GENETICS AND HEREDITY

• A trait is a notable feature or quality in a person. Each of us has a different combination of traits that make us unique. Traits are passed from generation to generation. We inherit traits from our parents, and we pass them on to our children.

• Physical traits are characteristics of one’s physical

makeup. These include hair color, eye color, and height.

• Behavioral traits are characteristics of the way one acts. A sheepdog’s herding instinct and a retriever’s desire to fetch are good examples of behavioral traits.

• Predispositions to medical conditions provide increased risk of getting a certain type of a disease. This is also a type of trait that can be passed from parent to child. Some examples of such diseases are sickle-cell anemia, cystic fibrosis, heart disease, cancer, and some types of mental illness.

WHAT TRAITS DO YOU HAVE?

EAR LOBE ATTACHMENT

• Earlobe attachment: If earlobes hang free, they are detached. If they attach directly to the side of the head, they are attached ear lobes. Some scientists report that this trait is due to a single gene for which unattached earlobes is dominant and attached earlobes is recessive. Other scientists believe that this trait is probably due to multiple genes. The size and appearance of the lobes are inherited traits.

TONGUE ROLLING

• Tongue Rolling: In 1940, a famous geneticist noted that about 70% of people of European descent are able to roll up the lateral edges of the tongue, while the remaining 30% were unable to do so. Tongue rolling may be due to a single gene with the ability to roll the tongue a dominant trait and the lack of tongue rolling a recessive trait.

• However, there is some question about the inheritance of tongue rolling because recent studies have shown that around 30% of identical twins do not share the trait.

CLEFT CHIN

CLEFT CHIN

• This trait is reportedly due to a single gene with a cleft chin dominant and a smooth chin recessive.

DIMPLES

DIMPLES

• Dimples are reportedly due to a single gene with dimples dominant (people may exhibit a dimple on only one side of the face) and a lack of dimples recessive.

HANDEDNESS

• Some scientists have reported that handedness is due to a single gene with right-handedness dominant and left-handedness recessive. However, other scientists have reported that the interaction of two genes is responsible for this trait.

FRECKLES

FRECKLES

• This trait is reportedly due to a single gene; the presence of freckles is dominant; the absence of freckles is recessive.

NATURALLY CURLY HAIR

NATURALLY CURLY HAIR

• Early geneticists reported that curly hair was dominant and straight hair was recessive. More recent studies suggest that more than one gene may be involved.

ALLERGIES

• While allergic reactions are induced by things a person comes in contact with, such as dust, particular foods, and pollen, the tendency to have allergies is inherited. If a parent has allergies, there is a one in four (25%) chance that their child will also have allergy problems. This risk increases if both parents have allergies.

HAND CLASPING

HAND CLASPING

• Fold your hands together by interlocking your fingers without thinking about it. Which thumb is on top—your left or your right?

• One study found that 55% of people place their left thumb on top. 45% place their right thumb on top and 1% have no preference.

• A study of identical twins concluded that hand clasping has at least some genetic component.

COLOR BLINDNESS

COLOR BLINDNESS

• Colorblindness is due to a recessive allele located on the X chromosome. Women have two X chromosomes, one of which usually carries the allele for normal color vision. Therefore, few women are colorblind. Men have only one X chromosome, so if they carry the allele for colorblindness, they will exhibit this trait. Thus, colorblindness is seen more frequently in men than in women.

HAIRLINE SHAPE

• Hairline shape is reportedly due to a single gene with a widow’s peak dominant and a straight hairline recessive.

HITCHHIKER’S THUMB

• Someone who has a thumb which bends backwards when extended is said to have a hitchhiker's thumb. This is a genetic trait, and it does not interfere with the thumb's normal functions. Hitchhiker's thumb is also not linked with any other genetic conditions; it is simply an interesting phenotype, akin to people who can curl their tongues. To see if you have a hitchhiker's thumb, make a fist and extend your thumb. If you notice a significant bend, you have inherited this trait. Hitchhiker's thumb is a recessive trait, which means that people must inherit the gene from both parents for it to manifest.

GREGOR MENDEL

• Gregor Mendel was an Austrian monk who experimented with pea plants in the mid-1800s.

• He kept track of a number of traits over several generations, including: color of the seeds, plant height, whether the pod was smooth or wrinkled, and the shape of the seeds.

• Over time, he noticed that certain plants produced new plants that were similar to the parents. For example, short "parent" plants produced more short plants, and tall "parent" plants have tall offspring.

• When he bred plants with different traits, he found patterns in the appearance of the new plants. He concluded that some genes are dominant and other ones are recessive. Dominant genes hide other genes that are present, and the trait corresponding to that gene will appear. Traits represented by recessive genes will only appear when the dominant gene is not present.

