a significant, dose-dependent prolif-

eration on murine splenocytes in vitro when compared with

the negative control (Fig. 3). In addition, no significant

differences were observed between the stimulatory effects

of rSEk and rSEQ and that of native SEC2 in all three

different dose groups. For comparison, the stimulatory

effect of the injection solution from the manufacturing

company on proliferation of murine splenocytes was also

analyzed in the assay. The results showed that stimulatory

effect of the injection solution was nearly equal to that of

rSEk, rSEQ and native SEC2 in the 10 ng/mL group.

Inhibitory effects of rSEK- and rSEQ-stimulated

murine splenocytes on growth of tumor cells in vitro

The stimulatory effects of rSEK and rSEQ on cytotoxicity

of murine splenocyts on tumor cells were also evaluated by

MTT assay, using B16 cell line and K562-ADM cell line as

target. The results showed that the growth of the tumor cells

was significantly inhibited by incubation with the murine

splenocytes that were stimulated with rSEK or rSEQ at

serial concentrations (10, 100 and 1,000 ng/mL) as com-

pared with the negative control, and that the SE-mediated

cytotoxicity of murine splenocytes on each tumor cell line

Fig. 1 Detection of se genes in the production strain (S. aureus) of

the staphylococcin injection. The results showed that the production

strain of the injection is positive for seven se genes. Lane 1: seg(287 bp); Lane 2: sei (328 bp); Lane 3: sek (293 bp); Lane 4: sem(379 bp); Lane 5: sen (282 bp); Lane 6: seo (214 bp); Lane 7: seq(122 bp); Lane 8: DNA ladder (100–1,000 bp, Fermentas). Detection

of either femA (134 bp) or femB (651 bp) was performed in each PCR

reaction for the validation of the amplification conditions


123

was dose dependent (Fig. 4). In addition, the inhibition rates

of the murine splenocytes stimulated by rSEk and rSEQ on

the growth of the two tumor cell lines were almost equiv-

alent to that of the murine splenocytes induced by native

SEC2 in all the different dose groups. For comparison,

cytotoxicity of murine splenocytes treated with the injection

solution on the two tumor cell lines was also determined

using the MTT method. The results showed that the inhi-

bition effects of the murine splenocytes mediated by rSEK,

rSEQ and native SEC2 in the 10 ng/mL group on growth of

the two tumor cell lines were almost the same as that of the

murine splenocytes stimulated by the injection solution.

Discussion

The se genes are carried either by mobile genetic elements,

including plasmids and prophages, or by chromosomal

Fig. 2 SDS–PAGE analysis of purification of rSEK and rSEQ. a Lane1 Protein molecular weight marker (14.3–97.2 kDa, TAKARA), Lane 2rGST-SEK after affinity chromatography, Lane 3 rSEK and GST tag

after thrombin digestion, Lane 4 rSEK after the second round affinity

chromatography, Lane 5 rSEK after anion-exchange chromatography.

b Lane 1 Protein molecular weight marker (14.3–97.2 kDa, TAKARA),

Lane 2 rGST-SEQ after affinity chromatography, Lane 3 rSEQ and GST

tag after thrombin digestion, Lane 4 rSEQ after the second round affinity

chromatography, Lane 5 rSEQ after anion-exchange chromatography

Fig. 3 Stimulatory effects of rSEK and rSEQ on proliferation of

murine splenocytes in vitro. Results are mean ± SD from three

independent experiments. The paired Student’s t test was used and

the P values are indicated as follows: **P \ 0.01; ***P \ 0.001. SIStaphylococcin injection

Fig. 4 Inhibitory effects of rSEK- and rSEQ-stimulated murine

splenocytes on growth of tumor cells in vitro. a Inhibition effects of

murine splenocytes stimulated by rSEK and rSEQ on the growth of

K562-ADM cell line in vitro. Results are mean ± SD from three

independent experiments. The paired Student’s t test was used and

the P values are indicated as follows: **P \ 0.01; ***P \ 0.001. SIStaphylococcin injection. b Inhibition effects of the murine spleno-

cytes stimulated by rSEK and rSEQ on the growth of B16 cell line in

vitro. Results are mean ± SD from three independent experiments.

