Genetic characterization of L-Zagreb mumps vaccine strain

Virus Research 109 (2005) 95–105

Genetic characterization of L-Zagreb mumps vaccine strain

Jelena Ivancic∗, Tanja Kosutic Gulija, Dubravko Forcic, Marijana Baricevic,Renata Jug, Majda Mesko-Prejac, Renata Mazuran

Molecular Biomedicine Unit, Department of Research and Development, Institute of Immunology Inc., Rockefellerova 10, 10000 Zagreb, Croatia

Received 6 July 2004; received in revised form 25 October 2004; accepted 4 November 2004Available online 18 December 2004

Abstract

Eleven mumps vaccine strains, all containing live attenuated virus, have been used throughout the world. Although L-Zagreb mumps vaccinehas been licensed since 1972, only its partial nucleotide sequence was previously determined (accession numbers AJ272363, AY623666 andAY583323). Therefore, we sequenced the entire genome of L-Zagreb vaccine strain (Institute of Immunology Inc., Zagreb, Croatia). In order toinvestigate the genetic stability of the vaccine, sequences of both L-Zagreb master seed and currently produced vaccine batch were determinedand no difference between them was observed.

ps genotypesa

e GenBank.E leotide andd wn that whilet amino acidd e used asa©

K

1

oRvotn1cPor

irus-in-

sesngcificceralram,in-

en-

ch asoccurs is

sincee

0d

A phylogenetic analysis based on SH gene sequence has shown that L-Zagreb strain does not belong to any of established mumnd that it is most similar to old, laboratory preserved European strains (1950s–1970s).L-Zagreb nucleotide and deduced protein sequences were compared with other mumps virus sequences obtained from th

mphasis was put on functionally important protein regions and known antigenic epitopes. The extensive comparisons of nuceduced protein sequences between L-Zagreb vaccine strain and other previously determined mumps virus sequences have sho

he functional regions of HN, V, and L proteins are well conserved among various mumps strains, there can be a substantialifference in antigenic epitopes of all proteins and in functional regions of F protein. No molecular pattern was identified that can bdistinction marker between virulent and attenuated strains.2004 Elsevier B.V. All rights reserved.

eywords:L-Zagreb mumps vaccine; Phylogenetic analysis

. Introduction

The mumps virus (genusRubulavirus, family Paramyx-viridae) is an enveloped, non-segmented, negative strandNA virus with the genome size of 15384 nucleotides. Theirus genome contains seven genes in the following ordern the genome map: the nucleocapsid (N), phospho (P), ma-

rix (M), fusion (F), small hydrophobic (SH), hemagglutinin-euraminidase (HN) and large (L) protein gene (Elango et al.,988; Elliott et al., 1989). Besides phosphoprotein, P gene en-odes two more proteins, V and I. Faithful transcription ofgene gives rise to V mRNA while non-templated insertion

f two or four guanine leads to production of P or I mRNA,espectively (Paterson and Lamb, 1990).

∗ Corresponding author. Tel.: +385 1 4684 500; fax: +385 1 4684 303.E-mail address:[email protected] (J. Ivancic).

Mumps virus causes a systemic illness spread by vcontaining droplets from the upper respiratory tract. Thefection with mumps is asymptomatic in one-third of ca(Galazka et al., 1999). The disease is generally self-limitiand usually characterized by parotitis and mild nonspesymptoms, but the virus has the capacity to invade visorgans and CNS. Without an effective vaccination progcomplications arising from mumps infection include mengitis, encephalitis, orchitis and neurological disorders (WHO,2001). Aseptic meningitis is reported in up to 15% andcephalitis in up to 0.3% of cases (WHO, 2001). Althoughcase-fatality rate is very low, permanent sequelae sudeafness, paralysis, seizures or hydrocephalus, may(WHO, 2001) and therefore, vaccination against mumprecommended.

Live attenuated mumps vaccines have been in usethe late 1960s (Galazka et al., 1999). Eleven mumps vaccin

168-1702/$ – see front matter © 2004 Elsevier B.V. All rights reserved.oi:10.1016/j.virusres.2004.11.013

96 J. Ivancic et al. / Virus Research 109 (2005) 95–105

strains (Jeryl Lynn, Urabe, Leningrad-3, L-Zagreb, Rubini,Hoshino, Miyahara, Torii, NKM-46, S-12 and RIT 4385)have been used throughout the world, some only on a limitedscale. All vaccine preparations utilizing the same parent strainare not identical because of differences in passage history, cellsubstrates and manufacturing process (WHO, 2001).

The freeze-dried variant of mumps virus Leningrad-3 (L-3) was given to the Institute of Immunology Inc. (Zagreb,Croatia) in 1969 from All-Union Research Institute for In-fluenza (Leningrad, Russia) with a history of 15 guinea-pigskidney and 6 quail embryo fibroblasts passages followed byone guinea-pigs kidney culture passage. At the Institute of Im-munology Inc. the strain was propagated in the primary cul-ture of chicken fibroblasts and preserved in the 26th passageas vaccine strain L-Zagreb (Beck et al., 1989; Winterhalter-Matas, 1990).

Since 1972, L-Zagreb serves for production of monovalentand combined live, attenuated viral vaccines by the Instituteof Immunology Inc. In the early 1980s L-Zagreb was givento the Serum Institute of India and from then it is used asa standard vaccine strain in viral vaccines produced by thismanufacturer.

Given the very poorly understood basis for the attenua-tion of the live mumps vaccine strains and the absence ofconvincing animal model for mumps, estimates of the vac-c onseop form nu-c iffer-e mpsv1 aveb cina-t ef-fi ains( -e eent thata

com-p inedT vac-c ccineb r availa

2

2

Dm -s t ofo ion

and 250�l aliquots were stored below−70◦C until used forRNA extraction.

Freeze-dried L-Zagreb vaccine, batch No. 113 (titre4.9 log CCID50/0.5 ml) (Institute of Immunology Inc., Za-greb, Croatia), was reconstituted in 250�l of sterile waterfor injection prior to RNA extraction.

2.2. RNA extraction

The total RNA was extracted from 250�l of master seedaliquots or reconstituted vaccine as reported by Chomczyn-ski and Mackey (Chomczynski and Mackey, 1998). Briefly,250�l of solution D (4 M guanidine thiocyanate, 25 mMsodium citrate pH 7.0, 0.5% sodium lauroyl sarcosine, 0.1 M2-mercaptoethanol), 50�l of 0.2 M sodium acetate, 500�lof phenol and 400�l of chloroform:isoamyl alcohol (24:1)were added.

RNA was precipitated from the aqueous phase with 1 vol-ume of isopropanol and the pellet was washed twice in 300�lof 75% ethanol. Finally, the RNA pellet was dissolved in 10�lof DNase, RNase free water.

Guanidine thiocyanate, sodium citrate, 2-mercapto-ethanol, phenol, isopropanol and ethanol were purchasedfrom Merck (Darmstadt, Germany); sodium lauroyl sarco-sine, sodium acetate, chloroform:isoamyl alcohol (24:1) weref aterw Swe-d

2

.( ith8ebD d5 sc

rep den),e liedB

2

f VrM x-a Cla

at9 -s

ine safety and efficacy depend primarily on the respf the population and clinical trials (Lim et al., 2003). Aossible step toward elucidating the molecular basisumps virus attenuation/virulence is a comparison of

leotide and deduced amino acid sequence data from dnt wild and vaccine strains. Furthermore, although muirus is believed to be serologically monotypic (Afzal et al.,997a; Jin et al., 2004), numerous antigenic differences heen shown to exist between various strains and vac

ion with a monovalent vaccine may show a lack ofcient protection against more divergent wild type strGut et al., 1995; Nojd et al., 2001). Therefore, it is intersting to compare the known antigenic epitopes betw

he circulating wild type strains and vaccine used inrea.

