Gene-for-gene relationship in the host pathogen system ...msudaylab.org/wp-content/uploads/2016/11/2013_Vogt-et-al.pdf · Gene-for-gene relationship in the host–pathogen system

Gene-for-gene relationship in the host–pathogen systemMalus9 robusta 5–Erwinia amylovora

Isabelle Vogt1, Thomas W€ohner1, Klaus Richter2, Henryk Flachowsky1, George W. Sundin3, Annette Wensing4,

Elizabeth A. Savory3, Klaus Geider4, Brad Day3, Magda-Viola Hanke1 and Andreas Peil1

1Julius K€uhn-Institut, Institute for Breeding Research on Horticultural and Fruit Crops, Pillnitzer Platz 3a, D-01326, Dresden, Germany; 2Julius K€uhn-Institut, Institute for Resistance Research

and Stress Tolerance, Erwin-Baur-Str. 27, 06484, Quedlinburg, Germany; 3Department of Plant Pathology, Michigan State University, East Lansing, MI, 48824, USA; 4Julius K€uhn-Institut,

Institute for Plant Protection in Fruit Crops and Viticulture, Schwabenheimer Straße101, 69221, Dossenheim, Germany

Author for correspondence:Andreas Peil

Tel: +49 (0)351 2616228Email: [email protected]

Received: 19 July 2012

Accepted: 10 November 2012

New Phytologist (2013) 197: 1262–1275doi: 10.1111/nph.12094

Key words: avrRpt2EA, fire blight, gene-for-gene interaction,Malus9 robusta 5,resistance.

Summary

� Fire blight is a destructive bacterial disease caused by Erwinia amylovora affecting plants in

the family Rosaceae, including apple. Host resistance to fire blight is present mainly in acces-

sions ofMalus spp. and is thought to be quantitative in this pathosystem.� In this study we analyzed the importance of the E. amylovora effector avrRpt2EA, a homo-

log of Pseudomonas syringae avrRpt2, for resistance ofMalus9 robusta 5 (Mr5).� The deletion mutant E. amylovora Ea1189DavrRpt2EA was able to overcome the fire blight

resistance of Mr5. One single nucleotide polymorphism (SNP), resulting in an exchange of

cysteine to serine in the encoded protein, was detected in avrRpt2EA of several Erwinia strains

differing in virulence to Mr5. E. amylovora strains encoding serine (S-allele) were able to over-

come resistance of Mr5, whereas strains encoding cysteine (C-allele) were not. Allele specific-

ity was also observed in a coexpression assay with Arabidopsis thaliana RIN4 in Nicotiana

benthamiana. A homolog of RIN4 has been detected and isolated in Mr5.� These results suggest a system similar to the interaction of RPS2 from A. thaliana and

AvrRpt2 from P. syringae with RIN4 as guard. Our data are suggestive of a gene-for-gene

relationship for the host–pathogen system Mr5 and E. amylovora.

Introduction

The bacterial disease fire blight is currently one of the most eco-nomically important plant diseases in pome fruit productionworldwide. The disease is caused by the Gram-negative entero-bacterium Erwinia amylovora, which was the first bacterium thathas been identified as the causal agent of a plant disease (Winslowet al., 1920). E. amylovora was first observed in North America inthe Hudson Valley of New York (Denning, 1794) and has sincebeen decribed in more than 40 countries (Peil et al., 2009). Thebacterium E. amylovora overwinters in cankers of infected treesand can be disseminated in spring of the next season by birds,insects, mites, spiders, humans, wind, water or mechanical equip-ment (Schroth et al., 1974). In plants, the bacteria cells aremostly localized in the xylem and intercellular spaces from wherethey disseminate downwards against the direction of the waterflow (Bogs et al., 1998). Bacterial aggregation in the xylem causesa disruption of the vessel walls by changing the vessel pressure(Esau, 1965). Plugging of the vascular system by bacteria andcapsular extracellular polysaccharide leads to wilting symptomsand necrosis of the plant tissue above the infection site (VanAlfen & Allard-Turner, 1979). Fire blight infections can causesevere economic losses in pome fruit production. In the UnitedStates, for example, the estimated annual costs as a result of fire

blight infections are c. US$100 million (Norelli et al., 2003). InSwitzerland, an amount of US$9 million of losses was reportedbetween 1997 and 2000 (Hasler et al., 2002) and in Germany,losses of c. US$1.6 million were estimated for the LakeConstance region (southern Germany) after fire blight infectionsin 2007 (Scheer, 2009).

Disease management is possible with streptomycin or, less effi-ciently, with copper sprays; however, streptomycin resistance inE. amylovora occurs in the US and in other countries, includingCanada, Israel, and New Zealand (McManus et al., 2002;McGhee et al., 2011). US apple growers spend c. US$2.8 millionper year on antibiotic sprays (Gianessi et al., 2002). Streptomycin-containing products for fire blight control are not permitted inmany European countries. Biological control is anotherpossibility, but control can be variable and may not be effectivein years with disease-conducive weather conditions (Johnson &Stockwell, 1998).

Planting of fire blight-resistant cultivars seems to be the mostpromising strategy, which is environmental and producer-friendly. Most of the apple cultivars in current production glob-ally are highly susceptible to fire blight and thus justify resistancebreeding to fire blight as a primary objective in many applebreeding programs. Donor genotypes for fire blight resistance inwild apple species have been described and a number of studies

1262 New Phytologist (2013) 197: 1262–1275 No claim to original US government works

New Phytologist� 2013 New Phytologist Trustwww.newphytologist.com

Research

were performed with the aim of investigating the genetic basis ofthis trait. During the last decade, several quantitative trait loci(QTLs) for resistance to fire blight in different genetic back-grounds and in response to different strains of the pathogen wereidentified (Khan et al., 2012). For example, the QTL on linkagegroup 3 (LG 3) of Malus9 robusta 5 (Mr5) is of particular inter-est for breeding (Gardiner et al., 2012). This QTL was stable dur-ing 14 yr of virulence screening, in different cross-bredpopulations and after inoculation with a number of differentE. amylovora strains (Peil et al., 2007, 2008). In total, the QTLon LG 3 of Mr5 accounted for between 67 and 83% of the phe-notypic variance, indicating the existence of one or a few majorresistance genes in this genomic region. This assumption is sup-ported by several publications, which described the existence ofE. amylovora strains varying in virulence to Mr5 (Fazio et al.,2008) and strains overcoming the resistance of Mr5, (Norelli &Aldwinckle, 1986; Peil et al., 2011). Such diagnostic pathogenstrains are very useful not only for future breeding programs withobjectives of resistance gene pyramiding but also in studies ofplant–pathogen interactions. Little is known about genesinvolved in the Mr5-E. amylovora host–pathogen interaction.Gardner et al. (1980) postulated a dominant resistant gene forMr5 controlling resistance to fire blight and Peil et al. (2007) alsoassumed a major resistance gene.

Erwinia amylovora is known to encode a type III secretion sys-tem (T3SS), which secretes effector proteins such as DspA/E,Eop1, HopPtoCEA, HrpN, HrpW and others (Khan et al., 2012;Malnoy et al., 2012; McNally et al., 2012). One of these effectorsis AvrRpt2EA, a homolog of the AvrRpt2 protein of Pseudomonassyringae (Zhao et al., 2006). AvrRpt2 activates the RPS2 resis-tance gene of Arabidopsis thaliana via the cleavage of RIN4, theguard of RPS2 (Axtell & Staskawicz, 2003; Mackey et al., 2003;Day et al., 2005).

Shoots of Mr5 were inoculated with a number of differentE. amylovora wildtype strains and an avrRpt2EA mutant strainZYRKD3-1 (Zhao et al., 2006) in order to investigate the role ofAvrRpt2EA in the Mr5-E. amylovora host–pathogen interactions.Interestingly, four natural isolates and the avrRpt2EA mutantZYRKD3-1 were found to overcome the resistance of Mr5, sug-gesting a contribution of avrRpt2EA to virulence. Sequencing ofthe avrRpt2EA gene of strains differing in virulence to Mr5revealed a single nucleotide polymorphism (SNP), which resultedin a change in the amino acid sequence correlated with virulence.Artificial shoot inoculations with complemented mutant strainsgave further evidence for the involvement and importance of theSNP in the avrRpt2EA gene in virulence to Mr5 and the probableexistence of a gene-for-gene-relationship in the host–pathogensystemMalus9 robusta 5–E. amylovora.

Materials and Methods

Plant material

We used the following plant material for artificial shoot inocula-tions: 4- to 6-month-old single- and double-shooted branchedplants of Malus9 robusta 5 (Mr5), single-shooted Malus baccata

jackii (accession no. MAL0419), Malus floribunda 821, Malusbaccata (accession no. MAL0004), Malus fusca (accession no.MAL0045), Malus9 domestica Borkh. cvs ‘Idared’, ‘Royal Gala’,‘Prima’ and ‘Pinova’ and the advanced breeding clone 181 of theApple Breeding Collection at the Institute for Breeding Researchon Horticultural and Fruit Crops in Dresden, Saxony, Germany.Graft sticks of each genotype were cut and grafted onto Malling9 (M9) rootstocks. We also used double-grafted plants. Mr5 wasgrafted onto ‘Idared’/M9 interstem/rootstock combinations asscion or as an interstem between ‘Idared’ (as scion) and M9 (asrootstock). All plants were grown in the glasshouse at tempera-tures between 10 and 15°C under a natural photoperiod withextension of day time in spring.

