Genetic modification of Musa acuminate delays ripening stage

BY: ABBY HALL, LINDSEY KEPLINGER, AND GARRETT RIGGLEMAN

Food waste is a serious issue. Over 1.4 million bananas are thrown away every day in the United Kingdom alone (Prince,

2014). This is approximately 140 million calories, enough to provide 70,000 people with 2,000

calories, the amount the average person needs in a day. Twenty-seven percent of fresh fruits

were wasted in 1995 (Cuéllar and Webber, 2010).

One fruit that ripens extremely fast in bananas.

Many times you buy a bunch and they’re brown before you know it and then thrown away. With

GMO technology, we can try to fix this. Genetic engineering is one of science’s most innovative

breakthroughs (Malyska et al., 2014). Some claim is it unnatural, but there really is no exact

definition of unnatural and no negative effects of consuming genetically engineered foods have

been found (Cooley, 2004).

One piece of produce that stays edible for a long time is apples.

Placed in a refrigerator, apples can stay fresh for 1-2 months compared to bananas placed in the

refrigerator which last 2-9 days depending on how ripe they are when purchased.

What factors influence banana ripening?

There have been multiple studies on what factors influence banana ripening, but a quick search

on the internet didn’t provide us with any attempts at genetically modifying the fruit to slow

down the process. There are many tricks to slowing down the process like keeping the stem

covered in tape, or keeping the bananas in the refrigerator, but by changing the DNA, it should

make a significant change.

Enzyme: Pectate lyase To low the ripening process through genetic engineering, our first step was to find an enzyme in

the bananas that plays a role in its ripening process. The enzyme called pectate lyase has been

found to be in highest concentrations when fruits are at peak ripeness. It is the most active cell

wall-degrading enzyme during fruit ripening (Payasi, 2013). So, in an attempt to slow the

ripening process of the banana down, we’re going to genetically modify a banana to produce

the pectate lyase enzyme of an apple rather than the pectate lyase enzyme of a banana.

No gene promotors needed If this works as expected, we shouldn’t need any gene promotors. Hopefully, this modified

pectate lyase enzyme will work in the ripening process just as the regular enzyme does in all

circumstances.

Pectate lyase sequence in bananas

CTCAGATAGTGCAAGGCATGGCTACTTCCACGTGGTAAACAATGACTACACGCACTGGGAGATGTACGCC

ATTGGCGGTAGCGCGAATCCAACGATCAACAGTCAAGGCAACCGATACCTTGCGCCGACCAATCCATTTG

CAAAGGAGGTAACAAAAAGGGTGGACACAGATCAAAGCACGTGGAAGAACTGGAATTGGAGGTCGGAGGG

TGACCTGCTTCTGAATGGTGCTTTTTTCACCCCTTCCGGTGCAGGGGCTTCAGCCAGCTACGCACGGGCC

TCCAGCTTTGGGGCCAAGCCCTCTTCCTTGGTTGACACACTGACTTCTGATGCTGGGGTCCTGTCTTGCC

AAGTCGGCACTCGATGTTAACGTAATGCCAAGTAGCAGAACGCCACAACCCGAAGGATGGGAAATCGTAC

TTGACGGTGTTACAAATTTCTTCTATGTTACACCGTCAGAAATGTCATTTCCTCCAATTGCCCAACCTCC

GCCTGGCTCCATATGTGGAGCGCATGCGGAAGCGTTGTCAGTTTCTTTTATTCTACTTTGCTGTTTTAGC

TCTGTTACACCGTCCATCTAGCAATAAGTGGGTTTATAGATAGACTTCAAAAAAAAAAAAAAAAAA

Pectate lyase in apples actcacaaac acacctcctc tctctctgcc ttctctctct ttgcttgcct cagtgccttg