The paired Student’s t test was used and the P values are indicated as

follows: **P \ 0.01; ***P \ 0.001. SI Staphylococcin injection


123

elements such as staphylococcal pathogenic islands (SaPIs)

(Novick et al. 2001; Novick 2003). PCR has proven to be a

useful and reliable tool for detection of se genes in the last

two decades (Vasconcelos and Da Cunha 2010). For

simultaneous detection and identification of different se

genes in S. aureus strains recovered from a large group of

foods and clinical or other specimens, multiplex PCR

method has been developed (Sharma et al. 2000; Omoe

et al. 2002, 2005a; Bania et al. 2006; Hwang et al. 2007;

Morandi et al. 2007; Ertas et al. 2010; Wu et al. 2011). For

instance, Ertas et al. (2010) reported the identification of

presence of S. aureus and classical se genes from a total of

150 samples of sheep cheese and diary desserts using

multiplex PCR in Turkey. Wu et al. (2011) described the

identification of se genes and exfoliative toxin genes in

ninety-nine strains of community-acquired methicillin-

resistant S. aureus isolated from Chinese children in eight

Chinese hospitals using six sets of multiplex PCR. How-

ever, one possible disadvantage of multiplex PCR method is

that it seems to be complicated for the optimization of PCR

conditions and the design of the primers with similar

annealing temperatures, distinguishable product sizes and

high specificity in one multiplex PCR system. In addition,

in some cases, additional experiments such as restriction

endonuclease assay (REA) are necessary for minimizing

the possibility of false-positive or false-negative results

(Vasconcelos and Da Cunha 2010). More recently, several

microarray systems based on PCR-amplification were also

available for detection and identification of se and other

virulence-associated genes (Saunders et al. 2004; Sergeev

et al. 2004). Sergeev et al. (2004) identified almost all kinds

of se genes in several previously characterized S. aureus

isolates using a PCR-microassay combination consisting of

oligonucleotide probes that were designed corresponding to

highly conserved flanked regions for each se gene.

In this study, a series of separate PCR reactions were

performed to screen for the presence of se genes (from sea

to see and from seg to seu) in the production strain of the

staphylococcin injection from one manufacturing com-

pany. Since all the specificities of the primers used in this

study have been evaluated using standard S. aureus strains,

and the PCR conditions were confirmed using femA and

femB genes as internal positive controls and sterile water as

negative control respectively, the method described in this

study, albeit a little time-consuming, is accurate, reliable,

easy-to-operate and cost-effective, in that no complicated

optimization of PCR conditions are needed and no

expensive equipments or apparatus are required. The PCR

results showed that seven non-classical se genes (seg, sei,

sek, sem, sen, seo and seq) are harbored by the production

strain. The coexistence of seg, sei, sem, sen and seo genes

demonstrates that a common genetic element called the

enterotoxin gene cluster (egc) is present in the genome of

the strain (Jarraud et al. 2001; Kuroda et al. 2001). So far,

at least three egc variants have been suggested (Blaiotta

et al. 2006). Since the production strain is negative for seu

gene, which was described as a part of an egc variant

(Letertre et al. 2003; Blaiotta et al. 2006), and the

sequences of the five genes (seg, sei, sem, sen and seo)

were identical to those of the corresponding toxin genes

reported previously (seg: GenBank accession number

AY920261; sei: GenBank accession number AY920268;

sem: GeneID 1124490 in NCBI database; sen: GeneID

1124486 in NCBI database; seo: GeneID 1124491 in NCBI

database, data not shown), it is suggested that the pro-

duction strain harbors the most common egc combination

being seg-sei-sem-sen-seo. The egc element in the pro-

duction strain could be further discriminated using com-

bination of spa typing and REA analysis, which has proven

to be an effective method for genotyping of egc-positive

S. aureus strains (Blaiotta et al. 2006). sek and seq genes

were detected simultaneously, which is in agreement with

Bania’s study showing that all the strains carrying sek are

positive for seq (Bania et al. 2006). It was demonstrated

that seb-sek-seq gene combination is frequently associated

with SaPI3 (Yarwood et al. 2002), and that sea-sek-seq

gene combination usually associated with uSa3mw (Baba

et al. 2002; Wu et al. 2011), respectively. The strain har-

bors sek-seq but not sea or seb, implying that the gene

combination of sek-seq is different than those newly

described genetic elements. Thus, the PCR results led to

assumption that one or a plurality of the seven enterotoxins

may contribute to the clinical efficacy of the staphylococ-

cin injection.