Bacterial strains and fire blight inoculation

Erwinia amylovora (Burrill) Winslow et al. wildtype strains, theavrRpt2EA mutant strain ZYRKD3-1 (Zhao et al., 2006) and thecomplemented mutant strains ZYRKD3-1 (pZYR2-415-S) andZYRKD3-1 (pZYR2-415-C) used for artificial inoculation arelisted in Table 1. E. amylovora strains were denoted according toour strain nomenclature system; in some cases, strains have beengiven multiple designations (Table 1). Each strain received fromdifferent suppliers was recorded separately; for example, strainCUCPB 265 received from France was denoted as Ea3049,whereas strain E2002A, synonym for CUCPB 265, deliveredfrom USA was denoted as Ea395.

Bacteria for use in fire blight inoculation experiments were cul-tured on bouillon glycerin agar at 28°C for 48 h. Antibiotics wereadded to growth media for the mutant ZYRKD3-1 (20 lg ml�1

chloramphenicol) and the complemented mutants containingpZYR2-415-C or pZYR2-415-S (15 lg ml�1 tetracycline). Theplants were inoculated by cutting tips of the upper two leaves withscissors dipped in the bacterial suspension (109 colony-formingunit (cfu) ml�1). Inoculation was performed on shoots with aminimum length of 25 cm. The inoculated plants were incubatedin the glasshouse at 25–27°C (day) and 22°C (night). Necrosis ofeach inoculated shoot was measured 28 d post inoculation (dpi).The length of necrotic shoot tissue relative to the total shoot lengthaveraged over all replicates was recorded as a percentage (%).

Inoculation of double-branched plants

We used double-branched Mr5 (referred as 2xMr5) and Mr5grafted as scion or as interstem to investigate the intercellularspread of the activated resistance signal. The inoculation was per-formed on nine to 17 plants of each combination. The first shootof 2xMr5 plants as well as the resistant shoot (Mr5) of Mr5/‘Id-ared’/M9 and of ‘Idared’/Mr5/M9 plants were inoculated withstrain Ea898 to induce resistance. The second shoot of 2xMr5was inoculated 24 h later with ZYRKD3-1 and with Ea898 inthe case of the scion/interstem/rootstock combination. All shootswere inoculated using scissors dipped in suspensions of the rele-vant bacterial strains. The length of necrotic shoot tissue relativeto the total shoot length averaged over all replicates was recordedas a percentage (%).

No claim to original US government works

New Phytologist� 2013 New Phytologist TrustNew Phytologist (2013) 197: 1262–1275

www.newphytologist.com

NewPhytologist Research 1263

avrRpt2EA-gene sequencing

The avrRpt2EA gene was amplified from single colonies of differ-ent E. amylovora strains by PCR using the primers avrRpt2-1 andavrRpt2-2 (Table 2). The PCR reaction was performed in a 50 llstandard volume consisting of 5 ll dNTPs (2 mM), 2.5 ll

forward and reverse primer (10 pmol), 0.2 ll DreamTaq DNApolymerase (Fermentas, St. Leon-Rot, Germany) and 5 ll 109buffer. DNA sequencing of the avrRpt2EA gene of differentE. amylovora strains was conducted by Eurofins MWG Operon.The primers avrRpt2-1, avrRpt2-2, avrRpt2-5 and avrRpt2-6were used for direct sequencing of the PCR amplification

Table 1 Description of the Erwinia amylovora strains used in this study

Strains (alternative name) Origin Reference AA156 Virulence

GermanyEa7 Pyrus, Brandenburg, 1972 H-J. Schaefer C* �Ea91 Pyrus, Potsdam, 1985 H-J. Schaefer C �Ea115 Crataegus, Eisleben, 1989 K. Richter C �Ea237 Malus, Baden-W€urttemberg, 1994 E. Moltmann CEa250 Malus, Langenweddingen, 1995 D. Beyme C �Ea269 Pyrus, Baden-W€urttemberg, 1996 E. Moltmann C �Ea270 Pyrus, Baden-W€urttemberg, 1996 E. Moltmann C �Ea273 Cydonia, Rieder, 1995 K. Richter C �Ea401 (Ea1/79) Cotoneaster, 1979 W. Zeller C*Ea402 (Ea7/74) Cotoneaster, 1974 W. Zeller C*Ea627 Pyrus, Dresden, 2003 SMUL, Dresden C*Ea662 Pyrus, Tundersleben (Magdeburg), 2003 D. Beyme C*Ea763 Pyrus, Baden-W€urttemberg, 2006 E. Moltmann C*Ea782 Crataegus, Quedlinburg, 2007 K. Richter C*Ea797 Malus, Baden-W€urttemberg, 2007 E. Moltmann CEa815 Malus, Freising, 2008 G. Poschenrieder C*Ea839 Pyrus, Baden-W€urttemberg, 2008 E. Moltmann C*Ea898 (Ea1189) Malus Burse et al. (2004) C*

CanadaEa77 (CFBP 3050, CUCPB 266, E4001A, Ea396, Ea3050) Malus, Ontario W.G. Bonn S +Ea395 (CFBP 3049, CUCPB 265, E2002A, Ea3049) Malus, Ontario, obtained from USA W.G. Bonn S +Ea396 (CFBP 3050, CUCPB 266, E4001A, Ea77, Ea3050) Malus, Ontario, obtained from USA W.G. Bonn S +Ea3049 (CFBP 3049, CUCPB 265, E2002A, Ea395) Malus, Ontario, obtained from France W.G. Bonn S*Ea3050 (CFBP 3050, CUCPB 266, E4001A, Ea77, Ea396) Malus, Ontario, obtained from France W.G. Bonn S*

United StatesEa78 (CFBP 3051, CUCPB 273, Ea3051) Malus, New York, 1980 S.V. Beer C �Ea3051 (CFBP 3051, CUCPB 273, Ea78) Malus, obtained from France C*Ea110 Malus, Michigan A.L. Jones S* +Ea400 (Ea581) Malus, Kearneysville, 1998 T. van der Zwet S +PFB4 (INRA 2653-1) Prunus, Idaho, 1995 McManus & Jones (1995) C*PFB15 (INRA 2655-1) Prunus, Idaho K. Mohan via J. P. Paulin C*

Czech RepublicEa222 (50/92) Cotoneaster, Havlickuv Brod, 1992 V. Kudela C* �Ea717 Crataegus, Slany, 1997 J. Korba C*

New ZealandEa789 Malus, 2007 M. Horner C*

SwitzerlandEa180 Cotoneaster, 1993 ACWW€adenswil C �Ea842 Malus, 2008 ACWW€adenswil C*

PolandEa846 Malus, 1986 P. Sobiczewski C*

FranceEa847 (CFBP 1430) Crataegus, 1973 J.-P. Paulin C*

MutantsZYRKD3-1 Zhao et al. (2006)ZYRKD3-1 (pZYR2-415-S) This studyZYRKD3-1 (pZYR2-415-C) This study

AA156 is the amino acid at position 156, *avrRpt2EA gene was sequenced; virulence was tested onMalus9 robusta 5: +, virulent; �, not virulent.

New Phytologist (2013) 197: 1262–1275 No claim to original US government works


Research

NewPhytologist1264

products. Primer sequences are shown in Table 2. The alignmentof the resulting sequences was performed using MUSCLE soft-ware (Edgar, 2004) and BioEdit software version 7.0.9.0 (Hall,1999). Translation was performed using the EMBOSS Transeqsoftware (Rice et al., 2000).

SNP marker development

Polymerase chain reaction primers 680 (specific for bothalleles), 682 (specific for the S-allele) and 683 (specific for theC-allele) (Table 2) were designed to distinguish strains with theSNP in the avrRpt2EA gene at position 644. The base variationwas included in the critical 3′ end position of the primer toexclude product formation for the mismatch allele. PCR reac-tions were performed in 25 ll volume reactions using amplifi-cation conditions as described previously (Gehring & Geider,2012).

Complementation of ZYRKD3-1

The avrRpt2EA genes from E. amylovora strains differing in theSNP at position 644 (Ea222 and Ea3049) were amplified usingthe primers avrRpt2-4-Bam5′ and avrRpt2-3-Eco5′ (Table 2)containing appropriate restriction sites (BamHI or EcoRI, respec-tively) for further cloning. The amplification products wereligated into the pCR®2.1-TOPO® vector and transformed intoOne Shot® Chemically Competent TOP10 E. coli cells by usingthe TOPO TA Cloning® Kit (Invitrogen). Transformants werescreened on medium containing 20 lg ml�1 kanamycin andfurther verified to contain the plasmid by PCR (primers M13forand M13rev). Plasmid DNA from positive clones was isolatedusing the GeneJET Plasmid Miniprep Kit (Fermentas). The

inserts were excised with BamHI and EcoRI and purified by gelextraction using the QIAquick Gel Extraction Kit (Qiagen). Theinserts were ligated into the expression vector pRK415 (Keenet al., 1988) and transformed into Library Efficiency® DH5aCompetent Cells (Invitrogen). Both vector gene constructs weresequenced to ensure the correct sequence of the cloned fragments.The transformation into different E. amylovora strains was doneby electroporation at 800Ω, 25 lF, and 2.5 kV using theGene Pulser® II Electroporation System (BioRad, Munich,Germany) with 1 mm gap 90 ll cuvettes (VWR, Dresden,Germany).