• Genes contain information about a specific characteristic or trait and can either be dominant or recessive. Genes are found on chromosomes, but not all copies of a gene are identical. The different form of a gene is called an allele.

• Alleles are represented using capital letters (dominant) and lower case letters (recessive). When the alleles are identical, the individual is homozygous for that trait. If the pair is made of two different alleles, the individual is heterozygous.

• A homozygous pair of can be either dominant (AA, BB) or recessive (aa, bb). Heterozygous pairs are made up of one dominant and one recessive allele (Aa, Bb). In heterozygous individuals only the dominant allele is expressed, while the other allele, the recessive, is hidden but still present. Capital letters represent dominant genes and lower case letters, recessive genes.

• What does all this mean? Let’s look at an example: In rabbits, brown fur color is dominant over white fur color. We would represent a brown allele with an uppercase “B”. We would represent a white allele with a lowercase “b”.

• If a baby bunny rabbit inherited two dominant alleles “BB”, his fur color would be brown. If the baby bunny rabbit inherited one dominant and one recessive allele “Bb”, his fur color would still be brown. This is because the dominant allele would cover up or hide the recessive allele. Finally, if the baby bunny rabbit inherited two recessive alleles “bb” he would have white fur. White fur would only be possible if no dominant allele was present

• An organism’s appearance is known as its phenotype.

• In bunny rabbits, possible phenotypes for the characteristic of fur color include brown, white, and black. Both inherited alleles together form an organism’s genotype.

• Our baby rabbits with brown fur could have a genotype of either “BB” or “Bb”. Another of our baby rabbits may have white fur and their genotype would be expressed “bb”.

• Phenotype refers to the appearance or expression of the trait, and genotype refers to the genetic make-up of the gene.

• Remember: If you are asked for a phenotype, you should give a characteristic (brown or white).

• If you are asked for a genotype, you should give an allele combination “bb” or “Bb” or “BB”.

PUNNETT SQUARES

• The Punnett square is a diagram used to predict an outcome of a particular cross or breeding experiment.

• Used by biologists to determine the probability of an offspring having a particular genotype or phenotype, the Punnett square is a summary of every possible combination of two maternal (mother) alleles with two paternal (father) alleles for each gene being studied in the cross.

• The mathematical chance that something will happen is known as probability. Probability is usually written as a percentage or a ratio. When you toss a coin, there is a 50% chance of getting heads. In a parent with two different alleles, such as Pp, there is a 50% chance of offspring getting a "P" and a 50% chance of getting a "p".

• In this example, the Dad rabbit is homozygous for grey fur and the mother is homozygous for brown fur. Each parent contributes one of their alleles to their offspring.

• Because grey is dominant, their offspring will all be heterozygous for grey fur.

• If we were asked for the genotypic probability or ratio, we would express it as 100% Bb or 4:4 Bb.

• If we were asked for the phenotypic probability or ratio, we would express it as 100% grey or 4:4 grey.

YOU TRY IT!

• Use a Punnett Square to predict the genotype and phenotype of the offspring in a cross between two heterozygous (hybrid) tall (Tt) pea plants.

• In pea plants, yellow peas are dominant over green plants. Use a Punnett square to predict the phenotype and genotype of the offspring in a cross between a plant heterozygous/hybrid for yellow (Yy) peas and a plant homozygous/purebred for green (yy) peas.

• In pea plants, yellow peas are dominant over green plants. Use a Punnett square to predict the phenotype and genotype of the offspring in a cross between two plants heterozygous/hybrid for yellow peas.

• In pea plants, round peas are dominant over wrinkled peas. Use a Punnett square to predict the phenotype and genotype of the offspring in a cross between homozygous/purebred for round peas (RR) and a plant homozygous/purebred (rr) for wrinkled peas

• In pea plants, round peas are dominant over wrinkled peas. Use a Punnett square to predict the phenotype and genotype of the offspring in a cross between two plants heterozygous/hybrid for round peas.

 

MEET MOM- MODEL A MEET DAD- MODEL B

  

     

Red antennae3 body segmentsCurly tail2 pairs of legsGreen noseBlack feetGreen eyes

Green antennae2 body segmentsStraight tail 3 pairs of legsBlue noseGreen feet2 eyes

RR or Rr Red antennae rr Green antennaeSS or Ss 3 body segments ss 2 body segmentsCC or Cc Curly tail cc Straight tailLL or Ll 3 pairs of legs ll 2 pairs of legsBB or Bb Blue nose bb Green noseGG or Gg Green feet gg Black feetEE or Ee 2 eyes ee 3 eyes

GENOTYPES AND PHENOTYPES

TRAIT DAD’S ALLELE

MOM’S ALLELE

COIN TOSS RESULTS

NEW MODEL BABY GENOTYPE

NEW MODEL BABY PHENOTYPE

ANTENNAE COLORNUMBER OF BODY SEGMENTS

TAIL SHAPENUMBER OF LEG PAIRSNOSE COLORFOOT COLOR

NUMBER OF EYES

BUG FAMILY TRAITS

BUG BABY PICTURE                   

BUG BABY PICTURE

DNA

• How do cells know what their role is in your body? For example, how do cells in your inner ear know that their role is to support hearing instead of something else, like helping your heart to beat?