The DNA-based approaches are considered to be reli-

able and rapid for detection and identification of se genes.

However, it should be reminded that those approaches

could only indicate the presence of specific se genes

without indicating whether the corresponding SE proteins

are produced. Accordingly, reverse transcription real-time

PCR has been reported to evaluate expression potential of

se genes in S. aureus strains (Lee et al. 2007; Derzelle et al.

2009). For example, Lee et al. (2007) investigated and

compared expression profiles of SEs at an mRNA level in

four strains of S. aureus from food samples and two clinical

isolates of S. aureus using reverse transcription real-time

PCR. However, it should be pointed out that transcription

of se genes does not guarantee that the corresponding

SE proteins are actually produced or are produced at a

detectable level. The expression potentials of the seven se

genes were preliminarily investigated by reverse tran-

scription real-time PCR in our lab. The results indicated

that the relative mRNA abundances of the seven se genes

could be significantly affected by growth conditions such

as cell density, pH, temperature and fermentation scale

(data not shown). Since mimicking the actual industrial


123

fermentation condition of production of the staphylococcin

injection in a lab setting is difficult to achieve, more

extensive studies on on-line detection of expression profile

of SE proteins at an mRNA level in manufacturing pro-

cedures of the injection products are required.

Numerous assays have been developed for direct detec-

tion of classical SE proteins in food or clinical samples,

including reversed passive latex agglutination (RPLA),

radioimmunoassay (RIA), enzyme immunoassay (EIA) and

enzyme-linked immunosorbent assay (ELISA) (Bendahou

et al. 2009; Vasconcelos and Da Cunha 2010). However, fast

and unambiguous commercial detection methods of the non-

classical SEs are still lacking due to the difficulties in puri-

fication and preparation of antibodies with high specificity

and affinity (Vasconcelos and Da Cunha 2010). In our pre-

vious studies, SDS–PAGE coupled with LC–MS/MS

method was performed to analyze the protein components in

the injection solution (Ding et al. 2009). However, no

positive results were obtained for the detection of the cor-

responding toxin proteins of the seven se genes (seg, sei, sek,

sem, sen, seo and seq). As the MS-based method is of low

selectivity for the identification of SE proteins, approaches

with higher selectivity and sensitivity for the detection of

those types of SE proteins in the injection products need to

be developed in future studies. In addition, as discrepancies

between the distribution of se genes and the expression of

the corresponding SE proteins were frequently observed

(Zouharova and Rysanek 2008; Bendahou et al. 2009), it is

suggested that two or more methods might be performed

together to get more accurate and reliable results for both

phenotypic and genotypic characterization of se-positive S.

aureus isolates. On the other hand, since production of SEs is

quite sensitive to the environmental conditions such as pH,

salt concentration and microbial competition (Le Loir et al.

2003), those culture conditions also should be strictly

monitored during the preparation process of the injection

products.

It is claimed that the main effective component in the

injection is SEC2, and SEC2 was detected both by ELISA

assay and mass-spectrometry-based approach in the injec-

tion products from the manufacturing company in our

previous study (Ding et al. 2009). Unexpectedly, sec2 gene

was not identified in the genomic DNA of the production

strain. Although a similar lack of correlation between SEC

production and the presence of sec gene has been reported

(Morandi et al. 2007), the negative results for sec2 gene

could also suggest that SEC2 might not be produced by the

production strain but added artificially during the prepa-

ration process of the related injection products.

In this study, the gene fragments for the mature form of

SEK and SEQ were cloned from the production strain, and

the corresponding recombinant proteins, rSEK and rSEQ,

were expressed and purified. The in vitro superantigenic

activities of rSEK and rSEQ were evaluated by MTT assay.