Expression analysis

Expression of the avrRpt2EA gene was verified by isolation ofbacterial total RNA using the GeneJET RNA Purification Kit(Fermentas) followed by cDNA synthesis with RevertAid ReverseTranscriptase (Fermentas) and transcript content of avrRpt2EAanalyzed by PCR using the SNP primers 680, 682 and 683(Table 2). RNA and DNA were used as controls in the PCRreaction.

RIN4 disappearance assays, expression of AvrRpt2EA inNicotiana benthamiana

avrRpt2EA from Ea3049 and Ea222 were amplified via PCR fromvector pRK415 containing the appropriate allele using primersdesigned to add an N-terminal SalI site (avrRpt2_SalI, Table 2)and a C-terminal hemagglutinin (HA) tag and SacI site(avrRpt2_HA-SacI, Table 2). The native GTG start codon waschanged to ATG to ensure proper translation in Agrobacteriumtumefaciens. The resulting PCR products were subcloned into theTA cloning vector pGEM-T-Easy (Promega) and their sequenceswere verified. Plasmids were digested with the appropriateenzymes and products were ligated into the pMD1 expressionvector. pMD1 plasmids were transformed in A. tumefaciensC58C1 for use in transient expression assays. Infiltration andtransient expression in N. benthamiana using A. tumefaciens wereperformed on 4- to 6-wk-old plants. A. tumefaciens strains weregrown overnight at 28°C on Luria-Bertani (LB) plates containing50 lg ml�1 rifampicin and 25 lg ml�1 kanamycin. A. tumefaciensclones were resuspended in induction buffer (10 mM MES(2-(N-morpholino)ethanesulfonic acid), pH 5.6, 10 mM MgCl2,150 mM acetosyringone), incubated at room temperature andshaking (200 rpm) was performed in the dark for 2 h beforeinfiltration. A. tumefaciens suspensions of single constructs wereinfiltrated at a final concentration of OD600 = 0.8 (OD, opticaldensity). A. tumefaciens pMD1 T7:RIN4 was infiltrated in a 1 : 1ratio (OD600 = 0.4 : 0.4) with each of the AvrRpt2:HA constructsfor disappearance assays. Phenotypes were assessed at the time ofinfiltration and 3 dpi as described by Axtell et al. (2003).

Western blotting

Plant tissue was collected at 1 dpi and frozen immediately inliquid nitrogen. Tissue was ground to a fine white powder and

Table 2 Sequences of primers used in this study

Primer Sequence 5′? 3′ directionTA(°C)

avrRpt2-1 GATCCTGGCCTGAAAGGTGATAC 55avrRpt2-2 AGCGGATAGCCATTCTGGATCAGavrRpt2-51 GTATGCCTGCACCAGAATGCavrRpt2-61 GGGCCTGAAGAGTCATAGAGavrRpt2-4-Bam5′

GGATCCGGTGCTTATCCATGCGGTCGTTC 55

avrRpt2-3-Eco5′

GAATTCCGTGCAGATTGGCGAAGTGATTA

680 GAGCACCAGCCTCGTCAATC 67682 CATAATGGGTCCATGGCGAG683 CATAATGGGTCCATGGCGACM13for AGGGTTTTCCCAGTCACGACGTT 55M13rev GAGCGGATAACAATTTCACACAGGavrRpt2_SalI GCGTCGACATGAAAGTCAGTCATCTCAC 55avrRpt2_HA-SacI

GAGCTCCTAGCGATAGTCAGGAACATCGTATGGGTAATTTTCACTGTATAAC

RIN4_F CCGGAATTCATGGCACAACGTTCACATGTACC 58RIN4_R CGCGGATCCCGATTCAATCTCATTTTCTGCTCC

TA, annealing temperature used for PCR; nonbinding bases are underlined;HA, hemagglutinin.1Sequencing primer.





resuspended in lysis buffer (50 mM Tris, pH 8.0, 1 mMEDTA, 0.1% Triton) containing complete Mini proteaseinhibitor (Roche). Samples were centrifuged at 15.300 g at4 °C and the supernatant retained. Protein was quantifiedusing the Bradford assay and 50 lg total protein was run foreach sample on an 12% sodium dodecyl sulfate polyacrylamidegel electrophoresis (SDS-PAGE) gel. Gels were transferred tonitrocellulose membrane, blocked overnight at 4°C, andprobed with anti-T7-HRP (horseradish peroxidase) conjugatedantibody (Novagen, Madison, WI, USA).

Isolation of RIN4 homologs in Mr5

RIN4 homologs were amplified from genomic DNA andcDNA of Mr5 using primers RIN4_F and RIN4_R (Table 2)containing the restriction site for BamHI and EcoRI. PCRreaction was performed in a 50 ll standard volume consistingof 5 ll dNTPs (2 mM), 2.5 ll forward and reverse primer (10pmol), 0.5 ll Phusion® High-Fidelity DNA Polymerase(Fermentas) and 10 ll 5X HF Buffer. The products weredigested with BamHI and EcoRI and purified by gel extractionusing the QIAquick Gel Extraction Kit (Qiagen). The frag-ments were ligated into expression vector pGADT7 (Clontech,Heidelberg, Germany) and transformed in Library EfficiencyDH5a Competent Cells (Invitrogen). To ensure the correctsequence of the construct, sequencing was done at EurofinsMWG Operon. Translation was performed using theEMBOSS Transeq software (Rice et al., 2000). The alignmentof the obtained protein sequences was performed with BioEditsoftware version 7.0.9.0 (Hall, 1999).

Results

Individual strains of E. amylovora differ in their virulence toMr5

During a period of 3 yr, the virulence of 13 differentE. amylovora strains was examined by artificial shoot inoculationon Mr5, ‘Prima’ and the fire blight resistant breeding clone 181.Two of these strains originated from Cotoneaster, one fromCrategus, one from Cydonia, five from Malus and four from Pyrus(Table 1). Whereas all strains resulted in more or less stronginfection of ‘Prima’ and breeding clone 181, only three strainsEa77 (Ea396 is a synonym of Ea77), Ea395 and Ea400, all iso-lated from Malus, were able to overcome the resistance of Mr5(Fig. 1). The mean necrosis rate of the three strains over the yearswas 67.8% on Mr5 compared with 68.1 and 44.3% on ‘Prima’and 181, respectively. All strains virulent to Mr5 induced stron-ger symptoms on the resistant clone 181 than the other isolates.The situation was different for ‘Prima’, as strains Ea180, Ea222,Ea250 and Ea270 caused higher mean necrosis rates than Ea400.

The avrRpt2EA mutant strain ZYRKD3-1 is virulent to Mr5

Shoots of the fire blight resistant wild apple accessionsM. baccata, M. fusca, Mr5 and the susceptible cv ‘Idared’ wereinoculated with the E. amylovora wildtype strain Ea898 (syno-nym of Ea1189) and its avrRpt2EA mutant strain ZYRKD3-1.Both were virulent to ‘Idared’ with mean shoot necrosis of 69.8%for Ea898 and 90.7% for ZYRKD3-1, but avirulent toM. baccata and M. fusca. Using the wildtype strain Ea898, no

Fig. 1 Evaluation of virulence in different Erwinia amylovora strains.Malus9 robusta 5 (Mr5), ‘Prima’ and the advanced breeding clone 181 wereinoculated with 13 different E. amylovora strains (Ea77 and Ea396 are both synonyms of E4001a, but were received from different sources; Table 1).Percentage lesion length : length of necrotic shoot / shoot length *100%, on average 16 shoots per strain and clone were inoculated during a 3 yrexperiment. Error bars, + SD.



Research

NewPhytologist1266

symptoms were detectable on Mr5, but the avrRpt2EA mutantinduced necrosis with a mean length of 52.4% (Figs 2, 3).

Fig. 2 Virulence of the Erwinia amylovorawildtype strain Ea898 and theavrRpt2EA mutant strain ZYRKD3-1. Shoots of the fire blight-susceptibleapple cv ‘Idared’ and the three resistant wild apple accessionsMalus9 robusta 5 (Mr5),Malus fusca,Malus baccata were inoculatedwith both E. amylovora strains (109 colony-forming units (cfu) ml�1).Percentage lesion length: length of necrotic shoot / shoot length*100% of 16 inoculated shoots per strain and clone on average. Errorbars, + SD.

Fig. 3 Shoots ofMalus9 robusta 5 (Mr5) infected with the wildtype strainEa898 (left) and the avrRpt2EA mutant strain ZYRKD3-1 (right).Photographs were taken 28 d after inoculation.

Fig. 4 Double-branched plants ofMalus9 robusta 5 (Mr5) (top) and scion–interstem combinations Mr5/’Idared’ (middle) and ‘Idared’/Mr5(bottom) were inoculated on the Mr5 shoot with the avirulent strain Ea898to induce a resistance signal (Idared, red arrow; Mr5, blue arrow). Twenty-four hours later, the second shoot was inoculated with the avrRpt2EAmutant strain ZYRKD3-1 (double-branched plants of Mr5 (left)) or Ea898(‘Idared’ of the scion–interstem combinations (middle and right)).Percentage lesion length: length of necrotic shoot / shoot length *100%of 16 inoculated shoots per strain and clone on average. Errorbars, + SD.