61 cacattcaaa aaaatgccaa aaatgccaag gccctcctca ggcccctcac ttctctctcc

121 cctcctcctc ctccctctcc tctctctcct ctccccaacc ctcatttcct ccaggccact

181 tcatctccaa gaccctgaat tggtagtaca agaggtacaa aggaatatta gcgactcagt

241 atctaggagg aacttgggct acttgtcatg cgggaccggc aaccctatcg acgactgctg

301 gcggtgcgac ccgaactggg agaagaacag gcagagctta gctgattgtg cgatagggtt

361 cggaaagaac gccataggtg gaagagacgg gaagatttac gtggtcacag attccggcga

421 tgacgacccc gtgaacccca agccaggaac cctacgacac gccgtcatcc aagacgagcc

481 attatggatc attttccagc gtgacatgac catccagctg aaggaggagc tgatcatgaa

541 ctccttcaag acaatcgacg gccggggagc gtccgtacac attgccggcg ggccatgcat

601 caccatccag ttcgtgacca acattattat ccacggactg cacatacacg attgcaagca

661 gggtgggaac gctatggtga ggagctcccc caggcacttc gggtggagga ccgtatcgga

721 cggcgacggc gtgtcgatct tcggtgggag ccacgtgtgg gtggaccatt gctcgttgtc

Pectate lyase in apples (cont.) 781 caactgcaaa gatgggttgg ttgatgcaat ttatgggtcc actgcgataa cgatttcgaa

841 caattacatg acgcaccatg ataaggtgat gcttttgggg catagcgatt cgtataccaa

901 cgacaagaac atgcaaatca ccattgcgtt caatcacttt ggagaaggct tggtccaaag

961 aatgccaaga tgtaggcatg gatatttcca tgtggtgaac aatgactaca cccattggga

1021 gatgtatgcc attggtggga gtgcagaccc tacaatcaat agccaaggga acagatttgc

1081 tgcaccagat atcagatcca gcaaagaggt gaccaaacat gaggatgcac cagaaagtga

1141 atggaagaat tggaactgga ggtcggaagg cgacttgatg ctcaacggtg cgttttttac

1201 tgcatcaggt gccggagctt cctctagcta cgccagggct tcgagcttgg gtgcaaagcc

1261 atcttctcta gtgggtgcga ttaccacggc ttccggcgca cttagttgcc gaaagggctc

1321 tcgttgctga ttgcatatcg agcttgtggc ctattgaaaa cgacattcct aaagtgatta

1381 gctgaagaac tattcaagtt caattagaca tatttaggag ggaagtgaga ggaaaacgac

1441 atttcctcca aacaatattt tctactttgt ccctttgctt ttttactgtt tttaagtcaa

1501 ttttcatgat gattacaacc tcgctttgtt tctctgaggc tgcattaggg tttctgttca

1561 agaatcttga tgacctataa gagaagacaa gtgttgaagt gttgactata ctaaattatc

1621 aatctatttc ctgatatttg ataaaaaaaa aaaaaaaaaa

Restriction enzyme MluCI They both have 3 AATT sequences. To get them to combine, we use restriction enzymes. Restriction

enzymes are often called molecular scissors because they cut DNA into either sticky or blunt ends. We

will be using the restriction enzyme called MluCI, an isoschizomer of Tsp509I. They are isoschizomers

of each other because they both recognize the same genetic sequence (Vanamee et al., 2010). Tsp509I

has been used in various studies before. Use of this enzyme is quick and practical while also being low-

cost (Mahami-Oskouei et al., 2011). MluCI can be ordered online through New England Bio Labs which

is what we would do.

DNA transfer using plasmids To get the DNA from the apple to the banana, we would use agrobacterium tumefaciens

bacterium’s plasmid. After removing the plasmid, we would treat both it and the DNA of the

apple with the restriction enzyme to form sticky ends on both the plasmid and the DNA region

of interest. The two would then be allowed to connect. The recombinant DNA would then be

inserted back into the bacteria which would be allowed to colonize.

PyroMark Q96 ID Once we create the new DNA for the pectate lyase enzyme, we will use the PyroMark Q96 ID

from Qiagen to see the DNA sequence. The PyroMark Q96 ID is a very reliable, fast machine that

been used in many studies. It can and has been used for a wide range of study topics including a

study that aimed to detect bacterial etiology in urine to properly diagnose UTI’s (Lu et al., 2011)

and another that investigated parent-of-origin SNP’ (single nucleotide polymorphisms) in

imprinted genes (Zhang et al, 2013). We would use it to test the bacteria we created to make

sure the DNA from the apple was present.