The results demonstrated that both of the recombinant SE

proteins exhibited a remarkable stimulatory influence on

lymphocytes and enhanced the cell-mediated cytotoxicity

against the two tumor cell lines. The results also showed that

the superantigenic activities of the injection solution were

equivalent to those of rSEK, rSEQ and native SEC2 in the

10 ng/mL group. Thus, the results in this study indicate that,

first, both rSEK and rSEQ represent potential immuno-

modulatory reagents for antitumor therapy and second, those

protein components identified in our previous study (Ding

et al. 2009), other than SEC2, might have little contributions

to the immunostimulatory capacities of the injection prod-

ucts. Since the superantigenic activities of rSEG, rSEI,

rSEM, rSEN and rSEO have been confirmed in our previous

studies (Pan et al. 2007a; Pan et al. 2007b and Sun’s

unpublished data), and it is proved that staphylococcin

injection could be safely administered to patients with

malignant diseases, it is tempting to expect that those

recombinant non-classical SEs (rSEG, rSEI, rSEK, rSEM,

rSEN, rSEO and rSEQ), used singly or in combination, might

be appropriate candidates for immunomodulatory agents in

cancer therapy, and that genetic engineering approach might

be considered as an alternative approach to the traditional

manufacturing process of the second-generation staphylo-

coccin injection. However, since each serological type of

SEs interacts with specific T cells expressing particular TCR

Vb elements (Fraser et al. 2000; Proft and Fraser 2003),

combination of different types of recombinant SEs may

induce depletion or anergy of a large portion of the T-cell

repertoire, resulting in severe immunosuppression. Clinical

trials of superantigen-based immunotherapy revealed that

the efficacy of the engineered tumor-targeted superantigen

could be moderated by SE-specific antibodies in the human

body, and the clinical toxicities and the maximum tolerated

dose (MTD) are both correlated with the serum level of anti-

SE antibodies (Alpaugh et al. 1998; Cheng et al. 2004; Shaw

et al. 2007). Thus, if one or a plurality of the seven rSEs is

used as the main active component in the future products of

the staphylococcin injection, the concentration of the anti-

bodies specific for the corresponding enterotoxins should be

seriously considered. Furthermore, customized regimens

encompassing variability in the systemic immune response

and the biology of different types of malignant diseases

should be taken into account to optimize the efficacy of the

combined therapy with minimal toxicity.

Conclusion

The distribution of se genes in the production strain of the

staphylococcin injection was identified. The results showed

that the production strain harbors seven se genes, indicating


123

that one or a plurality of the seven non-classical SEs (SEG,

SEI, SEK, SEM, SEN, SEO and SEQ) may contribute to

the immunomodulatory capacity of the injection products.

In addition, the recombinant SEK and SEQ proteins were

produced and purified. The results of the MTT method

showed that both of the recombinant proteins possess

strong stimularoty effects on the proliferation and cyto-

toxicity of the murine splenocytes, indicating that both

rSEK and rSEQ appear as potential candicates for cancer

immunotherapy.

Acknowledgments This work was financially supported by the

grant (No. 2004C13041) from the Science and Technology Depart-

ment of Zhejiang Province, China.

References

Alpaugh RK, Schultz J, McAleer C, Giantonio BJ, Persson R,

Burnite M, Nielsen S-E, Vitek L, Persson B, Weiner LM (1998)

Superantigen-targeted therapy: phase I escalating repeat dose

trial of the fusion protein PNU-214565 in patients with advanced

gastrointestinal malignancies. Clin Cancer Res 4:1903–1914

Baba T, Takeuchi F, Kuroda M, Yuzawa H, Aoki K, Oguchi A, Nagai

Y, Iwama N, Asano K, Naimi T, Kuroda H, Cui L, Yamamoto K,

Hiramatsu K (2002) Genome and virulence determinants of high

virulence community-acquired MRSA. Lancet 359:1819–1827

Bania J, Dabrowska A, Bystron J, Korzekwa K, Chrzanowska J,

Molenda J (2006) Distribution of newly described enterotoxin-

like genes in Staphylococcus aureus from food. Int J Food

Microbiol 108:36–41

Becker K, Roth R, Peters G (1998) Rapid and specific detection of

toxigenic Staphylococcus aureus: use of two multiplex PCR

enzyme immunoassays for amplification and hybridization of

staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic

shock syndrome toxin 1 gene. J Clin Microbiol 36:2548–2553

Bendahou A, Abid M, Bouteldoun N, Catelejine D, Lebbadi M (2009)

Enterotoxigenic coagulase positive Staphylococcus in milk and

milk products, lben and jben, in northern Morocco. J Infect Dev

Ctries 3:169–176

Blaiotta G, Fusco V, von Eiff C, Villani F, Becker K (2006)

Biotyping of enterotoxigenic Staphylococcus aureus by entero-

toxin gene cluster (egc) polymorphism and spa typing analyses.