Fire blight resistance of Mr5 is not systemic

One shoot of double-branched plants of Mr5 was inoculatedwith Ea898, which was avirulent to Mr5. No shoot necrosiswas detectable on the first shoot. The second shoot wasinoculated with avrRpt2EA mutant ZYRKD3-1 24 h after theinitial inoculation. As shown in Fig. 4, the mutant ZY-RKD3-1 was virulent to Mr5 when applied to the secondbranch. An average mean length of shoot necrosis of 42%was detected.

Scion/interstem combinations of Mr5/‘Idared’ and ‘Idared’/Mr5 were also tested for systemic-acquired resistance inresponse to inoculation with Ea898 wildtype. Ea898 wasapplied to Mr5 and, 24 h later, ‘Idared’ was inoculated usingthe same strain. No symptoms were detected on Mr5, whereas‘Idared’ showed shoot necrosis of 72% (Mr5/Idared) and 98%(Idared/Mr5) (Fig. 4).

Sequencing of the avrRpt2EA gene of various strains ofE. amylovora

The avrRpt2EA gene of 22 E. amylovora strains of different ori-gins was amplified from genomic DNA by PCR using theprimers avrRpt2-1 and avrRpt2-2 and sequenced. The nucleicacid sequence of the avrRpt2EA gene (669 bp) was identical for19 strains. Three strains (Ea110, Ea3049 and Ea3050) con-tained a single nucleotide deviation in which guanine atposition 644 of the DNA sequence was substituted by cytosine(G644C). This mutation resulted in a change of the amino acidsequence from cysteine at position 156 (C-allele) to serine(C156S). A partial alignment of the AvrRpt2EA amino acidsequences of the 22 E. amylovora strains is shown in Fig. 5.Strains Ea3049 (Ea395), Ea3050 (Ea396) and Ea110, all ofwhich contained the C156S substitution (S-allele), were virulentto Mr5 (Figs 1, 6).

SNP marker-based detection of additional strainscontaining the single base mutation

Twenty-two E. amylovora strains used for sequencing of theavrRpt2EA gene and 53 additional strains were tested to distin-guish strains with and without the SNP in the avrRpt2EA gene bycolony PCR using the primer combination 680–682 for theguanine variant, and 680–683 for the cytosine variant. Primers682 and 683 contain the SNP base as the discriminating base atthe 3′ end. Under stringent PCR conditions, a PCR product wasonly obtained for the respective SNP variant. Identical resultswere obtained by PCR and sequencing of the 22 strains (Fig. 5and Supporting Information, Fig. S1). This indicates that theappropriate primers are a useful tool for fast screening of strainsdiffering in the SNP at position 644. To summarize, 70E. amylovora isolates contained guanine at nucleotide position644, whereas five strains contained cytosine (Tables 1, Fig. S1). Itshould be noted that most E. amylovora strains also recently iso-lated in the Ontario region of Canada carried the C-allele such asEa CaV8, CaV15, Tp3 or Tp9 (Table S1).

Development of complemented mutant strains

The two alleles of the avrRpt2EA gene were used for complemen-tation of the mutant strain ZYRKD3-1. The gene was amplifiedfrom the E. amylovora strains Ea222 (containing the C-allele) andEa3049 (containing the S-allele) and cloned into the expressionvector pRK415 as described. The resulting plasmids were desig-nated pZYR2-415-C (containing the C-allele) and pZYR2-415-S(containing the S-allele). The plasmids were transferred to theavrRpt2EA mutant ZYRKD3-1 to generate the complementedmutant strains ZYRKD3-1 (pZYR2-415-S), referred to asZYRKD-415-S, and ZYRKD3-1 (pZYR2-415-C), referred to asZYRKD-415-C. Next, to confirm the generation of the desiredcomplemented strains, the expression of the avrRpt2EA gene was

....|....| ....|....| ....|....| ....|....| ....|....| ....|....| 125 135 145 155 165 175

Ea7 QQREDVLRLM RNENLAEVSL PESRQFSANE LGNLLCRHGP IMFGWQTPAG SWHMSVLTGI Ea110 .......... .......... .......... .....S.... .......... .......... Ea222 .......... .......... .......... .......... .......... .......... Ea401 .......... .......... .......... .......... .......... .......... Ea402 .......... .......... .......... .......... .......... .......... Ea627 .......... .......... .......... .......... .......... .......... Ea662 .......... .......... .......... .......... .......... .......... Ea717 .......... .......... .......... .......... .......... .......... Ea763 .......... .......... .......... .......... .......... .......... Ea782 .......... .......... .......... .......... .......... .......... Ea789 .......... .......... .......... .......... .......... .......... Ea815 .......... .......... .......... .......... .......... .......... Ea839 .......... .......... .......... .......... .......... .......... Ea842 .......... .......... .......... .......... .......... .......... Ea846 .......... .......... .......... .......... .......... .......... Ea847 .......... .......... .......... .......... .......... .......... Ea898 .......... .......... .......... .......... .......... .......... Ea3049 .......... .......... .......... .....S.... .......... .......... Ea3050 .......... .......... .......... .....S.... .......... .......... Ea3051 .......... .......... .......... .......... .......... .......... EaPFB4 .......... .......... .......... .......... .......... .......... EaPFB15 .......... .......... .......... .......... .......... ..........

Fig. 5 Partial alignment of derived amino acid sequences of the effector protein AvrRpt2EA from different Erwinia amylovora strains. The highlightedstrains contain a single substitution of cysteine by serine at position 156 (C156S).



Research

NewPhytologist1268

tested by reverse transcriptase PCR (RT-PCR) on cDNA.E. amylovora wildtype strains (Ea898, Ea110 and Ea3050), theavrRpt2EA mutant ZYRKD3-1, and the complemented strainsZYRKD-415-S and ZYRKD-415-C were compared. RNAwas included as negative control. As shown in Fig. S2, all con-structs were validated as being complemented with the desiredalleles.

The effect of the single base mutation onto virulence

An inoculation experiment was performed using the E. amylovorawildtype strains Ea898, carrying the C-allele, as well as Ea110 andEa3050, both carrying the S-allele, in order to study the virulenceeffect of the SNP in the avrRpt2EA gene on apple shoots. Further-more, the avrRpt2EA mutant ZYRKD3-1 and the complementedstrains ZYRKD-415-S and ZYRKD-415-C were included. Thesestrains were used for inoculation of several fire blight-resistantwild apple genotypes M. baccata jackii, M. floribunda 821, Mr5,M. baccata and M. fusca. Three fire blight-susceptible Malus9domestica cvs ‘Idared’, ‘Pinova’ and ‘Royal Gala’ were used as con-trol genotypes. ‘Pinova’, ‘Royal Gala’ and M. baccata jackii werenot tested with the complemented mutant ZYRKD-415-C, as thenumber of successfully grafted plants of these genotypes was toolow. The results obtained in this experiment are shown in Fig. 6.As shown, all three apple cultivars were susceptible to the appliedstrains, while, by contrast, none to very little necrosis was detectedon M. baccata, M. floribunda 821 and M. fusca. On bothM. baccata jackii and Mr5, considerable necrosis was detectedafter inoculation with ZYRKD3-1, ZYRKD-415-S and the two

S-allele strains Ea110 and Ea3050. Neither the wildtype strainEa898 nor the complemented mutant strain ZYRKD-415-Ccould overcome the resistance (Fig. 6) of Mr5, indicating a possi-ble role for avrRpt2EA in resistance activation.

Expression of AvrRpt2EA in N. benthamiana

The two alleles of the avrRpt2EA gene, the P. syringae effectorAvrRpt2, and the catalytically inactive P. syringae AvrRpt2 muta-nt, AvrRpt2 C122A and T7:RIN4 as negative controls were tran-siently expressed using A. tumefaciens-mediated transformation inN. benthamiana in order to test whether the avrRpt2EA alleles areable to cause cell death. As shown in Fig. 7, both alleles ofE. amylovora AvrRpt2EA, the S-allele from strain Ea3049(AvrRpt2EA 3049:HA) and the C-allele from Ea222 (AvrRpt2EA222:HA) induced cell death in N. benthamiana 3 d after infiltra-tion. The same reaction was induced by the P. syringae effectorAvrRpt2 (PsAvrRpt2:HA), whereas infiltration with the negativecontrols PsAvrRpt2:HA C122A and T7:RIN4 did not elicit celldeath (Fig. 7). These data suggest recognition of the avirulenceactivity of AvrRpt2EA, possibly mediated in a manner similar tothat previously observed in A. thaliana (Axtell & Staskawicz,2003).

AvrRpt2EA coexpression with Arabidopsis RIN4 results inpartial elimination in a catalytically dependent manner

Previous data have demonstrated that P. syringae AvrRpt2 cleavesRIN4, resulting in the elimination of RIN4; this mechanism is

Fig. 6 Virulence of the Erwinia amylovorawildtype strains Ea898, Ea110 and Ea3050, the avrRpt2EA mutant strain ZYRKD3-1 as well as the complementedmutant strains ZYRKD3-1 (pZYR2-415-S) and ZYRKD3-1 (pZYR2-415-C) at 109 cfu ml�1. Percentage lesion length: length of necrotic shoot / shoot length*100% of 16 inoculated shoots per strain and clone on average. Error bars, + SD. *, ‘Pinova’,M. baccata jackii and ‘Royal Gala’ were not included intoevaluations using strain ZYRKD3-415-C.





hypothesized to release the negative regulation RIN4 imposes onthe resistance (R) protein RPS2 (Day et al., 2005). To determineif coexpression of AtRIN4 and AvrRpt2EA results in the elimina-tion of RIN4 in a catalytically dependent manner, we expressedAtRIN4 and AvrRpt2EA in N. benthamiana and monitored thecleavage (i.e. disappearance) of AtRIN4. As shown in Fig. 8,wildtype P. syringae AvrRpt2:HA (PsAvrRpt2:HA) coexpressedwith AtRIN4 resulted in the complete elimination of RIN4,while the catalytically inactive PsAvrRpt2:HA C122A did not.Interestingly, we observed the partial elimination of T7-taggedAtRIN4 by AvrRpt2EA:HA 3049, suggesting some degree of

conservation in both substrate (i.e. RIN4) recognition and activ-ity of AvrRpt2EA with P. syringae AvrRpt2. On the other hand,the coexpression of AvrRpt2EA:HA 222 with AtRIN4 seemed tohave no effect on the abundance of RIN4 (Fig. 8).