Although L-Zagreb has been in usage since 1972, itslete genome sequence has not previously been determherefore, we sequenced the entire L-Zagreb mumpsine strain (both master seed and currently produced vaatch) and compared its sequence to sequences of otheble vaccine and wild type strains.

. Material and methods

.1. Virus

Freeze-dried L-Zagreb master seed (titre 6.7 log CCI50/l) was preserved bellow−60◦C since the production (In

titute of Immunology Inc., Zagreb, Croatia). The contenne vial was reconstituted with 4 ml of water for inject

.

-

rom Amresco (Solon, OH, USA); DNase, RNase free was obtained from Amersham Biosciences (Uppsala,en).

.3. RNA circularisation

Isolated RNA was circularized as reported bySidhu et al1993)with some modifications. RNA was incubated w0 mU of pyrophosphatase at 25◦C for 10 min. 5′ and 3′ RNAnds were ligated using 60 U of T4 RNA ligase, 1× ligationuffer (500 mM Tris–HCl, pH 7.5, 100 mM MgCl2, 100 mMTT, 10 mM ATP), 5�l of BSA, 60 U of RNase inhibitor an�l of DMSO in a total volume of 50�l. The reaction waarried out over night at 4◦C.

All the chemicals used for RNA circularisation weurchased from Amersham Biosciences (Uppsala, Swexcept RNase inhibitor which was obtained from Appiosystems (Foster City, CA, USA).

.4. cDNA synthesis and PCR amplifications

The RNA was reversely transcribed into cDNA at 42◦Cor 60 min in a reaction mixture containing 50 U of MuLeverse transcriptase, 1× PCR buffer (50 mM KCl, 1.5 mMgCl2, 10 mM Tris–HCl, pH 9.0), 50 pmol of random hemers as primers, 20 U of RNase inhibitor, 60 nmol of Mg2nd 90 nmol of dNTP mix in a total volume of 26.6�l.

After the heat inactivation of the enzyme for 5 min5◦C, the mixture was cooled for 5 min at 5◦C and subequently used for PCR amplification.

J. Ivancic et al. / Virus Research 109 (2005) 95–105 97

Specific primers, selected using Urabe AM9 mumps virussequence (accession number AF314559), were used to am-plify the entire MuV genome as overlapping 600–700 bp frag-ments. Sequences of the primers used during this work arelisted inTable 1.

In the first PCR amplification, approx. 2 kb DNA frag-ments were obtained. Reaction mixtures included 2.4 Uof Pfu DNA polymerase, 1× Pfu reaction buffer (20 mMTris–HCl, pH 8.8, 10 mM KCl, 10 mM (NH4)2SO4, 2 mMMgSO4, 0.1 mg/ml BSA, 0.1% Triton X-100), 20 pmol ofeach primer, 75 nmol of MgCl2 and 40 nmol of dNTPs in atotal volume of 100�l. The initial denaturation step was per-formed at 94◦C for 2 min, followed by two rounds of cycles.The first round of 10 cycles involved denaturation at 94◦Cfor 1 min, primer annealing at 50◦C for 30 s and elongation at72◦C for 5 min. The second round consisted of 30 cycles withthe same thermal profile, except that the elongation for eachsuccessive cycle was prolonged by 20 s. The final elongationstep was performed at 72◦C for 10 min.

By using generated long PCR fragments as a template, weamplified PCR products for direct sequencing. PCR amplifi-cations were conducted through 35 cycles in a final volumeof 50�l containing 5�l of the first PCR amplification reac-tion mix, 20 pmol of each primer, 1× PCR buffer, 40 nmolof dNTPs and 2.5 U ofTaqDNA polymerase. After an initiald ◦ ◦3 ha

Nasei terC sa ces(b

2

QI-A )a spe-c singt liedB au-

TP

D n

KKKKKKKNN

Table 1 (Continued).

Designation 5′ → 3′ sequence Location

N2 (−) CCATCACCCAAGCCTGGATTA 677N3 (+) TGTTGAAGGACAGCCATGTG 598N4 (−) GGCCTAGATCATCTGCTACT 1301N5 (+) TCGGTACAGTCCTAGATGTC 1161N6 (−) TTAGCTGTGGCTGGATTGTC 1858N7 (−) CAGTTAGCTGTGGCTGGATT 1861N8 (−) TTGTGCTGATGCCTGTAG 1946P1 (+) GGACAATCCAGCCACAGCTA 1838P2 (−) CGGCGTTGAGGTTCTTGGTT 2422P3 (+) AGGACAAGGTGGCATTGTCA 2281P4 (−) CACATCTCCTGGTCCACTAA 2894P5 (+) TGGACAAGGTGCTTGCACAG 2692P6 (−) GCCTTCTTGAGCCACGATTAC 3359M1 (+) GAATGCCAGACTCACGAGAA 3162M2 (−) CGGAGCTGGCTTGAATCAGA 3720M3 (+) TCGGAAGACAGCGAGTGATA 3611M4 (−) TAGCACTGGCAGCCTTGATT 4248M5 (+) TAGTCCATGCAGGCGGTCAC 4102M6 (−) CGATGCCAATGGCAATGCCAG 4876F1 (+) ATTAATGAATTCAGAATCAACAA-

TCAGTCCG4412

F2 (−) AGCTGGTTATCAAGGATCT 5120F3 (+) CAAGCAATACAAGACCACA 5041F4 (−) GACATGCGGTTAGATCAAT 5776F5 (+) CCTGACCATCATGCAGTCA 5734F6 (−) ATTAATGAATTCTCACGAGACGTT-

ACGACC6264

F7 (+) GAGGCTGAGCCTAGAATCAA 5562LZ1v (+) CTGGGCTTACGTTGCAACT 6063LZ2v (−) GGCATTGTCCGATATTGTGA 6652HN1(+) GTTTCGATAACCCACTCTAGA 6422LZ4 (−) CACATTATGTGTATAGCACC 7203LZ5 (+) TAGGTAAGACACACTGGTGC 7170LZ6 (−) GCTCGCAATTTGTAACTAGG 7793LZ8 (−) GTACTTCAGGTAAGAGTATC 8474LZ9 (+) TTCTCTATCGGCCATCCACT 7082LZ10 (+) CTCAGGACCACAACAAGA 7763L1 (+) CCTGTGCTAACCAGATTGAC 8333L2 (−) GCATAGAGTGGACCTAGT 9082L3 (+) GATCTCGAGCAGGACAAGAC 8880L4 (−) CTTGGCTGGCAGTTAATGTG 9569L5 (+) GAGATTCTCGACCTACTGAC 9404L6 (−) TGGCACGACCTCATTCTCTT 10161L7 (+) CATTCAACCGACGGCTACTGT 9969L8 (−) CCTCCACGAGGAGAAACTA 10668L9 (+) AAGGCTAATGCGAAGCACTC 10549L10 (−) GTTTGGGGGAATACCAGATCA 11181L11 (+) GTAATGCGCCTGACTGAGAA 11078L12 (−) GTCTCACCTCCAGTGAATACC 11735L13 (+) GAAGAGGAACTCGCACAGTA 11579L14 (−) CTGTGGACTAGGTTAGCAGATG 12333L15 (+) TTGGGCTTTCGGAGATACAG 12205L16 (−) TTCCTGGTATCCTCCTCAAG 13037L17 (+) GTTTACTCTGGCTGGGCATT 12920L18 (−) GGATGCTGATTCGGATGAAC 13642L19 (+) CTTGCACACAGGCTCATCTT 12555L20 (+) AAGCTGCTTAATGCAATTCG 13508L21 (−) TCAGTAGCGCATGAACTTGG 14252L22 (+) GCGATATCACTGACTTAAGC 14100L23 (−) CTGATGATTGGCCCTTTAGGA 14780L24 (+) GGACTCCAAGCACAAGAA 14649L25 (−) ACCAAGGGGAGAAAGTAAAATC 15384