• Instructions providing all the information necessary for a living organism to grow and live reside in the nucleus of every cell. These instructions tell the cell what role it will play in your body.

• The instructions come in the form of a molecule called DNA. DNA encodes a detailed set of plans, like a blueprint, for building different parts of the cell.

• The DNA comes in the form of a twisted ladder shape scientists call a double helix. The ladder’s rungs are built with the four-letter DNA alphabet: A, C, T, and G.

• The DNA code letters stand for: A = Adenine T = Thymine C = Cytosine G = Guanine

• A always pairs with T, and C always pairs with G

• The information in DNA is stored as a code made up of four chemical bases: adenine (A), guanine (G), cytosine (C), and thymine (T).

• Human DNA consists of about 3 billion bases, and more than 99 percent of those bases are the same in all people.

• The order, or sequence, of these bases determines the information available for building and maintaining an organism, similar to the way in which letters of the alphabet appear in a certain order to form words and sentences.

• DNA bases pair up with each other, A with T and C with G, to form units called base pairs.

• Each base is also attached to a sugar molecule and a phosphate molecule. Together, a base, sugar, and phosphate are called a nucleotide.

• Nucleotides are arranged in two long strands that form a spiral called a double helix. The structure of the double helix is somewhat like a ladder, with the base pairs forming the ladder’s rungs and the sugar and phosphate molecules forming the vertical sidepieces of the ladder.

• An important property of DNA is that it can replicate, or make copies of itself. Each strand of DNA in the double helix can serve as a pattern for duplicating the sequence of bases. This is critical when cells divide because each new cell needs to have an exact copy of the DNA present in the old cell.

• DNA (deoxyribonucleic acid), is the key molecule in genetics and heredity. This molecule is found in every cell of every living organism and is composed of genes, each of which influences specific genetic traits (phenotype; e.g. earlobe attachment).

• The composition of each gene (genotype) determines how it influences each trait. Different compositions of the same trait are called alleles (e.g. an allele for free earlobes (F) and an allele (f) for attached earlobes.

• In humans, as well as in other plants and animals), DNA is packaged into threadlike bodies called chromosomes. These chromosomes are found in pairs. Humans have 23 pairs of chromosomes (a total of 46 chromosomes )in each cell, except for the reproductive cells (called gametes), which have only one set of chromosomes (23 chromosomes).

• This means that every human cell (except the gametes) carries two copies of every gene (two alleles). The alleles of a specific gene can be the same (homozygous) or different (heterozygous).

• All humans share 99.9% identical DNA. • If you examine DNA from any two humans,

you will find it to be 99.9% identical. However, if you visit any shopping mall in America you will clearly see many differences in appearance and behavior.

• These differences are the result of variation in only 0.1% of our DNA. On the molecular level, this 0.1% variation means that approximately 1 out of every 1000 DNA bases is different in each human.

• The DNA strand is made of letters: ATGCTCGAATAAATGTCAATTTGA• The letters make words: ATG CTC GAA TAA ATG TCA ATT TGA• The words make sentences: <ATG CTC GAA TAA> <ATG TCA ATT TGA>• These sentences are called genes. Genes tell

the cells to make other molecules called proteins. Proteins enable a cell to perform special functions, such as working with other groups of cells to make hearing possible.

• Genes are instruction manuals for our bodies. They are the directions for building all the proteins that make our bodies function. Genes are made of DNA.

• One strand of our DNA contains many genes. All of these genes are needed to give instructions for how to make and operate all the parts of our bodies.

• A gene is the basic physical and functional unit of heredity. Genes, which are made up of DNA, act as instructions to make molecules called proteins. In humans, genes vary in size from a few hundred DNA bases to more than 2 million bases. The Human Genome Project has estimated that humans have between 20,000 and 25,000 genes.

• Every person has two copies of each gene, one inherited from each parent. Most genes are the same in all people, but a small number of genes (less than 1 percent of the total) are slightly different between people. Alleles are forms of the same gene with small differences in their sequence of DNA bases. These small differences contribute to each person’s unique physical features.