Isolation of RIN4 sequences from Mr5

The Arabidopsis RIN4 gene is part of a large gene family ofnitrate-induced (NOI) domain-containing proteins, many ofwhich are capable of being cleaved by the P. syringae effector Av-rRpt2 (Afzal et al., 2011). To determine if AtRIN4 homologsexist in apple, thereby supporting our hypothesis that AvrRpt2EArecognition and activity are transduced in a similar fashion to thatin Arabidopsis, we sought to identify an MrRIN4 homolog. Asshown in Fig. 9, we were successful in identifying two nucleicacid sequences of putative RIN4 homologs in the genome ofMr5 and assigned them to the homolog chromosomes 5 and 10of the Golden Delicious genome (Velasco et al., 2010). Thededuced protein sequences differ in 17 amino acids and share anoverall amino acid identity of 92%. Additionally, we found thatthe RIN4 sequence on chromosome 10 has a deletion at position98–99, resulting in a deletion of two amino acids. MrRIN4-1and MrRIN4-2 are 241 and 239 amino acids in total, respec-tively. An alignment of the A. thaliana RIN4 andMrRIN4-1 andMrRIN4-2 is shown in Fig. 9. Sequence scanning of the twosequences identified two widely conserved areas, one in theN-terminal and the other in the C-terminal region. Both containthe cleavage sites of AvrRpt2 from P. syringae pv. tomato(Chisholm et al., 2005).

Discussion

The crabapple species Malus9 robusta (Carri�ere) Rehder (syn-onyms Malus microcarpa var. robusta Carri�ere, Pyrus baccata var.cerasifera Regel) is referred to as a hybrid between the twoprimary wild apple species M. prunifolia and M. baccata

Fig. 7 Infiltration of Nicotiana benthamiana with Agrobacterium

tumefaciens suspensions of the double constructs, containing the alleles ofAvrRpt2EA (S-allele, AvrRpt2EA 3049:HA (hemagglutinin); and C-allele,AvrRpt2EAa 222:HA), the Pseudomonas syringae AvrRpt2 (PsAvrRpt2:HA)or the catalytically inactive P. syringae AvrRpt2 mutant, PsAvrRpt2:HAC122A and RIN4. As control, RIN4 was separately expressed. Images werecollected at the time of infiltration and at 3 d post inoculation (dpi).

Fig. 8 Disappearance assay via western blot with T7Rin4 antibody. Bothalleles of AvrRpt2EA (S-allele, AvrRpt2EAa 3049:HA; and C-allele,AvrRpt2EAa 222:HA), the Pseudomonas syringae AvrRpt2 (PsAvrRpt2:HA)and the catalytically inactive P. syringae AvrRpt2 mutant, PsAvrRpt2:HAC122A, were transiently coexpressed via Agrobacterium tumefacienswithRIN4 in Nicotiana benthamiana. RIN4 was also separately expressed ascontrol. Ponceau staining of the blot as shown in the lower panel confirmsequal protein loading.



Research

NewPhytologist1270

(Jefferson, 1970; Ignatov & Bodishevskaya, 2011). One of themost famous accessions of this species is selection M.9 robustaNo. 5 (Mr5), which was grown from seed obtained in 1927 fromRussia through arrangements with the Arnold Arboretum(Jefferson, 1970). Mr5 has been described as tolerant to commonviruses of eastern Canada, resistant to collar rot, woolly appleaphid (Watkins & Spangelo, 1970), powdery mildew (Wan &Fazio, 2011) and fire blight (Watkins, 1971; Van Der Zwet &Keil, 1974). Differential interaction between Mr5 and variousE. amylovora strains were reported by Norelli & Aldwinckle(1986), who inoculated 25 apple cultivars, including Mr5, withE. amylovora strains Ea273 (Ea78 and Ea3051 in the author data-base) and Ea266 (Ea77, Ea396 and Ea3050 in the author data-base). Mr5 was resistant to Ea273 but susceptible to Ea266. TheCanadian isolate Ea3049 could also overcome the resistance ofMr5 and resulted in 97% average shoot necrosis (Peil et al.,2011). In the present study, two additional E. amylovora isolatesvirulent to Mr5 have been identified, Ea400 and Ea110 (Figs 1,6). The results obtained by Norelli & Aldwinckle (1986), Peilet al. (2011) and the present study demonstrate that the resistanceof Mr5 to fire blight is highly strain-specific. Furthermore, it wasshown that all E. amylovora strains able to overcome the resis-tance of Mr5 were highly virulent to susceptible and moderatelyresistant apple genotypes as well (Fig. 1).

In 2006, Zhao et al. identified an analog to the effector proteinAvrRpt2 from P. syringae pv. tomato in the genome ofE. amylovora and annotated it as AvrRpt2EA. Inoculation ofimmature pear fruits with an avrRpt2EA deletion mutant(ZYRKD3-1) resulted in reduction of disease symptoms, indicat-ing that AvrRpt2EA is a potential virulence factor in the

host–pathogen system pear–E. amylovora. To study the role ofAvrRpt2EA in the Malus9 robusta–E. amylovora host–pathogenrelationship, the fire blight resistant wild apple genotypesM. baccata, M. fusca, Mr5 and the susceptible apple cv ‘Idared’were inoculated with the wildtype strain Ea898 and ZYRKD3-1.Results obtained on ‘Idared’ could not support the hypothesis ofZhao et al. (2006), that avrRpt2EA seems to act as a virulence genein susceptible cultivars, because the deletion mutant caused a sim-ilar number of symptoms as the wildtype strain. This indifferentreaction was confirmed by inoculation of the susceptible applecvs ‘Royal Gala’ and ‘Pinova’, indicating that avrRpt2EA is notindispensable for a strong infection of apple cultivars. The resultsobtained on Mr5 were completely different. Whereas the wild-type strain Ea898 was not able to infect Mr5, the resistance ofMr5 was broken by the mutant strain which caused a percentageshoot necrosis of > 50% (Figs 2, 3). These results suggest that Av-rRpt2EA acts as an avirulence factor in the host–pathogen rela-tionship Mr5 and E. amylovora. Interestingly, the other tworesistant wild apple accessions, M. baccata and M. fusca, showedresistance to both the wildtype and the mutant strain, suggestinga different mode of resistance forM. baccata andM. fusca.

The fact that the deletion of the avrRpt2EA gene ofE. amylovora results in successful infection of Mr5 is a strongindication of a gene-for-gene relationship in the host–pathogensystem Mr5–E. amylovora. In general, plants recognize pathogeneffectors, also called avirulence proteins, by resistance proteinsand activate a defense cascade. This mode of interaction was firstdescribed by Flor (1971) and later supplemented by the guardmodel (Van Der Biezen & Jones, 1998; Dangl & Jones, 2001),explaining indirect interactions where the avirulence gene is

10 20 30 40 50....|....| ....|....| ....|....| ....|....| ....|....|

A. thaliana 1 MA-RSNVPKF GNWEAEENVP YTAYFDKARK TRAP-GSKIM NPNDPEYNSDMr5_RIN4_Chr5 1 MAQRSHVPKF GNWEGEESVP YTAYFDKARK DRTGVGGKMI NPNDPQENPDMr5_RIN4_Chr10 1 MAQRSHVPKF GNWEGEESVP YTAYFDKARK GRTGVGGKMI NPNDPEENPD

60 70 80 90 100....|....| ....|....| ....|....| ....|....| ....|....|

A. thaliana 49 SQSQ-APPHP PSSRTKP-EQ VDTVRRSREH MRSREESELK QFGDAG----Mr5_RIN4_Chr5 51 ILSDISASSP PKVRPEPEKP VHEQRRSRED NDLRFANSPA QRRNSGESAHMr5_RIN4_Chr10 51 ILSDTSASSP PKVRPEPGKP VHERRRSRED NDLRFANSPA QRRSSGE--H

110 120 130 140 150....|....| ....|....| ....|....| ....|....| ....|....|

A. thaliana 92 ------GSSN EAANKRQGRA SQNNSYD-NK SPLHKN---- -----SYDG-Mr5_RIN4_Chr5 101 QPSRGRGVSS GETHRRPARP SAGSENSVER SPLHRNARVT GRDSPSWEGKMr5_RIN4_Chr10 99 QPNRGRGVSS GETHRRPARQ SAGSENSVER SPLHRNARVS GRDSPSWEGK

160 170 180 190 200....|....| ....|....| ....|....| ....|....| ....|....|

A. thaliana 125 ----TGKSRP KPTNLRA-DE SPEKVTVVPK FGDWDENNPS SADGYTHIFNMr5_RIN4_Chr5 151 ASYETSHGTP GRSRLKPRDE SPEKGAAVPK FGEWDENDPA SADGFTHIFNMr5_RIN4_Chr10 149 ASYESSHGTP ARSRLKPRDE SPEKGAAVPK FGEWDENDPA SADGFTHIFN

210 220 230 240....|....| ....|....| ....|....| ....|....| ...