Appl Environ Microbiol 72:6117–6123

Brodin TN, Persson R, Soegaard M, Ohlsson L, d’Argy R, Olsson J,

Molander A, Antonsson P, Gunnarsson P-O, Kalland T, Dohlsten

M (1998) Man-made superantigens: tumor-selective agents for

T-cell-based therapy. Adv Drug Deliver Rev 31:131–142

Chen JH, Chen L, Hu DW, Ren SH, Duan TH, Wen YJ, Yang CL

(1999) Curative effect of combination therapy with highly

agglutinative staphylococcin in interventional treatment for

hepatic tumors. Chin J Clin Oncol 26:622–623 (in Chinese)

Cheng JD, Babb JS, Langer C, Aamdal S, Robert F, Engelhardt LR,

Fernberg O, Schiller J, Forsberg G, Alpaugh RK, Weiner LM,

Rogatko A (2004) Individualized patient dosing in phase I

clinical trials: the role of escalation with overdose control in

PNU-214936. J Clin Oncol 22:602–609

Derzelle S, Dilasser F, Duquenne M, Deperrois V (2009) Differential

temporal expression of the staphylococcal enterotoxins genes

during cell growth. Food Microbiol 26:896–904

Ding D, Huang P, Sun HY, Xue Q, Chen SQ (2009) Identification of

protein components and quantitative immunoassay for SEC2 in

staphylococcin injection. J Pharmaceut Biomed Anal 50:79–85

Dinges MM, Orwin PM, Schlievert PM (2000) Exotoxins of

Staphylococcus aureus. Clin Microbiol Rev 13:16–34

Dohlsten M, Hedlund G, Akerblom E, Lando PA, Kalland T (1991)

Monoclonal antibody-targeted superantigens: a different class of

anti-tumor agents. Proc Natl Acad Sci USA 88:9287–9291

Ertas N, Gonulalan Z, Yildirim Y, Kum E (2010) Detection of

Staphylococcus aureus enterotoxins in sheep cheese and dairy

desserts by multiplex PCR technique. Int J Food Microbiol

142:74–77

Forsberg G, Ohlsson L, Brodin T, Bjork P, Lando PA, Shaw D, Stern

PL, Dohlsten M (2001) Therapy of human non-small-cell lung

carcinoma using antibody targeting of a modified superantigen.

Brit J Cancer 85:129–136

Fraser J, Arcus V, Kong P, Baker E, Proft T (2000) Superantigens—

powerful modifiers of the immune system. Mol Med Today

6:125–132

Hansson J, Ohlsson L, Persson R, Andersson G, Ilback N-G, Litton

MJ, Kalland T, Dohlsten M (1997) Genetically engineered

superantigens as tolerable antitumor agents. Proc Natl Acad Sci

USA 94:2489–2494

He B, Wu Y (1998) Curative effect of highly agglutinative

staphylococcin plus cisplatin in treatment of malignant pleural

effusion and ascites. Chin J Clin Oncol 25:623–624 (in Chinese)

Holtfreter S, Grumann D, Schmudde M, Nguyen HTT, Eichler P,

Strommenger B, Kopron K, Kolata J, Giedrys-Kalemba S,

Steinmetz I, Witte W, Broker BM (2007) Clonal distribution of

superantigen genes in clinical Staphylococcus aureus isolates.