(+) and (−) indicate forward and reverse polarity of the primer, respectively.Primer locations are indicated for the first nucleotide of each primer.

enaturation step of 94C for 3 min, 35 cycles of 94C for0 s, 50◦C for 50 s and 72◦C for 1 min were performed, witterminal elongation step at 72◦C for 10 min.MuLV reverse transcriptase, random hexamers and R

nhibitor were obtained from Applied Biosystems (Fosity, CA, USA).TaqDNA polymerase, PCR buffer, dNTPnd MgCl2 were purchased from Amersham BioscienUppsala, Sweden).PfuDNA polymerase andPfu reactionuffer were from Promega (Madison, WI, USA).

.5. Automated DNA sequencing

PCR products were purified from agarose gel usingEX II Gel Extraction Kit (QIAGEN, Hilden, Germanynd DNA fragments were directly sequenced usingific primers. Nucleotide sequences were determined uhe BigDye terminators chemistry sequencing kit (Appiosystems, Foster City, CA, USA) in an ABI Prism 377

able 1rimers used for PCR amplifications and sequencing in the study

esignation 5′ → 3′ sequence Locatio

1 (−) TCTGTGAGATGCCCTAGCA 3522 (+) CGTCTCACCTTACGACAAT 149123 (−) GTCCCCTATCGACAATGAAG 1254 (+) GCCATTGGGTGTGTAATC 151075 (−) GTCTCCGGCGGAATTGAACC 2346 (+) GTGATAACACCCATGGAGATCC 149637 (−) CCCCTATCGACAATGAAAGGTG 1230 (+) CCAAGGGGAAAAAGAAGATGGGA 21 (+) GGCTCGATCCTCACCTTTCAT 91


Table 2Complete mumps virus genome sequences of (a) vaccine strains, (b) wild type strains and (c) laboratory strains currently deposited in the GenBank

(a)

Vaccine strain Accession number (reference) Manufacturer

Urabe AM9 AF314561 (Amexis et al., 2001) Biken InstituteAF314558 (Amexis et al., 2001) Chiron SpAAF314559 (Amexis et al., 2001) Smith-Kline Beecham

Urabe AM9 A vaccine substrain AB000386 (Mori et al., 1995) Biken InstituteUrabe AM9 B vaccine substrain AB000387 (Mori et al., 1995) Biken InstituteJeryl Lynn 5 AF338106 (Amexis et al., 2002) Merck & Co.

AF201473 and AX081123 (Clarke et al., 2000)

Jeryl Lynn 2 AF345290 (Amexis et al., 2002) Merck & Co.Miyahara AB040874 and NC002200 (Okazaki et al., 1992) Chem-Sero Therapeutic Research InstituteL-Zagreb (master seed) AY685921 Institute of Immunology Inc.L-Zagreb (vaccine) AY685920 Institute of Immunology Inc.

(b)

Wild-type strain Accession number (reference) Description

871004 AF314560 (Amexis et al., 2001) Isolate from the CSF of a patient with meningitis associated with Urabe AM987-1005 AF314562 (Amexis et al., 2001) Isolate from the CSF of a patient with meningitis associated with Urabe AM9Glouc1/UK96 AF280799 (Jin et al., 2000) Isolated in Great Britain in 199688-1961 AF467767 (Amexis et al., 2003) Isolated in USA in 1988Dg1062/Korea/98 AY309060 (Lee et al., 2004) Isolated in Korea in 1998Urabe AM-9 parental strain AB000388 (Mori et al., 1995)

(c)Laboratory strain Accession number (reference)

Sequence 11 from Patent WO0109309 AX081133 (Clarke et al., 2000)Sequence 12 from Patent WO0109309 AX081134 (Clarke et al., 2000)

tomatic DNA sequencer (Applied Biosystems, Foster City,CA, USA).

2.6. Data analysis

Obtained nucleotide sequences of L-Zagreb cDNA frag-ments were analysed with Clone Manager Suite software(Scientific & Educational Software, Durham, NC, USA). Theentire L-Zagreb master seed and vaccine sequences were de-posited in the GenBank (accession numbers AY685921 andAY685920).

The nucleotide sequence of L-Zagreb was compared toavailable mumps virus full length sequences submitted tothe GenBank. Currently, there are 18 complete mumps virusgenome sequences available in the GenBank, besides L-Zagreb (Table 2). Our analysis included following sequences:six strains whose parental strain was Urabe (Urabe AM9 vac-cines produced by Biken Institute, Chiron SpA and Smith-Kline Beecham, strains 87-1004 and 87-1005 isolated fromthe cerebrospinal fluids of vaccines with vaccine-associatedmeningitis), the major (JL5) and the minor (JL2) componentof the Jeryl Lynn vaccine produced by Merck & Co., Miya-hara vaccine strain produced by Chem-Sero Therapeutic Re-search Institute, and three contemporary wild type strains(88-1961 isolated in USA in 1988, Glouc1/UK96 isolated

in Great Britain in 1996 and Dg1062/Korea/98 isolated inKorea in 1998). Due to insufficient description of UrabeAM9 parental strain, Urabe AM9 A and B vaccine sub-strains and mumps virus sequences 11 and 12 from patentWO0109309, these sequences were not included in the anal-ysis. Furthermore, there are two sequences of the majorcomponent of Jeryl Lynn vaccine (JL5), one submitted byAmexis and Chumakov (accession number AF338106) andthe other submitted twice by Clarke et al. (accession num-bers AF201473 and AX081123). The JL5 sequences fromthese two groups of authors differ only in nucleotide 9634.This nucleotide difference does not influence the correspond-ing amino acid in the L protein. For data analysis, JL5 se-quence obtained by Amexis and Chumakov was used, as itwas obtained without additional passaging of vaccine virusbefore sequencing. The complete genomic sequence of Miya-hara vaccine strain was also submitted twice in the GenBankby the same authors, with no difference between the twosequences.

For comparison of deduced protein sequences, followingpartial mumps virus sequences were also used: HN gene of9218/Zg98 wild type strain isolated in Zagreb in 1989, HNgene of L-Zagreb vaccine strain produced by Serum Instituteof India, F and HN genes of Rubini vaccine strain, and F, SHand HN genes of Hoshino vaccine strain (accession numbers


AY612095, AY583323, AJ009685, X93180 and AB003414,respectively).