A. thaliana 171 KVREERSSGA NVSGSSRTPT HQSSRN--PN NTSSCCCFGF GGKMr5_RIN4_Chr5 201 KVREERAG-- KVPGTPSQPS YQDARRQGSN DSAKSCCFPW SRKMr5_RIN4_Chr10 199 KVREEKAG-- KAPGTPSHPS YQDARKQGSN DSAKCCCFPW GRK

Fig. 9 Protein alignment of RIN4 from Arabidopsis thaliana and Mr5 from chromosome 5 (Mr5_RIN4_Chr5) and 10 (Mr5_RIN4_Chr10). The arrowsindicate the cleavage sites of AvRpt2 from Pseudomonas syringae pv. tomato.





targeted/recognized by a guard. Effectors such as the AvrRpt2EAprotein are translocated into plant cells by T3SSs (Collmer et al.,2002). Three T3SSs which are encoded by so-called pathogenic-ity islands (PAIs) are known in E. amylovora (He et al., 2004; Oh& Beer, 2005). The hypersensitive response and pathogenicity(Hrp) T3SS PAI1 is essential for virulence of fire blight(Bellemann & Geider, 1992; reviewed in Oh & Beer, 2005),whereas the PAI2 and PAI3 T3SSs are dispensable for virulence(Zhao et al., 2009). Besides avrRpt2EA, four more potential effec-tor genes have been identified in the genome of E. amylovora:eop1 (orfB or eopB), eop3 (hopX1Ea), dspA/E and hopPtoCEa

(McNally et al., 2012). DspA/E is known as essential pathogenic-ity factor, as mutants were not able to induce disease symptomsor to grow on host plants (Barny et al., 1990; Gaudriault et al.,1997; Bogdanove et al., 1998). Deletion mutants of eop1, eop3and hopPtoCEa were also tested on immature pear fruits but didnot differ in virulence from the wildtype strain (Zhao et al.,2005; Asselin et al., 2011).

The apparent central function of AvrRpt2EA in the defensemechanism of Mr5 gave cause for further investigations. For thatreason, the avrRpt2EA gene of 22 E. amylovora strains (virulentand avirulent to Mr5) was sequenced and the amino acidsequences were deduced. Only one SNP was detected among the22 sequences that resulted in an amino acid exchange at position156 from cysteine to serine (C156S). SNP analysis showed thatonly five out of 75 strains encoded serine at position 156(Tables 2, Fig. S1). Only strains containing serine on position156 were able to overcome the resistance of Mr5, whereas strainswith cysteine at position 156 were not. Therefore, both were con-sidered as different alleles (C-allele and S-allele). The ability ofcysteine to form disulfide bridges could result in a differenttertiary structure for the two alleles, thereby modifying therecognition process in Mr5. Results obtained for the P. syringaeAvrRpt2 protein in the A. thaliana–P. syringae host–pathogensystem support the hypothesis that position 156 of theAvrRpt2EA protein seems to be important for avirulence activity(Lim & Kunkel, 2004).

ZYRKD3-1 was complemented with the C156 and the S156avrRpt2EA allele driven by its own promoter to verify whether theC156S substitution affects the avirulence activity. The comple-mentation with the C-allele should result in the recovery of resis-tance in Mr5 if there is a gene-for-gene relationship. On theother hand, ZYRKD3-1 complemented with the S-allele shouldovercome the resistance of Mr5. RT-PCR of the complementedstrains showed that both alleles were expressed (Fig. S2). Viru-lence analysis was done with the wildtype strain Ea898 (carryingthe C-allele), ZYRKD3-1, both complemented versions of ZY-RKD3-1 and strains Ea110 and Ea3050 (both carrying the S-allele) on ‘Pinova’, M. baccata jackii, M. floribunda 821,M. baccata,M. fusca, Mr5, ‘Idared’ and ‘Royal Gala’. The mutantstrain complemented with the C-allele was not virulent to Mr5,whereas the mutant strain complemented with the S-alleleresulted in an average shoot necrosis of 70%, thus breaking downresistance. These results confirm a gene-for-gene relationship inthe pathogen system Mr5 and E. amylovora.

The wild apple accessions of M. fusca, M. floribunda andM. baccata are highly resistant to all tested strains, indicatinganother resistance mechanism. M. baccata jackii has shown asimilar pattern to that of Mr5, the mutant strain, as all strainscarrying the S-allele were able to overcome the resistance ofM. baccata jackii, indicating a similar mechanism. SinceM.9 robusta is a hybrid between M. prunifolia and M. baccata,this is not surprising.

The demonstrated gene-for-gene relationship and the highdegree of similarity between the two effector proteins, AvrRpt2from P. syringae pv. tomato and AvrRpt2EA from E. amylovora,support the hypothesis of a resistance mechanism in Mr5 similarto the one in A. thaliana. AvrRpt2 is activated in the plant hostcytosol by ROC1, a cyclophilin, via prolyl isomerization (Coakeret al., 2006) and is able to cleave RIN4 (RPM1 interacting pro-tein 4). RIN4 is physically associated with RPS2. The cleavage ofRIN4 results in the activation of RPS2 (Resistance to P. syringaeprotein 2) and thereby in the activation of the pathogen defenseof the plant (Mackey et al., 2002; Axtell & Staskawicz, 2003;Kim et al., 2005).

We were also able to show in a coexpression assay of bothAvrRpt2EA alleles with A. thaliana RIN4 in N. benthamiana thatthe S-allele was capable of partial elimination of RIN4, whereasthe C-allele had no effect on the abundance of the RPS2 target.Two alleles of the avrRpt2EA gene were transiently expressed viaA. tumefaciens in N. benthamiana in order to test whether theyare able to cause cell death. Similar to P. syringae AvrRpt2, bothalleles of E. amylovora AvrRpt2EA elicited a cell death-likeresponse in N. benthamiana. These data are in agreement withthe hypothesis that, like that of previous studies (Lim & Kunkel,2004; Chisholm et al., 2005), RIN4 is not the only target of Av-rRpt2EA. Indeed, similar results were obtained by Lim & Kunkel(2004) and Axtell et al. (2003), who demonstrated that mutatedavrRpt2 strains were also unable to eliminate RIN4 but still viru-lent to the host.

In addition to AvrRpt2, RIN4 is known to interact with the ef-fectors AvrRpm1 and AvrB (Mackey et al., 2003), which in turnactivate resistance through a second coiled coil-nucleotide-bind-ing site-leucine rich repeat (CC-NBS-LRR) resistance gene,RPM1 (Grant et al., 1995). Thus, RIN4 appears to be a multi-functional target for the regulation and activation of gene-for-gene resistance to a variety of phytopathogenic effector proteins.A putative homolog of AtRIN4 was identified in the transcrip-tome of unchallenged Malus9 robusta 5 (Fahrentrapp, 2012).Two nearly identical RIN4-like genes on the homologous applechromosomes 5 and 10 have been detected in further investiga-tions (Fig. 9). Furthermore, a putative fire blight resistance gene,FB_Mr5 from Mr5, located at the QTL on LG3 (Peil et al.,2007) was recently published, showing a certain similarity toRPS2 of A. thaliana (Fahrentrapp et al., 2012). This CNL (CC-NBS-LRR) gene was recently identified using a map-based clon-ing approach (Fahrentrapp et al., 2011). Parravicini et al. (2011)could identify two genes at the fire blight resistance locus of ‘E-vereste’, showing high homology to the Pto/Prf complex, indicat-ing a similar resistance mechanism.



Research

NewPhytologist1272

This study gives a first indication of how fire blight resis-tance could function in the pathosystem Malus9 robusta 5 andE. amylovora. We demonstrated that AvrRpt2EA, an analog tothe effector protein AvrRpt2 from P. syringae pv. tomato, playsan important role in the resistance mechanism of Mr5 andthat it is part of a gene-for-gene relationship. The existence ofa homologous gene of RIN4 and an Rps2-like resistance genein the genome of Mr5 assumes a similar resistance mechanismto the one in A. thaliana. This hypothesis is supported by thefact that AvrRpt2EA is able to cleave RIN4 in Arabidopsis. AsAvrRpt2EA is not essential for virulence on Malus types otherthan Mr5, it is of interest that the respective gene is not foundin other closely related Erwinia species. While avrRpt2EA ishighly conserved among the E. amylovora analyzed here, andeven those present in various Rubus isolates (see Table S1), nohomolog is present even in closely related Erwinia species.While synteny of the respective genomic region is well con-served in E. amylovora, no similarity to the avrRpt2EA sequenceis found in the pear blight pathogen E. pyrifoliae, and the non-pathogenic E. billingiae and E. tasmaniensis. It can be con-cluded that avrRpt2EA is a recently acquired gene in anevolutionary context.