Use the bacteria to insert the DNA

Once we knew it was present, we would use the bacteria to insert the apple’s DNA into the

chromosome of a banana cell. The plant cells would be allowed to grow in a culture and then

the modified banana would be generated from these clones. All of the cells in the banana will be

affected by this modification.

Grow modified banana trees After successfully growing several of the modified banana trees, we will take some of the

modified bananas and generic bananas and test their ripening times. We would, of course, have

to have constants including the soil they were grown in, and the environment in which they

were allowed to ripen, monitoring factors such as temperature and humidity. We would test the

time it takes for the bananas to reach a point in the ripening process such as no green remaining

on the bananas or when a few brown spots begin to appear.

Negative Outcomes Negative outcomes can be expected with all genetic modification experiments. No one can know

exactly how modifying the DNA will affect the organism, in this case the banana. The taste may

be askew, the bananas may fail to ripen at all, or the plants could fail to grow because we don’t

know exactly how pectate lyase plays a role in the entire growth process.

Negative Outcomes (cont.) There are also risks that the organism could become an invasive species or affect its local

ecology in some way (Wolfenbarger and Phifer, 2000). The most controversy over GMO’s comes

from those worried about long-term effects, but the doors that are opened through transgenic

plants create endless opportunities for new discoveries. (Andow and Zwahlen, 2006).

Literature Cited Andow, D. A., & Zwahlen, C. (2006). Assessing environmental risks of transgenic plants. Ecology Letters,9(2), 196-214. doi:10.1111/j.1461-0248.2005.00846.x

Cooley, D. R., & Goreham, G. A. (2004). ARE TRANSGENIC ORGANISMS UNNATURAL?. Ethics & The Environment, 9(1), 46.

Cuéllar, A., Webber, M. (2010) Wasted Food, Wasted Energy: The Embedded Energy in Food Waste in the United States. Environmental Science & Technology. 44 (16), 6464-6469 http://pubs.acs.org/doi/full/10.1021/es100310d

Mahami-Oskouei, M., Dalimi, A., Forouzandeh-Moghadam, M., & Rokni, M. B. (2011). Molecular Identification and Differentiation of Fasciola Isolates Using PCR- RFLP Method Based on Internal Transcribed Spacer (ITS1, 5.8S rDNA, ITS2). Iranian Journal Of Parasitology, 6(3), 35-42.

Malyska, A., Maciag, K., & Twardowski, T. (2014). Perception of GMOs by scientists and practitioners - the critical role of information flow about transgenic organisms. New Biotechnology, 31(2), 196-202. doi:10.1016/j.nbt.2013.11.004

Prince, R. Feeding Britain: from potatoes to bananas, the tonnes of produce thrown away every day. 2014 Dec 8. The Telegraph. Web. 2015 Oct 25.

Literature Cited (cont.) Payasi, A., Sanwal, G., (2013 June). Pectate lyase activity during ripening of banana fruit. Phytochemistry, 63(3), 243–248. Web. 2015 Oct 28.

Vanamee, E., Viadiu, H., Chan, S., Ummat, A., Hartline, A., Xu, S., Aggarwal, A. (2010 Sep). Asymmetric DNA recognition by the OkrAI endonuclease, an isoschizomer of BamHI Nucl. Acids Res. 39 (2): 712-719. doi:10.1093/nar/gkq779

Lu, J., Yu, R., Yan, Y., Zhang, J., Ren, X. (2011 July). Use of Pyromark Q96 ID pyrosequencing system in identifying bacterial pathogen directly with urine specimens for diagnosis of urinary tract infections. 86(1): 78-81. doi: 10.1016/j.mimet.2011.03.016

Wolfenbarger, L., & Phifer, P. (2000). Biotechnology and ecology - the ecological risks and benefits of genetically engineered plants. Science, 290(5499), 2088-2093.

Zhang, S., Zhao, S., Wang, Z., & Li, C. (2013). Investigation of parent-of-origin SNPs in 5 imprinted genes for forensic purpose. Forensic Science International: Genetics Supplement Series, 4(1), e304-e305. doi:10.1016/j.fsigss.2013.10.155