2.7. Phylogenetic analysis

The 316 nucleotide sequence of L-Zagreb SH gene wascompared with other previously published mumps virus SHgene sequences by ClustalX 1.81 software that uses theneighbor-joining method of Saitou and Nei (Saitou and Nei,1987). The number of bootstrap trials was set to 1000. Thephylogenetic tree was displayed by Njplot. The sequences in-cluded in the analysis were selected semi-randomly. Namely,each of currently established mumps virus genotypes is pre-sented by at least two strains. Following strains were included(the number following the strain name indicates the yearof isolation/detection/vaccine strain production; accessionnumbers are given in parenthesis): Tay UK 50s (AF142774),Leningrad-3 Russia 67 (AY493374), L-Zagreb Croatia 70(AJ272363), ZgB Croatia wild type 69 (AY376471), Ed2 UK88 (X63711), Ed4 UK 88 (X63710), Belfast UK 75 (X63709),9218/Zg98 Croatia wild type 98 (AJ272364), Po10 Portugal96 (X63709), Bristol1 UK 89 (X63713), Ybl 92 Switzer-land 92 (X63713), Drag 94 Russia 94 (Y14297), Goa1 In-dia 98 (AF142765), UK 02-361 (AY380079), RW USA 80(X63708), MP 93-N Japan 93 (X63708), ZgA 69 Croatiaw ),P 01( oka4 67),S 4),M 7),Y 2),W 4),M 98( o-r 89-K at-s 234),H 0),H 00( ina9 63( 50( 45(

3

3

e ofv vali-d s rig-oe iral

vaccines due to inherent genetic instability of RNA viruses(Amexis et al., 2002). Furthermore, RNA viruses exist as ahighly heterogeneous population (Rima, 1996) and substan-tial population shifts can be seen after just few in vitro pas-sages (Amexis et al., 2002). Although during the productionprocess of the L-Zagreb vaccine three additional passages ofL-Zagreb master seed and one of working seed lots are per-formed on chick embryo fibroblast cells, genomic sequencesof the master seed virus and of the virus present in the vac-cine produced at the Institute of Immunology Inc. were 100%identical.

Two precaution measures were undertaken in other to en-sure the validity of obtained sequences: (a) the master seedand vaccine virus samples were not additionally passagedprior to RNA isolation and PCR fragments were sequencedon both strands in order to provide a consensus sequence; (b)in the first of two PCR amplifications in which long DNAfragments were obtained (fragments that have been subse-quently used as templates), we usedPfu DNA polymerasethat exhibits 3′ → 5′ exonuclease (proofreading) activity inorder to avoid possible nucleotide substitutions introducedby Taq polymerase. Furthermore, direct sequencing allevi-ates concerns associated with sequencing of cloned RT-PCRproducts that could represent a randomly selected subpopu-lation of viral genomes (Parks et al., 2001a).

ceda g thec e,H . Inc greb( andt otideo ed att nsem 20A 21Ar

an-u ami acidp , nt8 68e /T(

3

eend intog d ina (e psg otides virusg u

ild type 69 (AY376470), London1 UK 96 (AF142769o3s Portugal 96 (AJ272363), Tokyo S-III-10 Japan

AB105480), Tokyo M-50 Japan 00 (AB105479), Fuku9 Japan 00 (AB105483), 88-1961 USA 88 (AF4677tratf1 UK 98 (AF142773), S-12 Iran 91 (AF31568anchester1 UK 95 (AF142771), UK 02-1902 (AY38007ork1 UK 98 (AF142776), Pok1-4 Nepal 98 (AF14277rek1 UK 97 (AF142775), Glouc1 UK 96 (AF14276P 93-AK Japan 93 (AB003424), IS 98-53 Korea

AF180382), Dg1062 Korea 98 (AY309060), DD 98-40 Kea 98 (AF180378), AS 97-1 Korea 97 (AF180375), MP

Japan 89 (AB003422), Urabe AM973 (AF314559), Muyama Japan 84 (D90233), Miyahara Japan 70 (D90oshino Japan 76 (AB003414), Loug1 UK 97 (AF14277imeji 364 Japan 00 (AB105474), Sapporo K-4 Japan

AB105475), MP 94-H Japan 94 (AB003417), Wlz1 Ch5 (Z77158), Wsh1 China 95 (Z77160), JL 5 USAAF338106), JL2 USA 63 (AF345290), Kilham USAX63706), Rubini Switzerland 85 (X72944), Enders USAD90231).

. Results and discussion

.1. Genetic stability of L-Zagreb vaccine strain

Maintaining of production consistency is a cornerstonaccine safety and is based on a strict adherence to aated and approved manufacturing protocols as well arous quality control testing (Amexis et al., 2002). This isspecially important in case of live, attenuated RNA v

The only available sequence of L-Zagreb strain produt Serum Institute of India is the sequence encompassinoding region of HN gene, 3′ noncoding region of HN genN-L intergenic region and first 6 nucleotides of L geneomparison to corresponding sequence of original L-ZaInstitute of Immunology Inc.), there are seven nucleotidewo amino acid changes (the first letter indicates a nucler amino acid present in sequence of L-Zagreb produc

he Institute of Immunology Inc.): nt 6631 C/A (same-seutation, HN aa 6 l/l), nt 7215 A/C (HN aa 201 n/t), nt 72/C (HN aa 203 k/q), nt 8413 G/T, nt 8414 A/G, nt 84/G, nt 8422 G/A (the last four nt sites are all in 3′ noncoding

egion of the HN gene).Viruses from three vaccines containing Urabe strain, m

factured by Biken, Chiron SpA and Smith-Kline Beechn the past, differed on six nucleotide and five aminoositions overall: nt 7409 G/G/R (HN aa 266 d/d/d or n)005 C/C/A (HN aa 464 n/n/k), nt 8015 G/R/G (HN aa 4/e or k/e), nt 9572 T/C/T (L aa 512 f/s/f), nt 10529 C/CL aa 698 l/l/l) and nt 11692 G/G/T (L aa 1085 l/l/f).

.2. Genotyping of L-Zagreb vaccine strain

Since many various mumps virus strains have betected throughout the world, their classificationenotypes is very useful in molecular epidemiology anssessment of the mumps virus transmission pathwaysInout al., 2004). SH gene is the most variable part of the mumenome and therefore, the comparison of the nucleequences of the SH gene has been used in mumpsenotyping (Afzal et al., 1997b;Orvell et al., 1997b; W


Fig. 1. Mumps virus phylogenetic tree generated by the neighbor-joining method, based on the 316 nucleotide region of the SH gene. Numbers representbootstrap values (the number of bootstrap trials was set to 1000).

et al., 1998; Jin et al., 1999; Kim et al., 2000; Tecle et al.,2001; Uchida et al., 2001; Inou et al., 2004). Unfortunately,there is no precise agreement upon which region of the SHgene should be used for genotyping–the entire SH gene(316 nt), only coding region of the SH gene (174 nt) orthe entire SH gene plus SH-HN intergenic region (318 nt).Our phylogenetic analysis was based on the entire SH gene(316 nt).