Further investigations will reveal whether a cleavage of Mr5Rin4 by the E. amylovora effector AvrRpt2EA is dependent on therespective allele. The functionality of the candidate resistancegene FB_Mr5 has to be proved in a complementation assay. Thehypothesis of a similar system as described for A. thaliana–P. syringae could be confirmed by yeast two-hybrid experimentsto examine the possible interactions of Fb_Mr5, MrRIN4 andAvrRpt2EA. Another interesting task would be to investigate theresistance mechanism of the two highly resistant wild speciesM. fusca and M. baccata, which are obviously different from theone of Mr5.

Conclusions

The resistance of the wild apple species Malus9 robusta 5 (Mr5)to E. amylovora is highly strain-specific and can be broken onlyby a few strains originating from North America or the strain iso-lated from loquat in Israel. Furthermore, an avrRpt2EA deletionmutant, ZYRKD3-1 (Zhao et al., 2006), was able to overcomethe resistance of Mr5, which gave cause for further investigations.Subsequently, 22 avrRpt2EA genes from different E. amylovorastrains were sequenced and compared. Only one SNP has beenidentified which resulted in an exchange of cysteine to serine atposition 156 in the amino acid sequence. The C-allele wasresponsible for the diverging resistance responses, because onlystrains carrying the S-allele were able to overcome the resistanceof Mr5. Inoculation of Mr5 with the mutant ZYRKD3-1complemented with the C- or S-allele resulted in receiving orbreaking resistance and gave evidence of a gene-for-gene relation-ship. The defense mechanism appears to be similar to the one inA. thaliana triggered by the homolog effector AvrRpt2. In a dis-appearance assay, the S-allele of AvrRptEa

A was able to cleavenearly all of the RIN4 of A. thaliana. Besides RIN4, an RPS2-likegene could also be identified in the genome of Mr5. In contrast

to Arabidopsis (Cameron et al., 1994), the resistance found inMr5 is not systemic.

Acknowledgements

We thank John L. Norelli (USDA-ARS-AFRS, Kearneysville,WV, USA) for sharing E. amylovora strains and Marina Gernoldfor part of the PCR assays. This work was financially supportedby the Deutsche Forschungsgemeinschaft (DFG) projectnumbers AOBJ574457 and AOBJ577770 and by MichiganAgBioResearch.

References

Asselin JE, Bonasera JM, Kim JF, Oh C-S, Beer SV. 2011. Eop1 from a Rubusstrain of Erwinia amylovora functions as a host-range limiting factor.

Phytopathology 101: 935–944.Afzal AJ, da Cunha L, Mackey D. 2011. Separable fragments and membrane

tethering of Arabidopsis RIN4 regulate its suppression of PAMP-triggered

immunity. Plant Cell 23: 3798–3811.Axtell MJ, Chisholm ST, Dahlbeck D, Staskawicz BJ. 2003. Genetic and

molecular evidence that the Pseudomonas syringae type III effector proteinAvrRpt2 is a cysteine protease.Molecular Microbiology 49: 1537–1546.

Axtell MJ, Staskawicz BJ. 2003. Initiation of RPS2-specified disease resistance in

Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112:369–377.

Barny MA, Guinebreti�ere MH, Marc�ais B, Coissac E, Paulin JP, Laurent J.

1990. Cloning of a large gene cluster involved in Erwinia amylovoraCFBP1430 virulence.Molecular Microbiology 4: 777–786.

Bellemann P, Geider K. 1992. Localization of transposon insertions in

pathogenicity mutants of Erwinia amylovora and their biochemical

characterization. Journal of General Microbiology 138: 931–940.Bogdanove AJ, Bauer DW, Beer SV. 1998. Erwinia amylovora secretes DspE, a

pathogenicity factor and functional AvrE homolog, through the Hrp (Type III

secretion) Ppthway. Journal of Bacteriology 180: 2244–2247.Bogs J, Bruchm€uller I, Erbar C, Geider K. 1998. Colonization of host plants by

the fire blight pathogen Erwinia amylovoramarked with genes for

bioluminescence and fluorescence. Phytopathology 88: 416–421.Burse A, Weingart H, Ullrich MS. 2004. The phytoalexin-inducible

multidrug efflux pump AcrAB contributes to virulence in the fire blight

pathogen, Erwinia amylovora. Molecular Plant–Microbe Interactions 17:43–54.

Cameron RK, Dixon RA, Lamb CJ. 1994. Biologically induced systemic

acquired resistance in Arabidopsis thaliana. Plant Journal 5: 715–725.Chisholm ST, Dahlbeck D, Krishnamurthy N, Day B, Sjolander K, Staskawicz

BJ. 2005.Molecular characterization of proteolytic cleavage sites of the

Pseudomonas syringae effector AvrRpt2. Proceedings of the National Academy ofSciences, USA 102: 2087–2092.

Coaker G, Zhu G, Ding Z, Van Doren SR, Staskawicz B. 2006. Eukaryotic

cyclophilin as a molecular switch for effector activation.Molecular Microbiology61: 1485–1496.

Collmer A, Lindeberg M, Petnicki-Ocwieja T, Schneider DJ, Alfano JR.

2002. Genomic mining type III secretion system effectors in Pseudomonassyringae yields new picks for all TTSS prospectors. Trends in Microbiology10: 462–469.

Dangl JL, Jones JDG. 2001. Plant pathogens and integrated defence responses to

infection. Nature 411: 826–833.Day B, Dahlbeck D, Huang J, Chisholm ST, Li D, Staskawicz BJ. 2005.

Molecular basis for the RIN4 negative regulation of RPS2 disease resistance.

Plant Cell 17: 1292–1305.Denning W. 1794.On the decay of apple trees. New York Society for thePromotion of Agricultural Arts and Manufacturers Transaction 2: 219–222.

Edgar RC. 2004.MUSCLE: multiple sequence alignment with high accuracy and

high throughput. Nucleic Acids Research 32: 1792–1797.





Esau K. 1965. Esau’s plant anatomy: meristems, cells, and tissues of the plant body:their structure, function, and development. New York, USA: John Wiley & Sons.

Fahrentrapp J. 2012. Fire blight resistance ofMalus 9 robusta 5. PhD thesis,

ETH Zurich, Zurich, Switzerland.

Fahrentrapp J, Broggini GAL, Gessler C, Peil A, Kellerhals M, Malnoy M,

Richter K. 2011. Fine mapping of fire blight resistance locus inMalus 9robusta 5 on linkage group 3. Acta Horticulturae (ISHS) 896: 243–244.

Fahrentrapp J, Broggini GAL, Kellerhals M, Peil A, Richter K, Malnoy M,

Gessler C. 2012. A candidate gene for Fire Blight resistance inMalus 9 robusta5 is coding for a CC-NBS-LRR. Tree Genetics and Genome. doi 10.1007/s11295-012-0550-3.

Fazio G, Wan Y, Russo NL, Aldwinckle HS. 2008. Investigations on the

inheritance of strain specific resistance to Erwinia amylovora in an apple

rootstock segregating population. Acta Horticulturae (ISHS) 793: 331–335.

Flor HH. 1971. Current status of gene-for-gene concept. Annual Review ofPhytopathology 9: 275–296.

Gardiner SE, Norelli JL, de Silva N, Fazio G, Peil A, Malnoy M, Horner M,

Bowatte D, Carlisle C, Wiedow C et al. 2012. Putative resistance genemarkers associated with quantitative trait loci for fire blight resistance in Malus

‘Robusta 5’ accessions. BMC Genetics 13: 25.Gardner RG, Cummins JN, Aldwinckle HS. 1980. Inheritance of fire blight

resistance in Malus in relation to rootstock breeding. Journal of the AmericanSociety for Horticultural Science 105: 912–916.

Gaudriault S, Malandrin L, Paulin JP, Barny MA. 1997. DspA, an essential

pathogenicity factor of Erwinia amylovora showing homology with AvrE of

Pseudomonas syringae, is secreted via the Hrp secretion pathway in a DspB-

dependent way.Molecular Microbiology 26: 1057–1069.Gehring I, Geider K. 2012. Differentiation of Erwinia amylovora and Erwiniapyrifoliae strains with single nucleotide polymorphisms and by synthesis of

dihydrophenylalanine. Current Microbiology 65: 73–84.Gianessi L, Silvers C, Sankula S, Carpenter J. 2002. Plant biotechnology: current

and potential impact for improving pest management in US agriculture: an

analysis of 40 case studies. National Center for Food and Agricultural Policy JuneReport.

Grant MR, Godiard L, Straube E, Ashfield T, Lewald J, Sattler A, Innes RW,

Dangl JL. 1995. Structure of the Arabidopsis RPM1 gene enabling dual

specificity disease resistance. Science 269: 843–846.Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and

analysis program for Windows 95/98/NT. Nucleic Acids Symposium 41: 95–98.Hasler T, Schaerer HJ, Holliger E, Vogelsanger J, Vignutelli A, Schoch B. 2002.

Fire blight situation in Switzerland. Acta Horticulturae (ISHS) 590: 73–79.He SY, Nomura K, Whittam TS. 2004. Type III protein secretion mechanism in

mammalian and plant pathogens. Biochimica et Biophysica Acta 1694: 181–206.

Ignatov A, Bodishevskaya A. 2011.Malus. In: Chittaranjan Kole, ed.Wild croprelatives: genomic and breeding resources: temperate fruits. Berlin, Heidelberg,

Germany: Springer Verlag, 45–64.Jefferson RM. 1970. History, progeny, and locations of crabapples of documentedauthentic origin. Washington, USA: US Department of Agriculture.