CHROMOSOMES

• Each cell in our body contains a lot of DNA. In fact, if you pulled the DNA from a single human cell and stretched it out, it would be three meters long! That’s about as long as a car! How does all that DNA fit into a cell?

• The DNA is packaged into compact units called chromosomes. The packaging if DNA into a chromosome is done in several steps, starting with the double helix of DNA. Then the DNA is wrapped around some proteins. These proteins are packed tightly until they form a chromosome. Chromosomes are efficient storage units for DNA.

• In the nucleus of each cell, the DNA molecule is packaged into thread-like structures called chromosomes. Each chromosome is made up of DNA tightly coiled many times around proteins called histones that support its structure.

• Each chromosome has a constriction point called the centromere, which divides the chromosome into two sections, or “arms.” The short arm of the chromosome is labeled the “p arm.” The long arm of the chromosome is labeled the “q arm.” The location of the centromere on each chromosome gives the chromosome its characteristic shape, and can be used to help describe the location of specific genes.

• In humans, each cell normally contains 23 pairs of chromosomes, for a total of 46. Twenty-two of these pairs, called autosomes, look the same in both males and females. The 23rd pair, the sex chromosomes, differ between males and females. Females have two copies of the X-chromosome, while males have one X and one Y-chromosome.

• Each human cell has 46 chromosomes. All of the DNA is organized into two sets of 23 chromosomes. We get genetic material from both of our parents---that’s why children look like both their mom and their dad.

• Looking at a set of chromosomes, you can see that matching chromosomes are lined up in pairs---one each from mom and dad. Although the DNA double helix is too small to see, chromosomes can be viewed with a microscope.

• There are two sex chromosomes that determine whether you are male or female. Female sex cells have two X chromosomes (XX) and male sex cells have an X and a Y chromosome (XY). This means that it is always the father who contributes the chromosome that determines the sex of the offspring!

• Not all living things have 46 chromosomes, like humans. Mosquitoes, for instance, have 6. Onions have 16. Carp have 104.

PROTEINS

• Proteins are the machines that make all living things function, from viruses to daffodils, spiders to sea lions, and everything in between.

• Our bodies are made up of about 100 trillion cells! Each of these cells is responsible for a specific job. Every cell contains thousands of different proteins, which work together as tiny machines to run the cell. You can think of proteins as parts of a car engine---each part looks different, and they all do separate jobs to make the engine run.

• Proteins do most of the work in cells and are required for the structure, function, and regulation of the body’s tissues and organs.

• Proteins are made up of hundreds or thousands of smaller units called amino acids, which are attached to one another in long chains. There are 20 different types of amino acids that can be combined to make a protein. The sequence of amino acids determines each protein’s unique 3-dimensional structure and its specific function.

• The journey from gene to protein is complex and tightly controlled within each cell. It consists of two major steps: transcription and translation. Together, transcription and translation are known as gene expression.

• During the process of transcription, the information stored in a gene’s DNA is transferred to a similar molecule called RNA (ribonucleic acid) in the cell nucleus.

• Translation, the second step in getting from a gene to a protein, takes place in the cytoplasm. The RNA interacts with ribosomes to “read” the sequence of bases.

• Each sequence of three bases, called a codon, usually codes for one particular amino acid (building block of protein).

• A codon is a sequence of three bases that code for an amino acid.

• RNA assembles the protein, one amino acid at a time. Protein assembly continues until the ribosome encounters a “stop” codon.

• The flow of information from DNA to RNA to proteins is one of the fundamental principles of molecular biology. It is so important that it is sometimes called the “central dogma.”

• Through the processes of transcription and translation, information from genes is used to make proteins.

• Cells use the information encoded in their genes, which are sort of a protein library, as the “blueprint” for making proteins. Each gene in the DNA encodes information about how to make an individual protein.

• When a cell needs to make a certain protein, specialized machinery within the cell’s nucleus read the gene and then uses this information to produce a molecular message in the form of RNA, a molecule very similar to DNA. RNA moves from the nucleus into the cytoplasm of the cell. Once there, the cell’s protein-making machinery, the ribosome, reads the message and produces a protein that exactly matches the instructions laid out in the gene.

• Once made, the protein travels to the part of the cell where it is needed and begins to work. Each step in making a protein itself requires the work of highly specialized proteins.

• The Human Genome Project was an international research effort to determine the sequence of the human genome and identify the genes that it contains.

• The project formally began in 1990 and was completed in 2003, 2 years ahead of its original schedule.

• The work of the Human Genome Project has allowed researchers to begin to understand the blueprint for building a person. As researchers learn more about the functions of genes and proteins, this knowledge will have a major impact in the fields of medicine, biotechnology, and the life sciences.