Twelve genotypes, named A-L, have so far been shown toexist. At the moment, there is confusion about which geno-type should be named J and which K (Tecle et al., 2001;Uchida et al., 2001; Inou et al., 2004; Jin et al., 2004). Inthis work, we used the nomenclature proposed byInou et al.(2004). Fig. 1 shows that L-Zagreb mumps strain does notbelong to any of established genotypes. As expected, it formsa cluster with its ancestral strain, Leningrad-3: the sequenceanalysis of the two strains shows 100% identity in the SHgene. After Leningrad-3, the closest strain to L-Zagreb isZgB 69, a wild type strain isolated in Zagreb, Croatia in1969 (4.1% nt differences). Furthermore, relatively closelyrelated to L-Zagreb (5.4% nt differences) is Taylor strain, awild type strain isolated in United Kingdom during the 1950sand passaged in Vero cells. Its exact source and passage his-tory are not well documented (Jin et al., 1999). Since none ofthe nowadays detected strains shows a significant similarityw ricalr virusw thep

3.3. Comparison of L-Zagreb nucleotide sequence withother mumps virus vaccine and wild type strains

Since there are practically no molecular markers formumps virus attenuation/virulence, the complete nucleotidesequence of L-Zagreb was determined and compared againstother mumps virus full length sequences submitted to theGenBank. Results of comparisons of coding and noncodingregions are shown inTables 3 and 4, respectively. When cod-ing regions were analysed, the highest number of nucleotidedifferences, besides in SH gene, was observed within N, I andF gene sequences, while M and especially L gene sequenceswere more conserved (Table 3).

Besides protein coding regions, fairly large amount of vi-ral genome is composed of noncoding regions. Namely, thefirst 55 nucleotides comprise leader region, 13 nucleotidesrepresent nontranscribing intergenic sequences and the last24 nucleotides comprise trailer region. Furthermore, eachgene contains rather long 5′ and even longer 3′ noncodingsequences. Overall, over 7% of relatively small viral genomicsequence are noncoding regions. Maintenance of significantnoncoding nucleotide sequence content implies its functionalimportance. Regulatory sequences are found in many viralgenomes and are essential for the orderly progression of theviral life cycle (Parks et al., 2001b). Little is known of theirs uta-t nor-m ,1

ith them, it is possible that all of these strains are histoelicts saved in laboratories, representatives of mumpsild type strains that had been circulating in Europe inast.

ignificance in mumps virus, but it was shown that mions within the noncoding region of the F gene disruptal expression of the downstream SH gene (Takeuchi et al.996).

J.Ivancic

etal./V

irusResearch

109(2005)95–105

101Table 3The percentage of nucleotide (nt) and amino acid (aa) differences between L-Zagreb gene coding sequences and deduced proteins, and the corresponding sequences of the following mumps virus strains: JerylLynn 5 (JL5), Jeryl Lynn 2 (JL2), Urabe AM9 produced by Biken (Biken), Chiron (Chiron) and Smith-Kline Beecham (SKB), postvaccinal isolates 87-1004 and 87-1005, Miyahara vaccine, wild type isolatesGlouc1/UK96, 88-1961 and Dg1062/Korea/98

Strain GT N P V I M F SH HN L

nt(1650)

aa(549)

nt(1176)

aa(391)

nt(675)

aa(224)

nt(516)

aa (171)(165)a

nt(1128)

aa(375)

nt(1617)

aa(538)

nt(174)

aa(57)

nt(1749)

aa(582)

nt(6786)

aa(2261)

JL5 A 4.7 1.6 5.7 5.6 6.4 6.7 7.9 7.6 4.3 1.6 5.8 4.1 10.9 12.3 6.3 4.6 5.1 1.3JL2 A 4.5 1.8 6.6 5.6 7.0 7.1 8.5 8.2 4.5 1.3 5.4 3.2 12.6 15.8 5.6 3.8 4.9 1.5Biken B 4.0 2.0 2.3 2.0 2.8 3.1 3.3 2.3 2.4 1.3 3.5 2.4 6.9 10.5 2.8 1.9 2.7 0.6Chiron B 4.0 2.0 2.3 2.0 2.8 3.1 3.3 2.3 2.4 1.3 3.5 2.4 6.9 10.5 2.9 2.1 2.7 0.7SKB B 4.0 2.0 2.3 2.0 2.8 3.1 3.3 2.3 2.4 1.3 3.5 2.4 6.9 10.5 2.9 2.2 2.8 0.787-1004 B 4.0 2.0 2.3 2.0 2.8 3.1 3.3 2.3 2.4 1.3 3.5 2.4 6.9 10.5 2.8 1.9 2.7 0.787-1005 B 4.0 2.0 2.3 2.0 2.8 3.1 3.3 2.3 2.4 1.3 3.5 2.4 7.5 12.3 2.9 2.1 2.8 0.7Miyahara B 3.4 1.3 2.0 2.0 2.7 3.1 3.3 2.9 2.6 1.1 3.6 2.4 5.7 8.8 2.8 1.9 2.6 0.7Glouc1 G 3.7 0.4 3.0 2.6 3.9 3.1 4.7 2.9 3.3 0.8 3.6 2.8 4.0 3.5 3.7 2.1 3.3 0.788-1961 H 3.7 0.9 2.0 3.3 4.6 4.0 5.0 4.1 3.5 1.3 4.8 2.8 6.3 7.0 3.7 2.2 3.2 0.6Dg1062 I 3.6 0.9 3.6 2.6 4.0 4.5 4.8 8.2 3.8 1.1 4.3 3.0 5.2 7.0 3.1 1.0 3.4 1.8

Numbers in parenthesis indicate the total number of nucleotides in the coding region of the gene and the total number of amino acids in the protein. Strain genotype is presented in the column named GT.a Deduced protein sequence of Dg1062/Korea/98 strain I protein possesses 165 amino acids.

Table 4The percentage of nucleotide differences between L-Zagreb noncoding sequences and the corresponding genome regions of the following mumps virus strains: Jeryl Lynn 5 (JL5), Jeryl Lynn 2 (JL2), Urabe AM9produced by Biken (Biken), Chiron (Chiron) and Smith-Kline Beecham (SKB), postvaccinal isolates 87-1004 and 87-1005, Miyahara vaccine, wild type isolates Glouc1/UK96, 88-1961 and Dg1062/Korea/98

Strain GT leader(55)

N P V I M F SH HN L Trailer(24)5′ (90) 3′ (111) 5′ (70) 3′ (74) 5′ (70) 3′ (573) 5′ (70) 3′ (736) 5′ (36) 3′ (90) 5′ (64) 3′ (48) 5′ (50) 3′ (92) 5′ (78) 3′ (66) 5′ (8) 3′ (137)