Johnson KB, Stockwell VO. 1998.Management of fire blight: a case study in

microbial ecology. Annual Review of Phytopathology 36: 227–248.Keen NT, Tamaki S, Kobayashi D, Trollinger D. 1988. Improved broad-host-

range plasmids for DNA cloning in Gram-negative bacteria. Gene 70: 191–197.

Khan M, Zhao Y, Korban S. 2012.Molecular mechanisms of pathogenesis and

resistance to the bacterial pathogen Erwinia amylovora, causal agent of FireBlight disease in Rosaceae. Plant Molecular Biology Reporter 30: 247–260.

Kim H-S, Desveaux D, Singer AU, Patel P, Sondek J, Dangl JL. 2005. The

Pseudomonas syringae effector AvrRpt2 cleaves its C-terminally acylated target,

RIN4, from Arabidopsis membranes to block RPM1 activation. Proceedings ofthe National Academy of Sciences, USA 102: 6496–6501.

Lim MTS, Kunkel BN. 2004. The Pseudomonas syringae type III effectorAvrRpt2 promotes virulence independently of RIN4, a predicted virulence

target in Arabidopsis thaliana. Plant Journal 40: 790–798.

Mackey D, Belkhadir Y, Alonso JM, Ecker JR, Dangl JL. 2003. ArabidopsisRIN4 is a target of the Type III virulence effector AvrRpt2 and modulates

RPS2-mediated resistance. Cell 112: 379–389.Mackey D, Holt Iii BF, Wiig A, Dangl JL. 2002. RIN4 Interacts with

Pseudomonas syringae Type III effector molecules and is required for RPM1-

mediated resistance in Arabidopsis. Cell 108: 743–754.Malnoy M, Martens S, Norelli JL, Barny A-M, Sundin GW, Smits THM,

Duffy B. 2012. Fire blight: applied genomic insights of the pathogen and host.

Annual Review of Phytopathology 50: 475–494.McGhee GC, Guasco J, Bellomo LM, Blumer-Schuette SE, Shane WW, Irish-

Brown A, Sundin GW. 2011. Genetic analysis of streptomycin-resistant (SmR)

strains of Erwinia amylovora suggests that dissemination of two genotypes is

responsible for the current distribution of SmR E. amylovora in Michigan.

Phytopathology 101: 182–191.McManus PS, Jones AL. 1995. Genetic fingerprinting of Erwinia amylovorastrains isolated from tree-fruit crops and Rubus spp. Phytopathology 85: 1547–1553.

McManus PS, Stockwell VO, Sundin GW, Jones AL. 2002. Antibiotic use in

plant agriculture. Annual Review of Phytopathology 40: 443–465.McNally RR, Toth IK, Cock PJA, Pritchard L, Hedley PE, Morris JA, Zhao Y,

Sundin GW. 2012. Genetic characterization of the HrpL regulon of the fire

blight pathogen Erwinia amylovora reveals novel virulence factors.MolecularPlant Pathology 13: 160–173.

Norelli JL, Jones AL, Aldwinckle HS. 2003. Fire blight management in the

twenty-first century: using new technologies that enhance host resistance in

apple. Plant Disease 87: 756–765.Norelli JN, Aldwinckle HS. 1986.Differential susceptibility ofMalus spp.cultivars Robusta 5, Novole, and Ottawa 523 to Erwinia amylovora. PlantDisease 70: 1017–1019.

Oh C-S, Beer SV. 2005.Molecular genetics of Erwinia amylovora involved in the

development of fire blight. Fems Microbiology Letters 253: 185–192.Parravicini G, Gessler C, Denanc�E C, Lasserre-Zuber P, Vergne E, Brisset M-

N, Patocchi A, Durel C-E, Broggini GAL. 2011. Identification of serine/

threonine kinase and nucleotide-binding site–leucine-rich repeat (NBS-LRR)

genes in the fire blight resistance quantitative trait locus of apple cultivar

‘Evereste’.Molecular Plant Pathology 12: 493–505.Peil A, Bus VGM, Geider K, Richter K, Flachowsky H, Hanke MV. 2009.

Improvement of fire blight resistance in apple and pear. International Journal ofPlant Breeding 3: 1–27.

Peil A, Flachowsky H, Hanke M-V, Richter K, Rode J. 2011. Inoculation of

Malus 9 robusta 5 progeny with a strain breaking resistance to fire

blight reveals a minor QTL on LG5. Acta Horticulturae (ISHS) 896:357–362.

Peil A, Garcia-Libreros T, Richter K, Trognitz FC, Trognitz B, Hanke MV,

Flachowsky H. 2007. Strong evidence for a fire blight resistance gene ofMalusrobusta located on linkage group 3. Plant Breeding 126: 470–475.

Peil A, Hanke M-V, Flachowsky H, Richter K, Garcia-Libreros T, Celton J-M,

Gardiner S, Horner M, Bus V. 2008. Confirmation of the fire blight QTL of

Malus 9 robusta 5 on linkage group 3. Acta Horticulturae (ISHS) 793: 297–303.

Rice P, Longden I, Bleasby A. 2000. EMBOSS: the European molecular biology

open software suite. Trends in Genetics 16: 276–277.Scheer C. 2009. Feuerbrandsituation im Bodenseeraum und Ergebnisse der

Feuerbrandversuche des KOB 2008. Obstbau 3: 168–172.Schroth MN, Thomson SV, Hildebra Dc, Moller WJ. 1974. Epidemiology and

control of fire blight. Annual Review of Phytopathology 12: 389–412.Van Alfen NK, Allard-Turner V. 1979. Susceptibility of plants to vascular

disruption by macromolecules. Plant Physiology 63: 1072–1075.Van Der Biezen EA, Jones JDG. 1998. Plant disease-resistance proteins and the

gene-for-gene concept. Trends in Biochemical Sciences 23: 454–456.Van Der Zwet T, Keil HL. 1974. Fireblight of pear and apple its possible spread

in Europe. Proc. 19th Internat. Hort. Congr. Warszawa. 373–382.Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A,

Fontana P, Bhatnagar SK, Troggio M, Pruss D et al. 2010. The genome of

the domesticated apple (Malus x domestica Borkh.). Nature Genetics 42: 833–839.



Research

NewPhytologist1274

Wan Y, Fazio G. 2011. Confirmation by QTL mapping of theMalus robusta(‘Robusta 5’) derived powdery mildew resistance gene Pl1. Acta Horticulturae(ISHS) 903: 95–99.

Watkins R. 1971. Apple rootstocks. Annual Report East Malling Research Stationfor 1970 93: 97–98.

Watkins R, Spangelo LP. 1970. Components of genetic variance for plant

survival and vigor of apple trees. Theoretical and Applied Genetics 40: 195–203.Winslow CE, Broadhurst J, Buchanan RE, Krumwiede C, Rogers LA, Smith

GH. 1920. The families and genera of the bacteria: final report of the

Committee of the Society of American Bacteriologists on Characterization and

Classification of Bacterial Types. Journal of Bacteriology 5: 191–229.Zhao Y, Blumer SE, Sundin GW. 2005. Identification of Erwinia amylovoragenes induced during infection of immature pear tissue. Journal of Bacteriology187: 8088–8103.

Zhao Y, He SY, Sundin GW. 2006. The Erwinia amylovora avrRpt2EA genecontributes to virulence on pear and AvrRpt2EA ss recognized by ArabidopsisRPS2 when expressed in Pseudomonas syringae.Molecular Plant–MicrobeInteractions 19: 644–654.

Zhao Y, Sundin GW, Wang D. 2009. Construction and analysis of pathogenicity

island deletion mutants of Erwinia amylovora. Canadian Journal of Microbiology55: 457–464.

Supporting Information

Additional supporting information may be found in the onlineversion of this article.

Fig. S1 Validation of the single nucleotide polymorphism (SNP)marker on Erwinia amylovora strains that were used for sequenc-ing of the avrRpt2EA gene (Fig. 5).

Fig. S2 Presence and expression of the two avrRpt2EA alleles inthe wildtype strains Ea898, as the originally wildtype strain of themutant (C-allele), and Ea110 and Ea3050 (both with an S-allele).

Table S1 Description of additional Erwinia amylovora strainsanalyzed for the single nucleotide polymorphism (SNP) atposition 644, leading to the amino acid exchange from serine tocysteine at position 156

Please note: Wiley-Blackwell are not responsible for the contentor functionality of any supporting information supplied by theauthors. Any queries (other than missing material) should bedirected to the New Phytologist Central Office.

New Phytologist is an electronic (online-only) journal owned by the New Phytologist Trust, a not-for-profit organization dedicatedto the promotion of plant science, facilitating projects from symposia to free access for our Tansley reviews.

Regular papers, Letters, Research reviews, Rapid reports and both Modelling/Theory and Methods papers are encouraged. We are committed to rapid processing, from online submission through to publication ‘as ready’ via Early View – our average timeto decision is <25 days. There are no page or colour charges and a PDF version will be provided for each article.

The journal is available online at Wiley Online Library. Visit www.newphytologist.com to search the articles and register for tableof contents email alerts.

If you have any questions, do get in touch with Central Office ([email protected]) or, if it is more convenient,our USA Office ([email protected])

For submission instructions, subscription and all the latest information visit www.newphytologist.com





Documents

Gene-for-gene relationship in the host pathogen system ...msudaylab.org/wp-content/uploads/2016/11/2013_Vogt-et-al.pdf · Gene-for-gene relationship in the host–pathogen system