J Clin Microbiol 45:2669–2680

Hwang SY, Kim SH, Jang EJ, Kwon NH, Park YK, Koo HC, Jung

WK, Kim JM, Park YH (2007) Novel multiplex PCR for the

detection of the Staphylococcus aureus superantigen and its

application to raw meat isolates in Korea. Int J Food Microbiol

117:99–105

Jarraud S, Peyrat MA, Lim A, Tristan A, Bes M, Mougel C, Etienne J,

Vandenesch F, Bonneville M, Lina G (2001) egc, a highly

prevalent operon of enterotoxin gene, forms a putative nursery of

superantigens in Staphylococcus aureus. J Immunol 166:

669–677

Kuroda M, Ohta T, Uchiyama I, Baba T, Yuzawa H, Kobayashi I, Cui

L, Oguchi A, Aoki K, Nagai Y, Lian J, Ito T, Kanamori M,

Matsumaru H, Maruyama A, Murakami H, Hosoyama A,

Mizutani-Ui Y, Takahashi NK, Sawano T, Inoue R, Kaito C,

Sekimizu K, Hirakawa H, Kuhara S, Goto S, Yabuzaki J,

Kanehisa M, Yamashita A, Oshima K, Furuya K, Yoshino C,

Shiba T, Hattori M, Ogasawara N, Hayashi H, Hiramatsu K

(2001) Whole genome sequencing of meticillin-resistant Staph-ylococcus aureus. Lancet 357:1225–1240

Le Loir Y, Baron F, Gautier M (2003) Staphylococcus aureus and

food poisoning. Genet Mol Res 2:63–76

Lee YD, Moon BY, Park JH, Chang HI, Kim WJ (2007) Expression

of enterotoxin genes in Staphylococcus aureus isolates based on

mRNA analysis. J Microbiol Biotechnol 17:461–467

Letertre C, Perelle S, Dilasser F, Fach P (2003) Identification of a new

putative enterotoxin SEU encoded by the egc cluster of

Staphylococcus aureus. J Appl Microbiol 95:38–43

Morandi S, Brasca M, Lodi R, Cremonesi P, Castiglioni B (2007)

Detection of classical enterotoxins and identification of entero-

toxin genes in Staphylococcus aureus from milk and dairy

products. Vet Microbiol 124:66–72

Muller-Alouf H, Carnoy C, Simonet M, Alouf JE (2001) Superantigen

bacterial toxins: state of the art. Toxicon 39:1691–1701

Novick RP (2003) Mobile genetic elements and bacterial toxinoses:

the superantigen-encoding pathogenicity islands of Staphylococ-cus aureus. Plasmid 49:93–105

Novick RP, Schlieverta P, Ruzin A (2001) Pathogenicity and

resistance islands of staphylococci. Microbes Infect 3:585–594


123

Omoe K, Ishikawa M, Shimoda Y, Hu DL, Ueda S, Shinagawa K

(2002) Detection of seg, seh, and sei genes in Staphylococcusaureus Isolates and determination of the enterotoxin productiv-

ities of S. aureus isolates harboring seg, seh, or sei genes. J Clin

Microbiol 40:857–862

Omoe K, Hu DL, Takahashi-Omoe H, Nakane A, Shinagawa K

(2003) Identification and characterization of a new staphylococ-

cal Enterotoxin-related putative toxin encoded by two kinds of

plasmids. Infect Immun 71:6088–6094

Omoe K, Hu DL, Takahashi-Omoe H, Nakane A, Shinagawa K

(2005a) Comprehensive analysis of classical and newly

described staphylococcal superantigenic toxin genes in Staphy-lococcus aureus isolates. FEMS Microbiol Lett 246:191–198

Omoe K, Imanishi K, Hu DL, Kato H, Fugane Y, Abe Y, Hamaoka S,

Watanabe Y, Nakane A, Uchiyama T, Shinagawa K (2005b)

Characterization of novel staphylococcal enterotoxin-like toxin

type P. Infect Immun 73:5540–5546

Orwin PM, Leung DYM, Donahue HL, Novick RP, Schlievert PM

(2001) Biochemical and biological properties of staphylococcal

enterotoxin K. Infect Immun 69:360–366

Orwin PM, Leung DY, Tripp TJ, Bohach GA, Earhart CA, Ohlendorf

DH, Schlievert PM (2002) Characterization of a novel staphy-

lococcal enterotoxin-like superantigen, a member of the group V

subfamily of pyrogenic toxins. Biochemistry 41:14033–14040

Pan YQ, Ding D, Li DX, Chen SQ (2007a) Expression and bioactivity

analysis of staphylococcal enterotoxin M and N. Protein Expr

Purif 56:286–292

Pan YQ, Ding D, Sun HY, Chen SQ (2007b) Expression and

bioactivity of the cloned staphylococcal enterotoxin O. Acta

Pharm Sin 42:943–948 (in Chinese)