JL5 A 7.3 4.4 4.5 15.7 16.2 15.7 6.3 15.7 5.2 8.3 14.4 6.3 18.8 0.4 16.3 19.2 16.6 0 10.2 4.2JL2 A 3.6 3.3 9.0 17.1 16.2 17.1 7.5 17.1 6.2 11.1 15.6 9.4 16.7 0.2 16.3 16.7 15.2 0 9.5 8.3Biken B 7.3 1.1 1.8 5.7 12.2 5.7 3.0 5.7 2.6 2.8 7.7 4.7 6.3 0 4.3 10.3 6.1 0 2.9 4.2Chiron B 7.3 1.1 1.8 5.7 12.2 5.7 3.0 5.7 2.6 2.8 7.7 4.7 6.3 0 4.3 10.3 6.1 0 2.9 4.2SKB B 7.3 1.1 1.8 5.7 12.2 5.7 3.0 5.7 2.6 2.8 7.7 4.7 6.3 0 4.3 10.3 6.1 0 2.9 4.287-1004 B 7.3 1.1 1.8 5.7 12.2 5.7 3.0 5.7 2.6 2.8 7.7 4.7 6.3 0 4.3 10.3 6.1 0 3.6 4.287-1005 B 5.5 1.1 2.7 5.7 12.2 5.7 3.0 5.7 2.6 2.8 7.7 4.7 6.3 0 4.3 10.3 6.1 0 2.9 4.2Miyahara B 7.3 1.1 1.8 5.7 10.8 5.7 2.3 5.7 1.9 2.8 8.8 6.3 6.3 0.2 9.8 9.0 4.5 0 4.4 4.2Glouc1 G 3.6 3.3 7.2 7.1 14.9 7.1 3.5 7.1 3.0 5.6 7.7 7.8 2.1 0.2 12.0 11.5 6.1 0 1.5 4.288-1961 H 9.1 5.5 5.4 10.0 12.2 10.0 1.9 10.0 2.2 2.8 10.0 10.9 8.3 0 12.0 10.3 6.1 0 4.4 4.2Dg1062 I 3.6 2.2 3.6 5.7 14.9 5.7 3.3 5.7 2.9 8.3 10.0 9.4 8.3 0.4 15.2 10.3 3.0 0 2.9 4.2

Numbers in parenthesis indicate the total number of nucleotides in the 5′ and 3′ noncoding regions of the gene. Strain genotype is presented in the column named GT.


Most of the noncoding regions were less similar than thecoding regions of the corresponding genes (Tables 3 and 4).Surprisingly, 5′ noncoding region of the SH gene is very sim-ilar among all strains. 5′ noncoding region of the L gene wasidentical among all strains, but unlike other noncoding re-gions, this region is just eight nucleotides long and its con-servation may indicate the importance of each nucleotide.

If the first AUG codon in the M gene mRNA was usedfor translation, the resulting M protein would be 395 (not375) amino acids long. It is interesting that in all examinedsequences M gene mRNA possesses this “un-used” in-frame

Fgc

AUG triplet at the nucleotide position 3264-3266 (data notshown). What is the mechanism that governs the translatingmachinery to use the downstream AUG in the M gene mRNAis not known, but similar situation is encountered with themeasles virus F gene mRNA, where the 1 kb long untrans-lated region, located before the start codon of the F protein,was shown to modulate the selection of the initiation codon(Cathomen et al., 1995).

The first and the last ten nucleotides of L-Zagreb genomeare inversely complementary and identical to all other mumpssequences analysed.

3.4. Analysis of antigenic epitopes and functionaldomains of virus proteins

It is a well documented fact that reinfections with mumpsvirus occur and that vaccination may show a lack of protection

ig. 2. Comparison of deduced amino acid sequences of HN protein anti-enic epitopes among mumps virus strains. The presented sequences enompass (a) 265-268, (b) 329-340 and (c) 352-360 HN protein region.

Fra
-ig. 3. Comparison of deduced amino acid sequences of F protein functional
egions among mumps virus strains. The presented sequences show (a) aminocids 1-19, (b) amino acid 195.


against mumps virus strains different from vaccine strain (Gutet al., 1995; Nojd et al., 2001). This phenomenon is probablydue to antigenic differences that exist between the proteinsof different mumps virus strains (Server et al., 1982;Orvell,1984; Yates et al., 1996;Orvell et al., 1997a, 2002; Nojd et al.,2001).

Because of their position on the surface of viral particle,HN and F proteins are the primary targets of host immuno-logical response. Studies with monoclonal antibodies suggestthat the HN protein is the major target for the humoral im-mune response upon mumps virus infection (Wolinsky et al.,1985). Investigations of potential neutralizing epitopes andtheir localization on the mumps virus HN protein have re-sulted in the determination of three important HN peptides(aa 265-288, 329-340 and 352-360) (Kovamees et al., 1990;Orvell et al., 1997a; Cusi et al., 2001). Although just a limitednumber of strains was included in our analysis, comparisonsof deduced sequences of these HN protein segments show thatthese peptides vary among mumps strains (Fig. 2a–c). Criticalfunctional domains for hemagglutination and neuraminidaseactivity, nrkscs (aa 240-245) and gaegrv (aa 405-410), re-spectively (Lim et al., 2003), are conserved in L-Zagreb aswell as in other strains (data not shown).

HN protein residues 35-53 constitute a membrane an-chorage and have been thought to be highly conserved (se-qi ecteds greb,a (datan

rentv rallya

The first 19 amino acids of the N-terminal region of the Fprotein comprise a “signal peptide” that is important for theF protein function (Elango et al., 1989; Tecle et al., 2000).Comparisons of deduced sequences of this F protein segmentshow that this peptide varies substantially among mumpsstrains (Fig. 3a), while the aa region 98-102 which is rec-ognized by a host cell protease which activates the F proteinis very conserved and identical in all strains (aa sequencerrhkr; data not shown) (Waxham et al., 1987). It was shownthat the amino acid at the position 195 was responsible for thefusogenicity of the mumps virus (Tanabayashi et al., 1993). L-Zagreb possesses a phenylalanine at that position, same as thestrains originating from Urabe and Korean wild type Dg 1062,while Jeryl Lynn major and minor component strains, Rubini,Hoshino and Miyahara vaccine strains, as well as Glouc1 and88-1962 wild type isolates, have a serine (Fig. 3b). The strainspossessing a serine have a higher fusogenicity, as compared tothose that have a tyrosine or biochemically similar phenylala-nine (Tanabayashi et al., 1993). Whether this has an effect onoverall virulence of the virus can only be speculated, but ourdata show that both amino acids, serine and phenylalanine,can be found in virulent as well as in attenuated strains.

F protein residues 483-512 constitute a membrane an-chorage (Elango et al., 1989). Most strains possess sequenceigaiivaalvlsilsiiisllfccwayiat in that region. Unlike all others nine att uc1a boths 488.G linei

eina gion

F taining ted sequee

uence ilvlsvqavililvivtlg) (Waxham et al., 1998). All strainsncluded in our analysis except L-Zagreb possess expequence. In deduced HN protein sequence of L-Zamino acid at position 51 is asparagine, not threonineot shown).

F protein analyses showed that proteins from diffeirus strains belonging to the same genotype are structund antigenically relatively conserved (Tecle et al., 2000).

ig. 4. Comparison of deduced amino acid sequences of a region conncompass a region between amino acid 412 and 549.

trains, L-Zagreb possesses aa threonine in stead of alahe position 489 (data not shown). Wild type strains Glond Dg 1062 also differ from the common sequence:trains posses isoleucine instead of valine at the positionlouc1 additionally differs at the position 495, having va

nstead of isoleucine (data not shown).Investigation of the antigenic variation of the N prot

mong mumps virus strains determined the C-terminal re

N protein antigenic epitopes among mumps virus strains. The presennces


as a very important part of the mumps virus N protein. Anti-genic sites have been found to reside within the aa region412-475 and 475-549 (this region in also highly variablewithin measles virus strains) (Tanabayashi et al., 1990; Jinet al., 1997; WHO, 1998). We found that deduced sequenceof L-Zagreb strain was quite different when compared withstrains belonging to genotype A or B, and more homologousto strains belonging to genotypes G and H (Fig. 4).

C-terminal, Cys-rich region of the V protein inhibits theestablishment of the antiviral state induced by IFNs (Gotohet al., 2001). Seven cysteine residues in that region are foundin L-Zagreb, as well as in all other mumps strains, on aminoacid positions 189, 193, 205, 207, 210, 214 and 217. V pro-tein could be involved in viral transcription and/or replicationbecause the Cys-rich region is a reminiscent of a zinc fingerdomain, a motif that has been identified in nucleic acid bind-ing regulatory proteins (Paterson and Lamb, 1990).

As already noted, comparison of the L protein sequencesrevealed that of all mumps virus genes and proteins, it ismostly conserved, both on nucleotide and protein level. Themost important amino acid motifs, polymerase catalytic site(aa 778-780), RNA template contact region (aa 555-643) andATP binding site (aa 1814-1818) (Okazaki et al., 1992) areidentical in all strains.

4

cines encew nn,U tituteo ildt g thed witha ularm

pro-t otherp thatw arew be as f allp ularp ationm

R

A .L.,and

nicalal. J.

A ringflects

Amexis, G., Fineschi, N., Chumakov, K., 2001. Correlation of geneticvariability with safety of mumps vaccine Urabe AM9 strain. Virology287, 234–241.

Amexis, G., Rubin, S., Chizhikov, V., Pelloquin, F., Carbone, K., Chu-makov, K., 2002. Sequence diversity of Jeryl Lynn strain of mumpsvirus: quantitative mutant analysis for vaccine quality control. Virol-ogy 300, 171–179.

Amexis, G., Rubin, S., Chatterjee, N., Carbone, K., Chumakov, K., 2003.Identification of a new genotype H wild-type mumps virus strain andits molecular relatedness to other virulent and attenuated strains. J.Med. Virol. 70, 284–286.

Beck, M., Welsz-Malecek, R., Mesko-Prejac, M., Radman, V., Juzbasic,M., Rajninger-Miholic, M., Prislin-Musklic, M., Dobrovsak-Sourek,V., Smerdel, S., Stainer, D.W., 1989. Mumps vaccine L-Zagreb, pre-pared in Chick fibroblasts. I. Production and field trials. J. Biol. Stand.17, 85–90.

Cathomen, T., Buchholz, C.J., Spielhofer, P., Cattaneo, R., 1995. Prefer-ential initiation at the second AUG of the measles virus F mRNA: arole for the long untranslated region. Virology 214, 628–632.

Chomczynski, P., Mackey, K., 1998. Single-step method of total RNAisolated by acid guanidine phenol extraction. In: Celis, J.E. (Ed.),Cell Biology: A Laboratory Handbook. Academic Press, New York,pp. 221–224.

Clarke, D.K., Sidhu, M.S., Johnson, J.E., Udem, S.A., 2000. Rescue ofmumps virus from Cdna. J. Virol. 74, 4831–4838.

Cusi, M.G., Fischer, S., Sedlmeier, R., Valassina, M., Valensin, P.E., Do-nati, M., Neubert, W.J., 2001. Localization of a new neutralizing epi-tope on the mumps virus hemagglutinin-neuraminidase protein. VirusRes. 74, 133–137.

Elango, N., Varsanyi, T.M., Kovamees, J., Norrby, E., 1988. MolecularorderJ. Gen.

E psthe

E se-umps1–75.

G mps

G virusl. 45,

G mps

I M.,fuji,04.

al of

J 97.irol.

J umps. J.

J Thetrain.

J er-mps

K .S.,f thetion

. Conclusion

Although there are 11 attenuated mumps virus vactrains in the usage worldwide, the entire genomic sequas determined for only some of them, namely Jeryl Lyrabe, Miyahara and now L-Zagreb, produced at the Insf Immunology Inc. Genetic characterisation of mumps w

ype and vaccine strains is very important in assessinegree of protection that can be achieved by vaccinationparticular vaccine, but also in determination of molecarkers for mumps virus attenuation/virulence.The extensive comparisons of nucleotide and deduced

ein sequences between L-Zagreb vaccine strain andreviously determined mumps sequences have shownhile the functional regions of HN, V, and L proteinsell conserved among various mumps strains, there canubstantial amino acid difference in antigenic epitopes oroteins and in functional regions of F protein. No molecattern was identified that could be used as a discriminarker between virulent and attenuated strains.

eferences

fzal, M.A., Buchanan, J., Dias, J.A., Cordeiro, M., Bentley, MShrrock, C.A., Minor, P.D., 1997a. RT-PCR based diagnosticsmolecular characterisation of mumps viruses derived from clispecimens collected during the 1996 mumps outbreak in PortugMed. Virol. 52, 353–439.

fzal, M.A., Buchanan, J., Heath, A.B., Minor, P.D., 1997b. Clusteof mumps virus isolates by SH gene sequences only partially regeographical origin. Arch. Virol. 142, 227–238.

cloning and characterization of six genes, determination of geneand intergenic sequences and leader sequence of mumps virus.Virol. 69, 2893–2900.

lango, N., Varsanyi, T.M., Kovamees, J., Norrby, E., 1989. The mumvirus fusion protein mRNA sequence and homology amongParamyxoviridae proteins. J. Gen. Virol. 70, 801–807.

lliott, G.D., Afzal, M.A., Martin, S.J., Rima, B.K., 1989. Nucleotidequence of the matrix, fusion and putative SH protein genes of mvirus and their deduced amino acid sequences. Virus Res. 12, 6

alazka, A.M., Robertson, S.E., Kraiger, A., 1999. Mumps and muvaccine: a global review. Bull. World Health Organ 77, 3–14.

otoh, B., Komatsu, T., Takeuchi, K., Yokoo, J., 2001. Paramyxoaccessory proteins as interferon antagonists. Microbiol. Immuno787–800.

ut, J.P., Lablanche, C., Behr, S., Kirn, A., 1995. Symptomatic muvirus reinfection. J. Med. Virol. 45, 17–23.

nou, Y., Nakayama, T., Yoshida, N., Uejima, H., Yuri, K., Kamada,Kumagai, T., Sakiyama, H., Miyata, A., Ochiai, H., Ihara, T., OkaT., Nagai, T., Suzuki, E., Shimomura, K., Ito, Y., Miyazaki, C., 20Molecular epidemiology of mumps virus in Japan and propostwo new genotypes. J. Med. Virol. 73, 97–104.

in, L., Brown, B.W.G., Ramsay, M.E.B., Rota, P.A., Bellini, W.J., 19The diversity of measles virus in the UK, 1992–1995. J. Gen. V78, 1287–1294.

in, L., Beard, S., Brown, D.W.G., 1999. Genetic heterogeneity of mvirus in the United Kingdom: Identification of two new genotypesInfect. Dis. 180, 829–833.

in, L., Beard, S., Hale, A., Knowles, W., Brown, D.W.G., 2000.genomic sequence of a contemporary wild-type mumps virus sVirus Res. 70, 75–80.

in, L., Brown, D.W.G., Litton, P.A., White, J.M., 2004. Genetic divsity of mumps virus in oral fluid specimens: application to muepidemiology study. J. Infect. Dis. 189, 1001–1008.

im, S.H., Song, K.-J., Shin, Y.K., Kim, J.H., Choi, S.M., Park, KBaek, L.J., Lee, Y.J., Song, J.-W., 2000. Phylogenetic analysis osmall hydrophobic (SH) gene of mumps virus in Korea: identificaof a new genotype. Microbiol. Immunol. 44, 173–177.