Petersson K, Forsberg G, Walse B (2004) Interplay between super-

antigens and immunoreceptors. Scand J Immunol 59:345–355

Proft T, Fraser JD (2003) Bacterial superantigens. Clin Exp Immunol

133:299–306

Saunders NA, Underwood A, Kearns AM, Hallas G (2004) A

virulence-associated gene microarray: a tool for investigation of

the evolution and pathogenic potential of Staphylococcus aureus.

Microbiology 150:3763–3771

Sergeev N, Volokhov D, Chizhikov V, Rasooly A (2004) Simultaneous

analysis of multiple staphylococcal enterotoxin genes by an

oligonucleotide microarray assay. J Clin Microbiol 42:2134–2143

Sharma NK, Rees CED, Dodd CER (2000) Development of a single-

reaction multiplex PCR toxin typing assay for Staphylococcusaureus strains. Appl Environ Microb 66:1347–1353

Shaw DM, Connolly NB, Patel PM, Kilany S, Hedlund G, Nordle O,

Forsberg G, Zweit J, Stern PL, Hawkins RE (2007) A phase II

study of a 5T4 oncofoetal antigen tumour-targeted superantigen

(ABR-214936) therapy in patients with advanced renal cell

carcinoma. Brit J Cancer 96:567–574

Song YQ, Li GL, Cao RB, Huang J, Zhu F (2008) Clinical study on

concurrent radiotherapy and chemotherapy combined with

highly agglutinative staphylococcin in the treatment of local

advanced cervical cancers. Chin Hosp Pharm J 28:1782–1784 (in

Chinese)

Sundberg EJ, Li YL, Mariuzza RA (2002) So many ways of getting in

the way: diversity in the molecular architecture of superantigen-

dependent T-cell signaling complexes. Curr Opin Immunol

14:36–44

Tian WD, Tang W, Li SW, Zhang J, Wang D, Li LX (2001)

Signification of peripheral blood immune changes in treatment

for oral cancer with HAS and chemotherapy. Chin J Oral

Maxillofac Surg 11:45–48 (60) (in Chinese)

Vasconcelos NG, Da Cunha MLRS (2010) Staphylococcal entero-

toxins: molecular aspects and detection methods. J Pub Health

Epidemiol 2:29–42

Wu H, Yu ZH, Liang R, Wang ZN, Yang ZX (2005) The analysis of

clinical efficacy on highly agglutinative staphylococci combined

with radiotherapy in the patients with nasopharyngeal carci-

noma. Chin J Clin Oncol 32:879–882 (in Chinese)

Wu D, Li X, Yang Y, Zheng Y, Wang C, Deng L, Liu L, Li C, Shang

Y, Zhao C, Yu S, Shen X (2011) Superantigen gene profiles and

presence of exfoliative toxin genes in community-acquired

meticillin-resistant Staphylococcus aureus isolated from Chinese

children. J Med Microbiol 60:35–45

Yan Z, Chen J, Zhao WH, Guo W, Liu CX (2008) Clinical application

of highly agglutinative staphylococcin in cancer treatment. Chin

J Clin Oncol 35:953–959 (in Chinese)

Yarwood JM, McCormick JK, Paustian ML, Orwin PM, Kapur V,

Schlievert PM (2002) Characterization and expression analysis

of Staphylococcus aureus pathogenicity island 3. J Biol Chem

277:13138–13147

Zouharova M, Rysanek D (2008) Multiplex PCR and RPLA

Identification of Staphylococcus aureus enterotoxigenic strains

from bulk tank milk. Zoonoses Public Health 55:313–319


123

Documents

Gene detection of staphylococcal enterotoxins in production strain of staphylococcin injection and superantigenic activity of rSEK and rSEQ