Kovamees, J., Rydbeck, R., Orvell, C., Norrby, E., 1990. Hemagglutinin-neuraminidase (HN) amino acid alterations in neutralization escapemutants of Kilham mumps virus. Virus Res. 17, 119–129.

Lee, J.Y., Na, B.K., Lee, H.D., Chang, S.W., Kim, K.A., Kim, J.H., Cho,H.W., Kim, J., Kang, C., 2004. Complete nucleotide sequence of amumps virus genotype I strain isolated in Korea. Virus Genes 28,201–205.

Lim, C.S., Chan, K.P., Goh, K.T., Chow, V.T.K., 2003. Hemagglutinin-neuraminidase sequence and phylogenetic analyses of mumps virusisolates from a vaccinated population in Singapore. J. Med. Virol. 70,287–292.

Mori, C., Fujita, J., Tooriyama, T., Takahara, R., Takamizawa, A., 1995.Complete nucleotide sequence of the Mumps Virus Urabe vaccinestrain genomic cDNA. Rinsho To Uirusu 23, 341–352 (in Japanese).

Nojd, J., Tecle, T., Samuelsson, A.,Orvell, C., 2001. Mumps virus neu-tralizing antibodies do not protect against reinfection with a heterol-ogous mumps virus genotype. Vaccine 19, 1727–1731.

Okazaki, K., Tanabayashi, K., Takeuchi, K., Hishiyama, M., Okazaki, K.,Yamada, A., 1992. Molecular cloning and sequence analysis of themumps virus gene encoding the L protein and the trailer sequence.Virology 188, 926–930.

Orvell, C., 1984. The reactions of monoclonal antibodies with structuralproteins of mumps virus. J. Immunol. 132, 2622–2629.

Orvell, C., Alsheikhly, A.-R., Kalantari, M., Johansson, B., 1997a. Char-acterization of genotype-specific epitopes of the HN protein of mumpsvirus. J. Gen. Virol. 78, 3184–3193.

Orvell, C., Kalantari, M., Johansson, B., 1997b. Characterization of fiveconserved genotypes of the mumps virus small hydrophobic (SH)protein gene. J. Gen. Virol. 78, 91–95.

Orvell, C., Tecle, T., Johansson, B., Saito, H., Samuelsson, A., 2002.pho-

P em,s of

l. 75,

P em,virus

P rtion45.

R 24,

S thod

S ren-HN

Sidhu, M.S., Husar, W., Cook, S.D., Dowling, P.C., Udem, S.A., 1993. Ca-nine distemper terminal and intergenic non-protein coding nucleotidesequences: completion of the entire CDV genome sequence. Virology193, 66–72.

Takeuchi, K., Tanabayashi, K., Hishiyama, M., Yamada, A., 1996. Themumps virus SH protein is a membrane protein not essential for virusgrowth. Virology 225, 156–162.

Tanabayashi, K., Takeuchi, K., Hishiyama, M., Yamada, A., Tsurudome,M., Ito, Y., Sugiura, A., 1990. Nucleotide sequence of the leaderand nucleocapsid protein gene of mumps virus and epitope mappingwith the in vitro expressed nucleocapsid protein. Virology 177, 124–130.

Tanabayashi, K., Takeuchi, K., Okazaki, K., Hishiyama, M., Yamada, A.,1993. Identification of an amino acid that defines the fusogenicity ofmumps virus. J. Virol. 67, 2928–2931.

Tecle, T., Johansson, B., Yun, Z.,Orvell, C., 2000. Antigenic and geneticcharacterization of the fusion (F) protein of mumps virus strains. Arch.Virol. 145, 1199–1210.

Tecle, T., Bottiger, B., Orvell, C., Johansson, B., 2001. Characterizationof two decades of temporal co-circulation of four mumps virus geno-types in Denmark: identification of a new genotype. J. Gen. Virol.82, 2675–2680.

Uchida, K., Shinohara, M., Shimada, S., Segawa, Y., Hoshino, Y., 2001.Characterization of mumps virus isolated in Saitama prefecture, Japan,by sequence analysis of the SH gene. Microbiol. Immunol. 45,851–855.

Waxham, M.N., Server, A.C., Goodman, H.M., Wolinsky, J.S., 1987.Cloning and sequencing of the mumps virus fusion protein gene.Virology 159, 381–388.

Waxham, M.N., Aronowski, J., Server, A.C., Wolinsky, J.S., Smith, J.A.,virus

W irus.

W fectsf ex-27–

W ations of

WW s

16,

Y ari-77,

Antigenic relationship between six genotypes of the small hydrobic protein gene of mumps virus. J. Gen. Virol. 83, 2489–2496.

arks, C.L., Lerch, R.A., Walpita, P., Wang, H.-P., Sidhu, M.S., UdS.A., 2001a. Comparison of predicted amino acid sequencemeasles virus strains in the Edmonston vaccine lineage. J. Viro910–920.

arks, C.L., Lerch, R.A., Walpita, P., Wang, H.-P., Sidhu, M.S., UdS.A., 2001b. Analysis of the noncoding regions of measlesstrains in the Edmonston lineage. J. Virol. 75, 921–933.

aterson, R.G., Lamb, R.A., 1990. RNA editing by G-nucleotide insein mumps virus P-gene mRNA transcripts. J. Virol. 64, 4137–41

ima, B.K., 1996. Viruses in the RNA world. Biochem. Soc. Trans.1–13.

aitou, N., Nei, M., 1987. The neighbor-joining method: a new mefor reconstructing phylogenetic trees. Mol. Biol. E 4, 406–425.

erver, A.C., Merz, D.C., Waxham, M.N., Wolinski, J.S., 1982. Diffetiation of mumps virus strains using monoclonal antibody to theglycoprotein. Infect. Immunol. 35, 179–186.

Goodman, H.M., 1998. Sequence determination of the mumpsHN gene. Virology 164, 318–325.

interhalter-Matas, A., 1990. Study of genetic markers of mumps vLij. Vjesn. 112, 13–16 (in Croatian).

olinsky, J.S., Waxham, M.N., Server, A.C., 1985. Protective efof glycoprotein-specific monoclonal antibodies on the course operimental mumps virus meningoencephalitis. J. Virol. 53, 7734.

HO, 1998. Expanded Programme on Immunization—Standardizof the Nomenclature for Describing the Genetic CharacteristicWild-Type Measles Viruses, vol. 73. WER, pp. 265–269.

HO 2001. Mumps Virus Vaccines, vol. 45. WER, pp. 346–354.u, L., Bai, Z., Li, Y., Rima, B.K., Afzal, M.A., 1998. Wild type mump

viruses circulating in China establish a new genotype. Vaccine281–285.

ates, P.J., Afzal, M.A., Minor, P.D., 1996. Antigenic and genetic vation of the HN protein of mumps virus strains. J. Gen. Virol.2491–2497.

Documents

Genetic characterization of L-Zagreb mumps vaccine strain